Investigation of the Expression of Serine Protease in Vibrio vulnificus

Abstract

Vibrio vulnificus is a Gram-negative estuarine bacterium that causes infection in immuno-compromised patients, eels, and shrimp. V. vulnificus NCIMB2137, a metalloprotease-negative strain isolated from a diseased eel, produces a 45-kDa chymotrypsin-like alkaline serine protease known as VvsA. The gene encoding vvsA also includes another gene, vvsB with an unknown function; however, it is assumed to be an essential molecular chaperone for the maturation of VvsA. In the present study, we used an in vitro cell-free translation system to examine the maturation pathway of VvsA. We individually expressed the vvsA and vvsB genes and detected their mRNAs. However, the sample produced from vvsA did not exhibit protease activity. A sodium dodecyl sulfate (SDS) analysis detected the VvsB protein, but not the VvsA protein. A Western blotting analysis using a histidine (His)-tag at the amino terminus of proteins also showed no protein production by vvsA. These results suggested the translation, but not the transcription of vvsA. Factors derived from Escherichia coli were used in the in vitro cell-free translation system employed in the present study. The operon of the serine protease gene containing vvsA and vvsB was expressed in E. coli. Although serine proteases were produced, they were cleaved at different sites and no active mature forms were detected. These results indicate that the operon encoding vvsA and vvsB is a gene constructed to be specifically expressed in V. vulnificus.

INTRODUCTION

Vibrio vulnificus is a common Gram-negative halophilic estuarine bacterium that is the leading cause of seafood-related deaths in many countries.¹⁾ Septicemia is the most lethal infection caused by V. vulnificus, with an average mortality rate >50%. A serine protease called VvsA was previously suggested to be the virulence factor in V. vulnificus strains isolated from diseased eels.²⁾ These strains were responsible for severe systemic infections in cultured eels.^3,4)

VvsA is a 45-kDa chymotrypsin-like protease derived from the 59-kDa intermediate product remaining after the removal of the C-terminal 14-kDa polypeptide (Fig. 1). VvsA is an orthologue of the extracellular protease produced by V. parahaemolyticus, the causative agent of wound infection and gastroenteritis in humans.⁵⁾ VvsA is involved in characteristic skin damage during infection in humans and may cause external and internal hemorrhaging in eel vibriosis.⁶⁾ The gene vvsA and downstream gene vvsB constitute an operon, with VvsB functioning as the molecular chaperone for VvsA.⁷⁾ Similar operons have been found in V. parahaemolyticus, V. alginolyticus, V. harveyi, and Photobacterium profundum. VvsA shares a high homology of 63–76% with all homologues, whereas that of VvsB is 29–56%.

Fig. 1. Schematic Representation of the Maturation Process of VvsA

Cell-free protein synthesis systems have recently emerged as a powerful technological platform for rapid, efficient, and cost-effective production. Difficulties are sometimes associated with the expression of bacterial proteins due to their potent toxicity towards the producer. Therefore, the in vitro protein synthesis machinery is a technical boon. Senoh et al. identified the crucial amino acid residues leading to the inactivation of V. vulnificus hemolysin (VVH) using an in vitro cell-free translation system.⁸⁾

In the present study, we attempted to synthesize the active form of serine protease using an in vitro cell-free translation system for the functional characterization of VvsA.^8,9)

MATERIALS AND METHODS

Bacterial Strains and Growth Conditions

V. vulnificus NCIMB2137 isolated from eels was used in the present study. Bacterial strains were grown in Luria–Bertani medium at 37 °C with appropriate antibiotics.

Generation of the DNA Template to Clone vvsA and vvsB Genes Encoding Serine Proteases

The rapid translation system (RTS100 E. coli HY Kit, 5PRIME) is an in vitro protein synthesis system that uses Escherichia (E.) coli lysates. In the present study, DNA in a linear form or cloned in the expression vector pIVEX2.4d was used for RTS. Linear DNA fragments (N-terminal histidine (His)-tag) were used as substrates for RTS of vvsA. Two types of vvsA, vvsA (GenBank accession number, AB509375, wild-type vvsA) and the vvsA-S369A mutant were used. Circular DNA was used for RTS of vvsB (GenBank accession number, AB509375, wild-type vvsB) and vvsAB (wild-type).

The sequences of primers used to prepare these gene fragments are shown in Table 1. Genomic DNA (200 ng) was used for the full-length amplification of the vvsA gene (1999 bp) using vvsA-f and vvsA-r (Table 1). To prepare the gene fragment of vvsA-S369A, two-step PCR was used. One fragment of 1388 bp was amplified with the primers vvsA-f and vvsA-R1 and another fragment of 565bp with vvsA-F2 and vvsA-r. These fragments were fused to generate the vvsA-S369A product.

Table 1. Primers Used in This Study

Primer	Sequence (5′→3′)
vvsA-f	CGCTTAATTAAACATATGACCTTCCGCCGATGGCCTTCGACGA
vvsA-r	TTAGTTAGTTACCGGATCCCTTACTGGAAGGTTAATGTCCAGCTA
vvsA-S	GCGCGGCCGCTTCCGCCGATGGC
vvsA-F2	CGATTACGAGTACTACAATGGCACGGCAATGGCGAC
vvsA-R1	GTCGCCATTGCCGTGCCATTGTAGTACTCGTAATCG
vvsB-F	CTTTAAGAAGGAGATATACCATGTTCCGCCGATGGCCTTCGACGA
vvsB-r	TGATGATGAGAACCCCCCCCTTACTGGGTGTACAGTTGCCTAAC
vvsA-SalI	GGGCGAATTGGAGCTCTTCATAGAACTATCTTCTTATGTTTTG
pBlue-kpnI-vvsA-R	ACAAAAGCTGGGTACTTACTGGAAGGTTAATGTCCAG
pBlue-kpnI-vvsB-termR	ACAAAAGCTGCCATGGAATCGCAAGGCAGCTCCTCTTAAG

Underlined: Overlapping regions. Bold: vvsA-F2 and vvsA-R1 were changed amino acids. The restriction enzyme site on the vector multicloning site (MCS).

In the second PCR, 100 ng of the PCR product from the first PCR was directly used. During this reaction, adapter primers were used to add the His₆-Tag along with the upstream regulatory elements at the 5′ end and downstream regulatory elements at the 3′ end of the final PCR product.

The genomic DNA of V. vulnificus NCIMB2137 was used to amplify the vvsB gene without a signal peptide sequence. This construct was cloned into the expression vector pIVEX2.4d, followed by transformation into E. coli DH5α. The positive transformant was cultivated at 37 °C overnight, and the recombinant plasmid was purified for subsequent use in RTS.

Sequencing of the Cloned Mutant Gene (vvsA-S369A)

After clones had been amplified by PCR, the nucleotide sequence of the amplicon of vvsA (S369A) was elucidated using the Brilliant Dye™ Terminator Cycle Sequencing Kit and ABI PRISM™ 3500 Genetic Analyzer.

RT-PCR

Total RNA was extracted from RTS products using the RNeasy Mini Kit and treated with deoxyribonuclease (DNase)I. Two hundred nanograms was added to the Ready-To-Go RT-PCR Kit and incubated at 42 °C for 30 min for cDNA synthesis. PCR amplification was performed using appropriate primers and confirmed by electrophoresis.

In Vitro Synthesis of Proteins Using RTS

The in vitro expression of the serine protease gene was performed using the cell-free system of RTS ProteoMaster (Roche, Switzerland). The morphology of templates was linear DNA (0.1 µg) or circular DNA (0.5 µg). A reaction volume of 50 µL was prepared according to the manufacturer’s protocol. The reaction was performed at 400 rpm at 25 °C for 6 h. A protease inhibitor was added during metalloprotease expression only.

Purification of His-Tagged Proteins and the Protease Assay

The Capturem His-tagged Purification Mini-prep Kit (TaKaRa Bio, Otsu, Japan) was used to purify RTS products. After the protein synthesis reaction, 200 µL of the reaction solution was purified according to the manufacturer’s protocol. The protease activities of RTS products were measured according to the method described by Miyoshi et al.¹⁰⁾

Sodium Dodecyl Sulfate (SDS)-Polyacrylamide Gel Electrophoresis (PAGE) Analysis and N-Terminal Amino Acid Sequencing

RTS products (10 µL) and the periplasmic fraction isolated from E. coli were subjected to SDS-PAGE followed by staining with Coomassie brilliant blue R-250. Images were captured with the Molecular Imager ChemiDoc™ XRS+ Imaging System (BIO-RAD, U.S.A.).

The polyvinylidene difluoride (PVDF) membrane (BIO-RAD) was stained with Amido Black T. The N-terminal amino acid sequence was elucidated using an Applied Biosystem Precise Sequencer (Applied Biosystem, Foster city, CA, U.S.A.)

Folding of the Urea-Denatured Supernatant through Stepwise Dialysis in the Presence of Purified VvsB

We mixed 40 µL of purified VvsB (0.293 µg/µL) with 40 µL of the culture supernatant of V. vulnificus NCIMB2137. The culture supernatant was prepared from a centrifugal culture solution incubated at 26 °C overnight. Ten microliters of this mixture were stored for later use as a positive control to measure azocasein activity. This mixture was placed on a dialysis membrane (Spectra/Por^® Dialysis membrane Standard RC Trial kit MWCO: 6–8 kDa, SPECTRUM LABS. COM., U.S.A.) and immersed in 7 M urea solution overnight. Ten microliters of this denatured mixture were stored for later use as a negative control in the azocasein assay. The remaining mixture was immersed in 5 M urea solution followed by 3 M and then 1 M urea. After the mixture was dialyzed against 20 mM Tris–HCl solution (pH 8.0), azocasein activity of the re-folded mixture was measured along with positive and negative controls. The data is the mean + standard error (S.E.) of three experiments. It indicates the significant difference (p < 0.05) by T TEST.

Preparation of the Cell Membrane Fraction

Log phase bacteria were collected and washed twice with 2% NaCl solution. The bacterial pellet was suspended in pure water to allow osmotic shock lysis. After centrifugation, the bacterial pellet was dissolved in 50 mM Tris–HCl buffer (pH 8.0) and used as the cell membrane fraction.

Preparation of E. coli Recombinants and the Extracted Protein Fraction

The 2123 bp of vvsA and 2553 bp fragments of the vvsAB genes including operator/promoter (O/P) and Shine–Dalgarno sequence (SD) derived from V. vulnificus NCIMB2137. These fragments were amplified using the primer sets Prom-vvsA-salI (SalI): pBlue-kpnI-vvsA-R (KpnI) for vvsA and Prom-vvsA-salI (SalI): pBlue-kpnI-vvsB-termR (KpnI) for vvsAB (Table 1). These PCR products were cloned into the pBluescript IIKS+ vector containing the Amp^r marker by the HiFi DNA Assembly Master Mix kit (NEW ENGLAND BioLabs). These recombinants were transformed into E. coli HB101 (TaKaRa). The periplasmic fraction was collected by the osmotic shock method.¹¹⁾

RESULTS AND DISCUSSION

Serine protease has been shown to play a significant role as a virulence factor in Vibrionaceae.^2,6,7) In the present study, we used RTS to express V. vulnificus serine protease, VvsA, a 45-kDa toxic factor (Fig. 1), which may be responsible for eel vibrios,⁶⁾ and attempted to identify essential factors for the construction of functional VvsA.

Since we used a cell-free system, each target gene was cloned without a signal peptide (Fig. 1).

DNA fragments (vvsA or vvsB) were inserted into the pIVEX2.4d expression vector and used to synthesize proteins in RTS at 30 °C for 6 h. Total RNA was isolated from each sample and RT-PCR was performed to detect the expression of mRNA. Detectable levels of the mRNAs of these two genes were noted after 6 h (Fig. 2B). However, expression at the protein level was not detected for VvsA, whereas a band was observed at approximately 11.7 kDa for VvsB. To confirm that the protein band at 11.7 kDa in the gel was VvsB, it was extracted and its N-terminal amino acid sequence was elucidated. The results obtained showed that the band was VvsB (Fig. 2C).

Fig. 2. Gene Arrangement Map Used and Expression in the Rapid Translation System (RTS)

(A) 1 and 2 are the gene arrangements of vvsA and vvsB, respectively, inserted into the pIVEX2.4d expression vector. T7P; T7 Promoter, RBS; Ribosome-binding site, ATG; Start codon, His₆-tag; gene for the tag of His₆, Xa; Factor Xa restriction protease cleavage site, T7T; T7 Terminator. (B) mRNA expression from linear vvsA and circular vvsB DNA in RTS. DNA fragments 1 and 2 shown in A were inserted into the pIVEX2.4d expression vector. At the time of use, the vector into which gene fragment 1 was inserted was linearized by cleavage. The genes prepared were incubated at 30 °C for 6 h in RTS (RTS100 E. coli HY Kit, Roche Molecular Biochemicals). After the incubation, total RNA was isolated and RT-PCR was performed to detect the mRNAs of vvsA and vvsB. The products were electrophoresed on a 1.0% agarose gel. Lane 1, RT-PCR of vvsA (446 bp); lane 2, RT-PCR of vvsB (325 bp), lane M, size markers (1-kb Plus DNA Ladder; 100–12000 bp). (C) Protein expression from vvsA and vvsB DNA in RTS. The reaction mixtures obtained by the incubation in the in vitro protein synthesis system were separated by SDS-PAGE followed by Coomassie brilliant blue staining of the gel. Lanes 1 and 2 are samples recovered from solutions containing vvsA and vvsB, respectively. Lane M, molecular weight markers (10, 15, 20, 25, 37, 50, 75, 100, 150, and 250 kDa).

The serine protease from Aeromonas sobria (ASP) is dependent on another downstream protein called ORF2 for proper folding. The maturation of ASP with ORF2 was previously shown to be initiated in the periplasmic space and ASP became active after dissociating from ORF2.^12,13) We considered VvsB to also act as a molecular chaperone during the synthesis of VvsA. Since VvsA and VvsB were expressed separately in RTS, VvsB did not associate with VvsA or contribute to the construction of the active form of VvsA.

In many serine proteases, a chaperone facilitates the construction of the active form. These chaperones are often encoded as an intramolecular chaperone in the sequence.^14–18) The nascent protein containing serine protease and the chaperone often make contact with the cell membrane and the nascent serine protease becomes the active form. In RTS, there were no interactions with the cell membrane. This may be another reason for the unsuccessful production of VvsA in RTS.

A previous study reported that the serine protease of V. vulnificus underwent autolysis.¹⁹⁾ A possible reason why we did not detect the expression of VvsA was self-catalyzed proteolysis before folding. Therefore, we produced a variant gene of vvsA in which serine at the catalytic center was replaced with alanine to produce the inactive mutant VvsA-S369A.

The Western blot using the His-tag antibody only detected the expression of positive control GFP and VvsB. As a result of the N-terminal amino acid sequence of the protein corresponding to VvsB detected by a Western blotting, it was confirmed to the sequence of VvsB, as indicated in Fig. 3A. However, there was still no detectable mutant VvsA produced. This result eliminated the possibility of VvsA degradation due to autolysis. We then attempted to express VvsA in the presence of VvsB by mixing the linear DNA product of vvsA and circular vvsB at a 1 : 1.6 ratio. The expression of VvsB, but not VvsA was noted (Fig. 3B).

Fig. 3. Detection of Gene Products by a Western Blot Analysis

Genes were incubated in RTS at 25 °C for 6 h, and the products were treated with 5% SDS at 100 °C for 5 min and subjected to SDS-PAGE. Thereafter, the proteins were transferred to a PVDF membrane and detected using anti-His-tag serum, and the proteins possessing the His-tag were detected with anti-His-tag serum. (A) Protein detection from linear vvsA and circular vvsB DNA in RTS. Samples 2, 3, and 4 shown in the figures were prepared from reaction mixtures containing pIVEX2.4d (vector), the linear vvsA (wild-type), and the vector inserted with vvsB, respectively. (B) Protein detection from each mixture genes in RTS. Sample 3 was prepared from the reaction mixture containing two genes: the linear vvsA (wild-type) and the vector inserted with vvsB. Sample 4 was also prepared from reaction mixtures containing two genes: the linear vvsA mutant (VvsA-S369A) and the vector inserted with vvsB. These genes were mixed in samples 3 and 4 at vvsA : vvsB = 1 : 1.6 as the DNA ratio. The sample in lane 1 is GFP.

Additionally, there was no protease or peptidase (Synthetic substrate: succinyl (Suc)-alanine (Ala)-Ala-proline (Pro)-phenylalanine (Phe)-4-methylcoumaryl-7-amide) activity by any RTS products.

The effective renaturation of reduced lysozyme was previously achieved by the gentle removal of urea by dialysis.²⁰⁾ To define the role of VvsB, we performed the in vitro refolding process on the urea-denatured culture supernatant (containing VvsA) by slow dialysis in the presence of purified VvsB, and measured protease activity after refolding. The results obtained showed the loss of proteolytic activity in the culture supernatant after dialysis (Fig. 4 lanes 3 and 4). This result suggests three scenarios: the in vitro refolding process did not generate properly folded VvsA; factors other than VvsB may contribute to the stable and active conformation of VvsA; and VvsA was only expressed in a properly folded structure using bacterial machinery. Moreover, the protease activity of the culture supernatant was elevated in the presence of purified VvsB (Fig. 4). This result indicates that VvsB suppressed the autolysis of VvsA and, thus, warrants further investigation.

Fig. 4. Effect of VvsB on the Protease Activity Expression

Azocasein (5 mg/mL) was used as a substrate for the measurement of protease activity. One protease unit (PU) was defined as the amount of enzyme hydrolyzing 1.0 µg of azocasein in 1 min. Lanes 1, 2: the white bar indicates a mixture of the His-tag purification buffer 10 µL and V. vulnificus culture supernatants 40 µL; the gray bar represents the mixture of purified VvsB 10 µL (0.293 µg/µL) and 40 µL of V. vulnificus culture supernatants; lanes 3, 4: the samples obtained after the removal of urea after slow dialysis. The data are the mean + S.E. of three experiments. The asterisk (*) indicates the significant difference (p < 0.05) by T TEST.

Since none of the protocols described above led to the production of the active form of VvsA using RTS, we employed the conventional method of protein expression using the bacterial system. We cloned the vvsA and vvsAB operon in the pBluescript IIKS+ vector and transformed it into E. coli HB101. Figure 5 shows the results of the SDS-PAGE analysis of the periplasmic fraction extracted from each of the recombinants.

Fig. 5. Analysis of Proteins Released into the Periplasmic Space of E. coli from the Operon of vvsA and the Proteolytic Activity of Recovered Samples

(A) Arrangement of the functional regions of two gene fragments inserted into the vector. The numbers shown in the upper part of vvsAB are the amino acid numbers of the precursor of VvsA synthesized in V. vulnificus. P; Promoter, SD; Shine–Dalgarno sequence, SP; Signal peptide, PP; Propeptide. Amino acid number of the precursor of VvsA. (B) SDS-PAGE analysis of samples obtained from the periplasmic space. The periplasmic fraction obtained by the osmotic shock method from E. coli recombinants harboring the pBluescript IIKS+ vector with the insertion of vvsA or vvsAB. The periplasmic fraction was precipitated by 10% trichloroacetic acid, treated with 5% SDS at 100 °C for 5 min, and loaded onto 10% SDS-PAGE. Lane M, Protein molecular weight marker (250, 150, 100, 75, 50, 37, 25, 20, 15, and 10 kDa); lane 1, pBluescript IIKS+ vector; lane 2, vvsA inserted into the pBluescript IIKS+ vector; lane 3, vvsAB inserted into the pBluescript IIKS+ vector. (C) Proteolytic activity of samples. Azocasein (5 mg/mL) was used as a substrate for the measurement of protease activity in the periplasmic fraction obtained from recombinants. One protease unit (PU) was defined as the amount of enzyme hydrolyzing 1.0 µg of azocasein in 1 min. Lane 1, the pBluescript IIKS+ vector; lane 2, vvsA inserted into the pBluescript IIKS+ vector; lane 3, vvsAB inserted into the pBluescript IIKS+ vector; lane 4, the V. vulnificus NCIMB2137 culture supernatant collected from the stationary phase at 30 °C.

Figure 5A shows a map of the genes introduced into this vector that were expressed in the E. coli system. Figure 5B shows the results of SDS-PAGE on the expressed proteins. Two protein bands were characteristically detected in two samples containing different vectors, which were inserted with the vvsA and vvsAB operon, respectively (protein bands a and b in Fig. 5B). These two bands were not in the sample containing the vector (native) (Fig. 5B, lane 1).

Bands a and b were excised, and their amino terminal sequences were elucidated. The amino terminal sequences of a and b were GVAILSTVTVGEGVL and PTKYMVKFKEGSNAR, respectively. Based on these sequences, a was the region covering from glycine (Gly)-322 of VvsA and b was that from Pro-41 of VvsA (Fig. 5A).

A previous study reported that VvsA was synthesized as a 57-kDa precursor (pro-VvsA), which was later converted into the 45-kDa mature form after the removal of the N-terminal signal peptide and propeptide in V. vulnificus.⁷⁾ Cleavage at the site of VvsA in E. coli (between the 40th and 41st and between the 321st and 322nd) did not occur in V. vulnificus (Fig. 5A). Cleavage at this site interfered with the production of active VvsA.

Cleavage in E. coli was observed in samples with and without vvsB (Fig. 5B, lanes 2, 3). The sample in lane 3 in Fig. 5B was recovered from the solution containing a vector possessing vvsB. However, there was no evidence that the protein of VvsB was produced from E. coli in the sample. These results indicated that cleavage in E. coli was independent of VvsB.

In the absence of the synthesis of VvsB, this cleavage may occur, even in V. vulnificus. The present results showed that active VvsA was not produced in the absence of VvsB. VvsB did not appear to be expressed from the operon encoding vvsA in E. coli based on the result of lane 3 in Fig. 5B. However, active VvsA was produced in V. vulnificus. Therefore, the expression of vvsA is a characteristic event of V. vulnificus that does not occur in other bacteria.

Acknowledgments

This research was supported by the Japan Initiative for Global Research Network on Infectious Diseases (J-GRID) from the Ministry of Education, Culture, Sport, Science and Technology, Japan, and the Japan Agency for Medical Research and Development (AMED). We express our thanks to Professor Shin-ichi Miyoshi, Professor Keinosuke Okamoto, Dr. Eizo Takahashi, and Dr. Kei Kitahara for their advice. The authors are grateful to Ms. Tsugumi Shiokawa at the Division of Instrumental Analysis for amino acid sequence analyses.

Conflict of Interest

The authors declare no conflict of interest.

REFERENCES

• 1) Jones MK, Oliver JD. Vibrio vulnificus: disease and pathogenesis. Infect. Immun., 77, 1723–1733 (2009).
• 2) Wang J, Sasaki T, Maehara Y, Nakao H, Tsuchiya T, Miyoshi S. Variation of extracellular proteases produced by Vibrio vulnificus clinical isolates: genetic diversity of the metalloprotease gene (vvp), and serine protease secretion by vvp-negative strains. Microb. Pathog., 44, 494–500 (2008).
• 3) Tison DL, Nishibuchi M, Greenwood JD, Seidler RJ. Vibrio vulnificus biotype 2: new biogroup pathogenic for eels. Appl. Environ. Microbiol., 44, 640–646 (1982).
• 4) Senoh M, Miyoshi S, Okamoto K, Fouz B, Amaro C, Shinoda S. The cytotoxin-hemolysin genes of human and eel pathogenic Vibrio vulnificus strains: comparison of nucleotide sequences and application to the genetic grouping. Microbiol. Immunol., 49, 513–519 (2005).
• 5) Chakraborty S, Nair GB, Shinoda S. Pathogenic vibrios in the natural aquatic environment. Rev. Environ. Health, 12, 63–80 (1997).
• 6) Lee CY, Cheng MF, Yu MS, Pan MJ. Purification and characterization of a putative virulence factor, serine protease, from Vibrio parahaemolyticus. FEMS Microbiol. Lett., 209, 31–37 (2002).
• 7) Miyoshi S, Wang J, Katoh K, Senoh M, Mizuno T, Maehara Y. An extracellular serine protease produced by Vibrio vulnificus NCIMB2137, a metalloprotease-gene negative strain isolated from a diseased eel. World J. Microbiol. Biotechnol., 28, 1633–1639 (2012).
• 8) Senoh M, Okita Y, Shinoda S, Miyoshi M. The crucial amino acid residue related to inactivation of Vibrio vulnificus hemolysin. Microb. Pathog., 44, 78–83 (2008).
• 9) Kawase T, Miura F, Debnath A, Imakura K, Miyoshi S. Functional analysis of N-terminal propeptide in the precursor of Vibrio vulnificus metalloprotease by using cell-free translational system. Protein Expr. Purif., 149, 13–16 (2018).
• 10) Miyoshi N, Shimizu C, Miyoshi S, Shinoda S. Purification and characterization of Vibrio vulnificus protease. Microbiol. Immunol., 31, 13–25 (1987).
• 11) Neu HC, Heppel AL. The release of enzymes from Escherichia coli by osmotic shock and during the formation of spheroplasts. J. Biol. Chem., 240, 3685–3692 (1965).
• 12) Kobayashi H, Yoshida T, Miyakawa T, Tashiro M, Okamoto K, Yamanaka H, Tanokura M, Tsuge H. Structural basis for action of the external chaperone for a propeptide-deficient serine protease from Aeromonas sobria. J. Biol. Chem., 290, 11130–11143 (2015).
• 13) Nomura T, Fujii Y, Yamanaka H, Kobayashi H, Okamoto K. The protein encoded at the 3′ end of the serine protease gene of Aeromonas sobria functions as a chaperone in the production of the protease. J. Bacteriol., 184, 7058–7061 (2002).
• 14) Ikemura H, Takagi H, Inouye M. Requirement of pro-sequence for the production of active subtilisin E in Escherichia coli. J. Biol. Chem., 262, 7859–7864 (1987).
• 15) Ikemura H, Inouye M. In vitro processing of pro-subtilisin produced in Escherichia coli. J. Biol. Chem., 263, 12959–12963 (1988).
• 16) Gadwal S, Korotkov KV, Delarosa JR, Hol WG, Sandkvist M. Functional and structural characterization of Vibrio cholerae extracellular serine protease B, VesB. J. Biol. Chem., 289, 8288–8298 (2014).
• 17) Marie-Claire C, Ruffet E, Beaumont A, Roques BP. The prosequence of thermolysin acts as an intramolecular chaperone when expressed in trans with the mature sequence in Escherichia coli. J. Mol. Biol., 285, 1911–1915 (1999).
• 18) Yabuta Y, Takagi H, Inouye M, Shinde U. Folding pathway mediated by an intramolecular chaperone: propeptide release modulates activation precision of pro-subtilisin. J. Biol. Chem., 276, 44427–44434 (2001).
• 19) Lim MS, Kim JA, Lim JG, Kim BS, Jeong KC, Lee KH, Choi SH. Identification and characterization of a novel serine protease, VvpS, that contains two functional domains and is essential for autolysis of Vibrio vulnificus. J. Bacteriol., 193, 3722–3732 (2011).
• 20) Maeda Y, Koga H, Yamada H, Ueda T, Imoto T. Effective renaturation of reduced lysozyme by gentle removal of urea. Protein Eng. Des. Sel., 8, 201–205 (1995).