TLR9 Exerts an Oncogenic Role in Promoting Osteosarcoma Progression Depending on the Regulation of NF-κB Signaling Pathway

Abstract

Osteosarcoma (OS) is the most common primary malignant bone tumor and is mainly diagnosed in children. Toll-like receptor 9 (TLR9) is expressed in various tumor cells and was correlated with cancer progression. However, the underlying mechanism of TLR9 on the OS progression remains unclear. Our previous study demonstrated that the expression of TLR9 was positively correlated with the development stage of OS. Herein, we further evaluated the actual roles and the molecular mechanism of TLR9 on regulating OS cell proliferation and metastasis. Our data showed that TLR9 was upregulated in OS cells compared to normal osteoblastic cells, and knockdown of TLR9 inhibited OS cell proliferation and induced cell cycle arrest by the decreased expression of cyclin D1, CDK2, and p-Rb, while TLR9 overexpression exerted the inverse effects. Furthermore, TLR9 overexpression could enhance the migration and invasion activities of the OS cells by the upregulation of matrix metalloproteinases 2 (MMP2) and MMP9, and the opposite result was observed in TLR9-silenced cells. Moreover, the nuclear factor kappa B (NF-κB) signaling pathway was activated by TLR9, and TLR9-induced malignant phenotype of OS cells was abrogated by the NF-κB antagonist BAY11-7082. Our study indicated that TLR9 might play a critical role in facilitating OS progression by activating the NF-κB signaling pathway, which may provide a valuable therapeutic target for OS.

INTRODUCTION

Osteosarcoma (OS), the most common primary solid malignant bone tumor, is diagnosed mostly in children and adolescents, and its annual incidence peaks at 15–19 years of age. For patients aged 14 and younger, the 5-year relative survival rate for osteosarcoma is only 68%.¹⁾ Modern treatments are clinically applied for OS therapy including neoadjuvant chemotherapy, surgery, and postoperative adjuvant chemotherapy.^2,3) However, the 5-year overall survival for OS patients is limited to approximately 60% due to the poor prognosis of patients with metastasis and recurrence.⁴⁾ Therefore, there is an urgent need to find new therapeutic strategies for patients with OS.

Toll-like receptors (TLRs) are pattern-recognition receptors of pathogen and damage-associated molecular patterns, which activate innate immune responses. TLR9 is one of the important members of this family.⁵⁾ In addition to immune cells, the high expression of TLR9 occurred in various cancer samples including liver, esophageal and pancreatic cancer, indicating that TLR9 may play a role in promoting cancer initiation and development.^5–7) We previously reported that the expression of TLR9 was significantly increased both in OS cells and tissues, which was positively correlated with the development stage of OS.⁸⁾ It suggested that the abnormal expression of TLR9 may be associated with the progression of OS. Furthermore, several publications have shown that treatment with TLR9 agonist can promote the proliferation of liver cancer cells and increase the invasion and migration ability of esophageal and lung cancer cells.^7,9) The knockdown of TLR9 significantly inhibits liver cancer growth in vivo and the migration ability of diffuse large B-cell lymphoma in vitro.^6,10) However, the potential function of TLR9 in OS is unclear.

The nuclear factor kappa B (NF-κB) family consists of five transcription factor members that regulate many target genes with a whole variety of functions.¹¹⁾ Growing evidence has implicated that NF-κB is a pivotal player in many processes of the occurrence and progression of cancer by cooperating with multiple other signaling molecules and pathways.^12,13) The activation of the NF-κB signaling pathway was reported to promote the proliferation of OS cells while inhibiting this pathway reduced the metastatic ability of OS cells.^14,15) In addition, TLR9 agonists can upregulate the phosphorylation level of NF-κB p65 in liver cancer cells, while TLR9 antagonists obtain the opposite results, indicating that TLR9 may promote the activation of the NF-κB signaling pathway.⁶⁾

The above findings may be useful for expounding potential prognostic markers of OS. However, little is currently known about the regulation of TLR9 and its actual roles in OS. Therefore, in this study, we investigated the roles and molecular mechanisms of TLR9 on regulating OS cell proliferation and metastasis. We found that TLR9 was upregulated in OS cells and promoted the proliferation and metastasis of OS cells by activating the NF-κB signaling pathway.

MATERIALS AND METHODS

Cell Culture

Human OS cell lines (HOS, MG-63, 143B, and U2OS) and normal osteoblastic cell lines (hFOB 1.19) were purchased from iCell Bioscience Inc. (Shanghai, China) and Cell Collection of the Chinese Academy of Sciences (Shanghai, China) respectively. MG-63, HOS, and 143B were cultured in minimum essential medium (MEM) medium (Solarbio, Beijing, China) supplemented with 10% fetal bovine serum (FBS, Tianhang, Zhejiang, China) and maintained in an incubator with 5% CO₂ at 37 °C. U2OS was cultured in McCoy’s 5A medium (BioInd, Kibbutz Beit-Haemek, Israel) supplemented with 10% FBS and maintained in an incubator with 5% CO₂ at 37 °C. hFOB 1.19 was cultured in Dulbecco’s modified Eagle’s medium (DMEM)/F12 medium (Sigma-Aldrich, St. Louis, MO, U.S.A.) supplemented with 10% FBS and maintained in an incubator with 5% CO₂ at 33.5 °C.

Cell Treatment

To silence TLR9 in MG-63 and HOS cells, small interfering RNA (siRNA) for TLR9 (si-TLR9-1, si-TLR9-2) or siRNA negative control (si-NC) were transfected into the cells using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, U.S.A.) and incubated for 48 h. siRNA transfection was performed after cell seeding for 24 h and upon reaching 70% confluence. TLR9 overexpression vector and empty vector (control) were transfected in the same way. To inhibit the activation of the NF-κB pathway, MG-63 cells were further treated with the NF-κB antagonist, BAY11-7082 (10 µM; Aladdin, Shanghai, China). Treatment was performed beginning 24 h after TLR9 overexpression vector transfection and for an additional 24 h.

Cell Viability

Cell viability was accessed by using a Cell Counting Kit-8 (CCK-8, Solarbio). MG-63 and HOS cells were seeded in the 96-well plate (7000 cells per well) and incubated with 10 µL of CCK-8 solution for 2 h to determine viability at 0, 12, 24, 48, and 72 h. Absorbance was measured at a wavelength of 450 nm.

Immunofluorescence Assay

Cells were fixed with 4% paraformaldehyde (Sinopharm Group Co., Ltd., Shanghai, China) for 15 min, and permeated by phosphate-buffered saline (PBS) containing 0.1% Triton X-100 (Beyotime Biotech Co., Ltd., Shanghai, China). Then, cells were blocked with 1% bovine serum albumin (Sangon Biotech, Shanghai, China) for 15 min at room temperature and incubated with primary antibodies at 4 °C overnight. After washing for three times with PBS, cells were incubated with Cy3-labeled goat anti-rabbit immunoglobulin G (IgG) (Invitrogen) for 1 h at room temperature. The cells were further counter-staining with 40,6-diamidino-2-phenylindole (DAPI, Aladdin). Ultimately, cells were observed and photographed by fluorescence microscopy (Olympus, Tokyo, Japan).

5-Ethynil-2′-deoxyuridine (EdU) Assay

Following incubation with 10 µM EdU (KeyGen Biotech., Nanjing, China) solution for 2 h, cells were fixed with 4% paraformaldehyde for 15 min and washed by PBS containing 3% bovine serum albumin. Then, the cells were permeated by 0.5% Triton X-100 and incubated with Click-iT reagent for 30 min. Finally, nuclei were stained with DAPI for 5 min, and the cells were visualized by fluorescence microscopy.

Cell Invasion Assay

Invasion assays were performed by using the transwell chambers (Corning Incorporated, Corning, NY, U.S.A.) with Matrigel-coated inserts. The bottom compartment was added 800 µL medium with 10% FBS. The cell suspension was added to the top compartment and allowed to invade for 24 h in the incubator. The cells were fixed with 4% paraformaldehyde (Aladdin) and then stained with crystal violet (AMRESCO China, Solon, U.S.A.). The cells that crossed the inserts counted as the number of cells under phase-contrast microscopy (Olympus).

Wound-Healing Assay

Cell migration was accessed by wound-healing assay. The cells were seeded and cultured for 24 h. The medium was replaced by the medium without FBS after the cells reached 80% confluence. The cells were treated with 1 µg/mL of Mitomycin C (MedChemExpres, Monmouth Junction, NJ, U.S.A.) for 1 h before scratching. A scratch was made by the pipette tip and migration distance was measured at 0  and 24 h. The assays were documented using phase-contrast microscopy.

Cell Cycle Assay

Cell cycle assays were performed by using the cell cycle detection kit (Biosharp, Hefei, China). Briefly, the cells were trypsinized and suspended in PBS. Cells were fixed using 70% ethanol overnight at 4 °C. After centrifugation to remove ethanol, the cells were stained with a 500 µL working solution containing 25 µL propidium iodide and 10 µL deoxyribonuclease (DNase)-free ribonuclease (RNase) at room temperature. FACScan flow cytometry (ACEA Biosciences, Inc., San Diego, CA, U.S.A.) was used for analysis.

Western Blot

The total protein of cells was extracted with lysis buffer (Beyotime Biotech) containing phenylmethanesulfonyl fluoride (Beyotime Biotech). The protein was resolved using sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) after quantitation and denaturation and then transferred to polyvinylidene difluoride membranes (Millipore, Billerica, MA, U.S.A.). After blocking, protein bands were incubated with primary antibodies at 4 °C overnight and secondary antibodies at room temperature, following by the visualization with the enhanced chemiluminescence detection reagents (Beyotime Biotech). The primary antibodies used in this study are as follows: TLR9 antibody (1 : 1000, ABclonal, Shanghai, China), cyclin D1 antibody (1 : 1000, ABclonal), CDK2 antibody (1 : 1000, ABclonal), p-Rb antibody (1 : 1000, ABclonal), Rb antibody (1 : 1000, ABclonal), matrix metalloproteinases 2 (MMP2) antibody (1 : 1000, ABclonal), MMP9 antibody (1 : 1000, ABclonal), p-IκBα antibody (1 : 1000, CST, Danvers, MA, U.S.A.), IκBα antibody (1 : 1000, CST), p-NF-κB p65 antibody (1 : 1000, CST), NF-κB p65 antibody (1 : 1000, CST), β-actin (1 : 1000, Santa Cruz, Dallas, TX, U.S.A.).

Quantitative RT-PCR (qRT-PCR)

Total RNA of cells was isolated and collected using TRIpure reagent (BioTek Instruments, Winooski, VT, U.S.A.) following the manufacturer’s instruction. The RNA samples were quantitated and reverse transcribed to cDNA using the BeyoRT II M-MLV reverse transcriptase (Beyotime Biotech). qPCR was conducted using the SYBR Green probe (Solarbio) and 2 × Taq PCR MasterMix (Solarbio) in an Exicycler 96 fluorescence quantitative PCR instrument (Bioneer Corporation, Daejeon, Korea). β-Actin was used as the internal control. The relative mRNA expression of targeted genes was normalized to β-actin and calculated using the 2^−ΔΔCT method. The primer sequences used in this study are as follows: TLR9 forward, CCGTGCAGCCGGAGATGTTT, and TLR9 reverse, CCGTGAATGAGTGCTCGTGGTAG. β-Actin forward, GGCACCCAGCACAATGAA, and β-actin reverse, TAGAAGCATTTGCGGTGG.

Statistical Analysis

Statistical analyses were performed by GraphPad Prism Software 7.0 (GraphPad Prism, San Diego, CA, U.S.A.). Data are presented as mean ± standard deviation (S.D.). All experiments were repeated as least for triplicate. Comparison between two groups was analyzed by Student’s t-test. Effects sizes were calculated for the samples to confirm the power of the analysis due to the small sample size as described previously.¹⁶⁾ It has been confirmed that using the t-test is feasible for small sample size when the effect size is large (> 0.8).^17,18) Differences among multiple groups were compared by using one-way or two-way ANOVA. A p-value of less than 0.05 was considered to be significant.

RESULTS

The Expression of TLR9 Was Upregulated in OS Cells

We first determined the expression of TLR9 in normal osteoblastic cell line and four cultured OS cell lines. Our data showed that the mRNA and protein expression of TLR9 in all tested OS cell lines (HOS, MG-63, 143B, and U2OS) was increased to varying degrees (Fig. 1A). Since the expression of TLR9 in MG-63 and HOS cells was relatively mild and they have been widely used in OS research, they were used in the next research. To investigate the potential roles of TLR9 on OS cells in vitro, TLR9 was knocked down or overexpressed by its specific siRNA or overexpression vector. Transfection efficiency was shown in Figs. 1B and C, the expression level of TLR9 was downregulated obviously by TLR9 knockdown and upregulated by TLR9 overexpression both in MG-63 and HOS cells.

Fig. 1. TLR9 Expression Was Upregulated in OS Cells

(A) qRT-PCR and Western blot analysis of TLR9 expression in OS cells and normal osteoblastic cell. (B and C) mRNA and protein expression of TLR9 in MG-63 and HOS cells with TLR9 knockdown or overexpression. Data are shown as mean ± S.D. N = 3. * p < 0.05, ** p < 0.01, compared with hFOB1.19, si-NC or Vector group.

TLR9 Promoted the Proliferation and Induced Cell Cycle Transition of OS Cells

We next investigated the effect of TLR9 on proliferation and cell cycle progression. The results of CCK-8 assay showed that cell proliferation was markedly suppressed after silencing TLR9 (Fig. 2A). On the contrary, TLR9 overexpression dramatically promoted the proliferation of OS cells. Furthermore, the EdU assay demonstrated that the percentage of mitotic cells was decreased by TLR9 knockdown and increased by TLR9 upregulation (Fig. 2B). Moreover, the cell cycle assay indicated that TLR9 played a key role in cell growth, as the G0/G1 phase fraction was increased and the cells in the S and G2/M phase were decreased by TLR9 downregulation and vice versa (Figs. 3A, B). Results of Western blotting showed that the levels of G1/S checkpoint protein cyclin D1, cyclin-dependent kinase-2 (CDK2), and phosphorylation of retinoblastoma protein (Rb) were attenuated by TLR9 knockdown, whereas TLR9 overexpression conversely enhanced their expression (Fig. 3C). These results suggested that TLR9 promoted proliferation and induced cell cycle transition of OS cells.

Fig. 2. TLR9 Promoted the Proliferation of OS Cells

(A) Cell viability was detected at 0, 12, 24, 48, and 72 h using CCK-8 assay in MG-63 and HOS cells; (B) the effect of TLR9 on proliferation was detected by EdU assay. Data are shown as mean ± S.D. N = 3. * p < 0.0, ** p < 0.01, ^##p < 0.01 compared with si-NC or Vector group.

Fig. 3. TLR9 Induced OS Cell Cycle Transition

(A, B) Cell cycle progression was analyzed using flow cytometry; (C) Western blot analysis of cell-cycle-related proteins in MG-63 and HOS cells. Data are shown as mean ± S.D. N = 3. * p < 0.05, ** p < 0.01 compared with si-NC or Vector group.

TLR9 Promoted Migration and Invasion of OS Cells

Wound-healing and transwell assays were conducted to OS cells to explore the role of TLR9 in OS progression. As shown in Fig. 4A, the migration ratio of OS cells was significantly suppressed by TLR9 knockdown compared to OS cells transfected with si-NC; while, the opposite result was observed in the TLR9 overexpression OS cells. Similarly, transwell assay showed that the number of invasive cells was greatly reduced by silencing TLR9, and TLR9 overexpression led to the contrary effects (Figs. 4B, C). Furthermore, the relationship between TLR9 and the expression of MMP related to the migration potential of cancer cells was analyzed by Western blotting. The results demonstrated that MMP2 and MMP9 levels were attenuated in the TLR9-silenced OS cells and enhanced in the TLR9 overexpressing OS cells (Fig. 4D). Taken together, the above results replied that TLR9 accelerated cell migration and invasion of OS cells.

Fig. 4. TLR9 Promoted Metastasis of OS Cells

(A) The effect of TLR9 on cell migration was evaluated by wound-healing assay; (B, C) the effect of TLR9 on cell invasion was evaluated by Transwell assay; (D) Western blot analysis of metastasis-associated proteins in MG-63 and HOS cells. Data are shown as mean ± S.D. N = 3. * p < 0.05, ** p < 0.01 compared with si-NC or Vector group.

NF-κB Was Activated by TLR9 in OS Cells

To uncover the relationship between TLR9 and NF-κB, the expression of the NF-κB subunit RelA (NF-κB p65) was detected using Western blot and immunofluorescence assay in MG-63 cells. The result from Western blot demonstrated that the expression of p-kappa B alpha (IκBα) and p-NF-κB p65 was downregulated by the loss of TLR9 and upregulated by the gain of TLR9 (Fig. 5A). The result of IκBα protein expression was opposite (Fig. 5A). Then, immunofluorescence assay demonstrated that the knockdown of TLR9 inhibited translocation of NF-κB p65 into the nucleus, and this process was facilitated by the overexpression of TLR9 (Fig. 5B). These findings provided evidence that NF-κB could be activated by TLR9.

Fig. 5. NF-κB Was Activated by TLR9

(A) Western blot analysis of p-IκBα, IκBα, p-NF-κB p65, and NF-κB p65 expression in MG-63 cells; (B) immunofluorescence assay was used to detect NF-κB p65 expression in MG-63 cells. N = 3.

TLR9 Promoted the Malignant Phenotypes of OS Cells via the NF-κB Signaling Pathway

To further investigate whether the pro-cancer role of TLR9 was mediated by the NF-κB pathway, we overexpressed TLR9 and inhibit the activation of NF-κB by BAY 11-7082 in MG-63 cells. The transfection efficiency was detected by using Western blot and qRT-PCR, and the results demonstrated that the level of TLR9 was higher in TLR9-overexpressed cells than that of the empty vector group (Fig. 6A). Moreover, the cell viability curve of MG-63 cells was significantly increased after TLR9 overexpression (Fig. 6B). Then, the effect induced by TLR9 overexpression cells was attenuated by BAY 11-7082 treatment. In addition, wound-healing assays indicated that the promoted migration ability of MG-63 cells with TLR9 overexpression was reversed by BAY 11-7082 treatment (Fig. 6C). The expression of TLR9 was upregulated in TLR9-overexpressed cells with or without BAY 11-7082 treatment (Fig. 6D). Furthermore, the expression levels of phosphorylated IκBα and NF-κB p65 were dramatically upregulated following TLR9 overexpression and these high levels were attenuated by BAY 11-7082 treatment, while the result of IκBα expression was opposite (Fig. 6E). There was no obvious change in NF-κB protein expression. Taken together, these data indicated that TLR9 promoted the growth and migration activities of OS cells via the NF-κB signaling pathway.

Fig. 6. TLR9 Promoted the Growth and Migration of MG-63 Cells via the NF-κB Signaling Pathway

(A) mRNA and protein expression of TLR9; (B) CCK-8 assay was used to detect cell viability after TLR9 overexpression and treatment with BAY 11-7082 in MG-63 cells; (C) wound-healing assay was used to evaluate the migration of MG-63 cells; (D) Western blot analysis of TLR9 expression; (E) Western blot analysis of p-IκBα, IκBα, p-NF-κB p65, and NF-κB p65 expression. N = 3. * p < 0.05, ** p < 0.01 compared with Vector, Vector + DMSO, TLR9 + DMSO or Vector + BAY 11-7082 group.

DISCUSSION

OS is the most common tumor in bone tissue and one of the cancers with the lowest survival rate among pediatric cancers. The high levels of histological and molecular heterogeneity as well as the complexity of the molecular mechanisms make it a challenge for improving the therapeutic efficacy, especially for the patient with unresectable, recurrent, and metastatic OS.^4,19) TLR9 is an innate immune receptor, which is widely overexpressed in various cancers. In recent years, its tumor-promoting effects have been widely investigated.^20,21) In our earlier study, we found that TLR9 was overexpressed in OS cells and tissues that was related to the cancer stage.⁸⁾ However, the pathophysiology function and mechanism of TLR9 contributed to OS remains incompletely understood. In addition, studies have revealed that the NF-κB signaling pathway is involved in the proliferation and metastasis of OS cells, and is affected by TLR9 in cancer.^22–24) Here we have provided novel evidence for the important effects of TLR9 in regulating the proliferation, cell cycle progression, and metastasis of OS cells, and proposed a mechanism that involves the NF-κB signaling pathway.

The occurrence and development of tumors is a complex multistep process involving a large number of functional molecules. TLRs have the ability to recognize endogenous ligands (danger-associated molecular patterns), and the excessive release of these danger-associated molecules is associated with many types of cancer.^25,26) Up to now, accumulating data indicate that functional TLRs are also present on cancer cells, and their expression (including TLR9) is correlated with disease prognosis.²⁷⁾ The high level of TLR9 is found to be associated with a poor prognosis in most types of cancer.^28–30) For instance, an analysis indicated that TLR9 is elevated in glioma cells, which contributes to glioma growth, and silencing of TLR9 abrogated glioma development.³¹⁾ The similar results were obtained in our previous study, we found that TLR9 expression is correlated positively with the OS stage.⁸⁾ Furthermore, it is well established that the loss of normal cell cycle control is the hallmark of human cancers, which poses a challenge for cancer treatment.³²⁾ TLR9 can induce an accumulation of the G1 phase and lengthening of the S-phase in cancer cells.³³⁾ In human lung cancer cells, TLR9 antagonist was reported to have a direct effect on the cell cycle entry. Further, the expression of cell cycle-related proteins including cyclin D1, CDK4 was found to be reduced as well.³⁴⁾ Cyclin D1 is a cell cycle regulatory protein that regulates the G1 to S-phase transition of the cell cycle. Cyclin D1 overexpression is linked to the development and progression of cancer.³⁵⁾ These data suggest that TLR9 had a unique role in controlling cell cycle and proliferation. In line with these previous studies, our data confirmed the proliferation and cell cycle-promoting properties of TLR9 in OS cells. However, several publications have shown that the absence of TLR9 expression is associated with poorer prognosis, and TLR9 agonist can lead to decreased proliferation.^36,37) The differential expression of TLR9 in the pathophysiology of cancer may be resulted from its high tumor specificity.

The metastasis of tumor cell to lung tissue is still one of the main causes of mortality in OS patients.³⁷⁾ TLR9 overexpression or TLR9-ligands is able to induce invasion, contributing to poor prognosis of cancers in most cases.^36,38) In prostate cancer cells, high expression of TLR9 is associated with a higher probability of lymph node metastasis. Further silencing of TLR9 could inhibit its migration and invasion.³⁹⁾ Similarly, in the current study, TLR9 promoted the migration and invasion activity of OS cells by regulating the expression of MMP2 and MMP9. This was worthwhile because the members of MMP are considered important factors related to tumor metastasis.⁴⁰⁾ MMP2 and MMP9 have been reported to be downstream molecules of the TLR9 signaling pathway, and they are identified in functional analysis of the TLR9 signaling network in regulating cell migration and invasion,⁴¹⁾ which is consistent with our results. These data demonstrated the active role of TLR9 in the metastatic potential of OS cells.

Although TLR9 regulates proliferation and metastasis in a variety of cancer cells, the underlying mechanism of TLR9 in cancer progression remains unclear.⁹⁾ TLR9 dysregulation can drive autoinflammatory diseases⁴²⁾ TLR9 induces the overproduction of inflammatory mediators by activating multiple signaling factors including NF-κB, leading to a higher risk of chronic inflammatory diseases and cancer.⁴³⁾ The NF-κB family of transcription factors plays an essential role in innate and adaptive immune responses and inflammatory processes.⁴⁴⁾ NF-κB participates in the progression of cancer through crosstalk and coordination with multiple other signaling molecules and pathways.¹²⁾ An in vitro and in vivo evidence suggests that the agent blocking NF-κB and its downstream effector molecules could exert anti-proliferative and apoptosis-inducing effects in OS and may possibly be a novel strategy for OS treatment.⁴⁵⁾ Previous study demonstrates that NF-κB acts as a pivotal role in the mechanism of TLR4 or TLR3 that drives lung cancer progression.⁴⁶⁾ In colon cancer cells, O’Leary et al. reported that TLR4 could accelerate the cell adhesion via NF-κB, thereby enhancing the cell metastasis potential.⁴⁷⁾ Further, TLR9 inhibitor could decrease capability of gastric cancer cell migration by inhibiting the activity of NF-κB p65.⁴⁵⁾ These studies indicate that the pro-cancer effects of TLR proteins are at least partly mediated by NF-κB p65. The similar results were proven in our study, as evidenced by the p65 inhibitor BY 11-7082-induced-anticaner results. Our data implied that TLR9 might facilitate the malignant phenotypes of OS cells by activating NF-κB signaling pathway (Fig. 7).

Fig. 7. Schematic Diagram of the Potential Underlying Mechanism of TLR9 on Promoting OS Progression

CONCLUSION

Our findings indicated that high expression of TLR9 was associated with a higher probability of proliferation and metastasis of OS. Furthermore, NF-κB p65 can be activated by TLR9, and TLR9 might promote OS progression via the NF-κB signaling pathway. These findings may enhance the understanding and provide a potential therapeutic target for OS.

Acknowledgments

This study was supported by the 2018 Heilongjiang Postdoctoral Financial Assistance [LBH-Z18193].

Conflict of Interest

The authors declare no conflict of interest.

REFERENCES

• 1) Siegel RL, Miller KD, Fuchs HE, Jemal A. Cancer statistics, 2021. CA Cancer J. Clin., 71, 7–33 (2021).
• 2) Lindsey BA, Markel JE, Kleinerman ES. Osteosarcoma overview. Rheumatol. Ther., 4, 25–43 (2017).
• 3) Ren Y, Lin Y, Chen J, Jin Y. Disulfiram chelated with copper promotes apoptosis in osteosarcoma via ROS/mitochondria pathway. Biol. Pharm. Bull., 44, 1557–1564 (2021).
• 4) Matsuoka K, Bakiri L, Wolff LI, Linder M, Mikels-Vigdal A, Patiño-García A, Lecanda F, Hartmann C, Sibilia M, Wagner EF. Wnt signaling and Loxl2 promote aggressive osteosarcoma. Cell Res., 30, 885–901 (2020).
• 5) Zambirinis CP, Levie E, Nguy S, et al. TLR9 ligation in pancreatic stellate cells promotes tumorigenesis. J. Exp. Med., 212, 2077–2094 (2015).
• 6) Liu Y, Yan W, Tohme S, Chen M, Fu Y, Tian D, Lotze M, Tang D, Tsung A. Hypoxia induced HMGB1 and mitochondrial DNA interactions mediate tumor growth in hepatocellular carcinoma through Toll-like receptor 9. J. Hepatol., 63, 114–121 (2015).
• 7) Zhang Y, Wang Q, Ma A, Li Y, Li R, Wang Y. Functional expression of TLR9 in esophageal cancer. Oncol. Rep., 31, 2298–2304 (2014).
• 8) Jing Y, Liang H, Zhang Y, Cleveland J, Yan J, Zhang D. Up-regulation of toll-like receptor 9 in osteosarcoma. Anticancer Res., 35, 5839–5843 (2015).
• 9) Ren T, Xu L, Jiao S, Wang Y, Cai Y, Liang Y, Zhou Y, Zhou H, Wen Z. TLR9 signaling promotes tumor progression of human lung cancer cell in vivo. Pathol. Oncol. Res., 15, 623–630 (2009).
• 10) Nie M, Yang L, Bi X, Wang Y, Sun P, Yang H, Liu P, Li Z, Xia Y, Jiang W. Neutrophil extracellular traps induced by IL8 promote diffuse large B-cell lymphoma progression via the TLR9 signaling. Clin. Cancer Res., 25, 1867–1879 (2019).
• 11) Dolcet X, Llobet D, Pallares J, Matias-Guiu X. NF-kB in development and progression of human cancer. Virchows Arch., 446, 475–482 (2005).
• 12) Hoesel B, Schmid JA. The complexity of NF-κB signaling in inflammation and cancer. Mol. Cancer, 12, 86 (2013).
• 13) Kitajima T, Muroi M, Yamashita N, Tanamoto K. Toll-like receptors required for dermatophagoides farinae to activate NF-κB. Biol. Pharm. Bull., 37, 74–80 (2014).
• 14) Jiang W, Cai X, Xu T, Liu K, Yang D, Fan L, Li G, Yu X. Tripartite motif-containing 46 promotes viability and inhibits apoptosis of osteosarcoma cells by activating NF-B signaling through ubiquitination of PPAR. Oncol. Res., 28, 409–421 (2020).
• 15) Liao D, Zhong L, Duan T, Zhang R-H, Wang X, Wang G, Hu K, Lv X, Kang T. Aspirin suppresses the growth and metastasis of osteosarcoma through the NF-κB pathway. Clin. Cancer Res., 21, 5349–5359 (2015).
• 16) Faul F, Erdfelder E, Lang AG, Buchner A. G*Power 3: a flexible statistical power analysis program for the social, behavioral, and biomedical sciences. Behav. Res. Methods, 39, 175–191 (2007).
• 17) De Winter JCF. Using the Student’s t-test with extremely small sample sizes. Pract. Assess., Res. Eval., 18, 10 (2013).
• 18) Sullivan GM, Feinn R. Using effect size—or why the p value is not enough. J. Grad. Med. Edu., 4, 279–282 (2012).
• 19) Liu Y, Liu X, Yang S. MicroRNA-221 upregulates the expression of P-gp and Bcl-2 by activating the Stat3 pathway to promote doxorubicin resistance in osteosarcoma cells. Biol. Pharm. Bull., 44, 861–868 (2021).
• 20) Won H, Moreira D, Gao C, Duttagupta P, Zhao X, Manuel E, Diamond D, Yuan Y-C, Liu Z, Jones J, D’Apuzzo M, Pal S, Kortylewski M. TLR9 expression and secretion of LIF by prostate cancer cells stimulates accumulation and activity of polymorphonuclear MDSCs. J. Leukoc. Biol., 102, 423–436 (2017).
• 21) Chandler MR, Keene KS, Tuomela JM, Forero-Torres A, Desmond R, Vuopala KS, Harris KW, Merner ND, Selander KS. Lower frequency of TLR9 variant associated with protection from breast cancer among African Americans. PLOS ONE, 12, e0183832 (2017).
• 22) Zhao J, Ma S-T. Downregulation of lncRNA H19 inhibits migration and invasion of human osteosarcoma through the NF-κB pathway. Mol. Med. Rep., 17, 7388–7394 (2018).
• 23) Gong T, Su X, Xia Q, Wang J, Kan S. Expression of NF-κB and PTEN in osteosarcoma and its clinical significance. Oncol. Lett., 14, 6744–6748 (2017).
• 24) Gao C, Qiao T, Zhang B, Yuan S, Zhuang X, Luo Y. TLR9 signaling activation at different stages in colorectal cancer and NF-kappaB expression. Onco Targets Ther., 11, 5963–5971 (2018).
• 25) Zhao S, Zhang Y, Zhang Q, Wang F, Zhang D. Toll-like receptors and prostate cancer. Front. Immunol., 5, 352 (2014).
• 26) Chan JK, Roth J, Oppenheim JJ, Tracey KJ, Vogl T, Feldmann M, Horwood N, Nanchahal J. Alarmins: awaiting a clinical response. J. Clin. Invest., 122, 2711–2719 (2012).
• 27) Urban-Wojciuk Z, Khan MM, Oyler BL, Fåhraeus R, Marek-Trzonkowska N, Nita-Lazar A, Hupp TR, Goodlett DR. The role of TLRs in anti-cancer immunity and tumor rejection. Front. Immunol., 10, 2388 (2019).
• 28) Väisänen M-R, Jukkola-Vuorinen A, Vuopala KS, Selander KS, Vaarala MH. Expression of Toll-like receptor-9 is associated with poor progression-free survival in prostate cancer. Oncol. Lett., 5, 1659–1663 (2013).
• 29) Wang C, Cao S, Yan Y, Ying Q, Jiang T, Xu K, Wu A. TLR9 expression in glioma tissues correlated to glioma progression and the prognosis of GBM patients. BMC Cancer, 10, 415 (2010).
• 30) Sheyhidin I, Nabi G, Hasim A, Zhang R-P, Ainiwaer J, Ma H, Wang H. Overexpression of TLR3, TLR4, TLR7 and TLR9 in esophageal squamous cell carcinoma. World J. Gastroenterol., 17, 3745–3751 (2011).
• 31) Herrmann A, Cherryholmes G, Schroeder A, Phallen J, Alizadeh D, Xin H, Wang T, Lee H, Lahtz C, Swiderski P, Armstrong B, Kowolik C, Gallia GL, Lim M, Brown C, Badie B, Forman S, Kortylewski M, Jove R, Yu H. TLR9 is critical for glioma stem cell maintenance and targeting. Cancer Res., 74, 5218–5228 (2014).
• 32) Wang L, Yang L, Lu Y, Chen Y, Liu T, Peng Y, Zhou Y, Cao Y, Bi Z, Liu T, Liu Z, Shan H. Osthole induces cell cycle arrest and inhibits migration and invasion via PTEN/Akt pathways in osteosarcoma. Cell. Physiol. Biochem., 38, 2173–2182 (2016).
• 33) Parroche P, Roblot G, Le Calvez-Kelm F, Tout I, Marotel M, Malfroy M, Durand G, McKay J, Ainouze M, Carreira C, Allatif O, Traverse-Glehen A, Mendiola M, Pozo-Kreilinger JJ, Caux C, Tommasino M, Goutagny N, Hasan UA. TLR9 re-expression in cancer cells extends the S-phase and stabilizes p16(INK4a) protein expression. Oncogenesis, 5, e244 (2016).
• 34) Wang L, Zhang S, Cai H, Qi Q, Zhang C, Qi Z, Huang C. Inhibition of TLR9 signaling stimulates apoptosis and cell cycle arrest and alleviates angiogenic property in human cervical cancer cells. Endocr. Metab. Immune Disord. Drug Targets, 22, 510–517 (2021).
• 35) Alao JP. The regulation of cyclin D1 degradation: roles in cancer development and the potential for therapeutic invention. Mol. Cancer, 6, 24 (2007).
• 36) Ronkainen H, Hirvikoski P, Kauppila S, Vuopala KS, Paavonen TK, Selander KS, Vaarala MH. Absent Toll-like receptor-9 expression predicts poor prognosis in renal cell carcinoma. J. Exp. Clin. Cancer Res., 30, 84 (2011).
• 37) Rayburn ER, Wang W, Zhang R, Wang H. Experimental therapy for colon cancer: anti-cancer effects of TLR9 agonism, combination with other therapeutic modalities, and dependence upon p53. Int. J. Oncol., 30, 1511–1519 (2007).
• 38) Ilvesaro JM, Merrell MA, Li L, Wakchoure S, Graves D, Brooks S, Rahko E, Jukkola-Vuorinen A, Vuopala KS, Harris KW, Selander KS. Toll-like receptor 9 mediates CpG oligonucleotide-induced cellular invasion. Mol. Cancer Res., 6, 1534–1543 (2008).
• 39) Luo Y, Jiang Q-W, Wu J-Y, Qiu J-G, Zhang W-J, Mei X-L, Shi Z, Di J-M. Regulation of migration and invasion by Toll-like receptor-9 signaling network in prostate cancer. Oncotarget, 6, 22564–22574 (2015).
• 40) Sato H. Tumor metastasis and MMP inhibitor. Clin. Calcium, 16, 621–626 (2006).
• 41) Merrell MA, Ilvesaro JM, Lehtonen N, Sorsa T, Gehrs B, Rosenthal E, Chen D, Shackley B, Harris KW, Selander KS. Toll-like receptor 9 agonists promote cellular invasion by increasing matrix metalloproteinase activity. Mol. Cancer Res., 4, 437–447 (2006).
• 42) Stanbery AG, Newman ZR, Barton GM. Dysregulation of TLR9 in neonates leads to fatal inflammatory disease driven by IFN-γ. Proc. Natl. Acad. Sci. U.S.A., 117, 3074–3082 (2020).
• 43) Wagner H. The immunobiology of the TLR9 subfamily. Trends Immunol., 25, 381–386 (2004).
• 44) DiDonato JA, Mercurio F, Karin M. NF-κB and the link between inflammation and cancer. Immunol. Rev., 246, 379–400 (2012).
• 45) Zhang Y, Li Y, Li Y, Li R, Ma Y, Wang H, Wang Y. Chloroquine inhibits MGC803 gastric cancer cell migration via the Toll-like receptor 9/nuclear factor kappa B signaling pathway. Mol. Med. Rep., 11, 1366–1371 (2015).
• 46) Zhan Z, Xie X, Cao H, Zhou X, Zhang XD, Fan H, Liu Z. Autophagy facilitates TLR4- and TLR3-triggered migration and invasion of lung cancer cells through the promotion of TRAF6 ubiquitination. Autophagy, 10, 257–268 (2014).
• 47) O’Leary DP, Bhatt L, Woolley JF, Gough DR, Wang JH, Cotter TG, Redmond HP. TLR-4 signalling accelerates colon cancer cell adhesion via NF-κB mediated transcriptional up-regulation of Nox-1. PLOS ONE, 7, e44176 (2012).