Study on the Protective Effect of Schizandrin B against Acetaminophen-Induced Cytotoxicity in Human Hepatocyte

Abstract

Drug-induced liver injury (DILI) occurs frequently worldwide. Acetaminophen (APAP) is a common drug causing DILI. Current treatment methods are difficult to achieve satisfactory results. Therefore, there is an urgent need to provide safe and effective treatment for patients. Schizandrin B (Sch B), the main component of Schisandra, has a protective effect on liver. However, the potential mechanism of Sch B in the treatment of APAP induced liver injury has not been elucidated to date. In our research, we studied the effect of Sch B on protecting damaged liver cells and explored the potential mechanism underlying its ability to reduce APAP liver injury. We found that Sch B could reduce hepatocyte apoptosis, oxidative stress injury and inflammatory response. These effects were positively correlated with the dose of Sch B. Sch B regulated glucose 6-phosphate dehydrogenase expression by upregulating the expression of p21-activated kinase 4 and polo-like kinase 1. Sch B could inhibit the mitogen-activated protein kinase (MAPK)–c-Jun N-terminal kinase (JNK)–extracellular signal-regulated kinase (ERK) signaling pathway and regulate the expression of apoptosis-related proteins to reduce the incidence of cell apoptosis. In addition, Sch B reduced the expression levels of reactive oxygen species and inflammatory cytokines in hepatocyte. Consequently, we described for the first time that Sch B could not only activate the pentose phosphate pathway but also inhibit the MAPK–JNK–ERK signaling pathway, thereby achieving antioxidative and anti-inflammatory effects and inhibiting hepatocyte apoptosis. These findings indicated the potential use of Sch B in curing liver damage induced by APAP.

INTRODUCTION

Drug-induced liver injury (DILI) is a frequently occurring disease with atypical symptoms and difficult diagnosis, and it seriously threatens the health of patients.¹⁾ The main drugs that cause drug-induced liver damage are nonsteroidal anti-inflammatory drugs, anti-tuberculosis drugs and herbal medicines.^2–4) Among these drugs, acetaminophen (APAP) is frequently reported as a drug that causes drug-induced liver injury, and it ranks first among nonsteroidal anti-inflammatory drugs.^5,6) Old age and underlying serious liver disease are major elements for DILI caused by APAP.⁷⁾ The APAP-induced liver injury model is a common liver injury model, which is used to model drug-induced liver injury. The mechanisms of APAP-induced hepatotoxicity are varied.⁸⁾ These mechanisms suggest that the liver lipid peroxidation damage induced by APAP can be alleviated through antioxidant effect. Hepatoprotective drugs can reduce the levels of alanine aminotransferase (ALT) and aspartate aminotransferase (AST), disease the content of malonic dialdehyde (MDA) and inhibit the apoptosis of liver cells induced by APAP in mice.⁹⁾ Inhibition of prolyl hydroxylase 2 activity can increase liver angiogenesis, maintain the body's redox homeostasis, and prevent acute liver injury induced by APAP.¹⁰⁾ The liver toxicity of APAP is also related to changes in CYP2E1 expression.¹¹⁾ Inhibition of liver mitochondrial DNA replication, which leads to mitochondrial dysfunction, is also the mechanism underlying liver damage caused by the drug.¹²⁾ Mitochondrial oxidative stress causes changes in the flux of the mouse respiratory chain, which is crucial in the process of APAP-induced liver injury, although changes in pyruvate dehydrogenase kinase 4 activity is the key factor.¹³⁾

Glucose 6-phosphate dehydrogenase (G6PD) is the most frequently researched molecule regarding liver damage, and it plays a crucial role in oxidative stress and is associated with the development of liver damage.¹⁴⁾ High-throughput detection showed that G6PD activity in the liver of diabetic mice was enhanced significantly as compared with normal mice.¹⁵⁾ When nonalcoholic steatohepatitis fibrosis occurs, G6PD is upregulated in the liver and adipogenesis and fibrosis factors increase. Liver fibrosis can be reversed by reducing the expression level of G6PD.¹⁶⁾ In the pentose phosphate pathway, G6PD is an important restriction enzyme which is related to the occurrence of liver cancer. Inhibiting the activity of G6PD can inhibit the occurrence of tumors.¹⁷⁾ Similarly, reports have shown that G6PD is overexpressed in clear cell renal cell carcinoma and regulated by nuclear factor-kappaB (NF-κB) and phospho-Tyr705-signal transducer and activator of transcription 3 (STAT3) (pSTAT3).¹⁸⁾ Changes in G6PD activity are involved in the accumulation of liver lipids.¹⁹⁾ Resveratrol is an effective component of the Chinese medicine Veratrum grandiflorum, which provides protection against liver damage caused by aluminum phosphide by regulating the oxidative stress response and changing G6PD activity.²⁰⁾

The mitogen-activated protein kinase (MAPK)–c-Jun N-terminal kinase (JNK)–extracellular-response kinase (ERK) signaling pathway is an important signaling pathway widely involved in eukaryotic cell activities.²¹⁾ When the MAPK cascade is unregulated, digestive system diseases, neurodegenerative diseases, metabolic diseases and other diseases occur.^22,23) All members of the JNK family can be affected by a variety of external factors, such as serum, UV light, cytokines and oxidative stress. The occurrence of hepatotoxicity induced by APAP is closely related to the activation of JNK pathway.²⁴⁾ Therefore, once JNK is activated, JNK can increase the transcriptional activity of the factors activating transcription factor 2 (ATF2) and c-jun by phosphorylating them. In addition, JNK can also phosphorylate p53 and regulate the stability of p53. In the MAPK family, extracellular-response kinase (ERK) was discovered later. It carries a big weight in promoting cell multiplication, transformation, and apoptosis,in regulating cell differentiation, in stimulating cell autophagy and in maintaining gene stability.²⁵⁾ By studying the regulation of MAPK signaling pathway, researchers find that related drugs can inhibit the occurrence of liver fibrosis.^26,27) Similarly, the deterioration of cholestatic liver injury is closely related to the activation of NOD-like receptor protein 3 (NLRP3) inflammasome promoted via the MAPK pathway.²⁸⁾

Schisandra has a good clinical effect on liver injury in China.²⁹⁾ Schisandra can reduce the hepatocyte damage caused by APAP by regulating the metabolic pathway of arachidonic acid.³⁰⁾ Schizandrin B (Sch B) is the key component of Schisandra which is protective of liver (Fig. 1) and our previous study has found that Sch B has a protective effect on liver cell injury caused by rifampicin.³¹⁾ The liver protection mechanism of this component is very complicated. Reports have shown that it can reduce clozapine-induced damage to the liver by activating the nuclear factor (NF)-E2-related factor 2 (Nrf2)–antioxidant response element (ARE) signaling pathway.^32,33) However, it has not been reported whether Sch B can protect APAP-induced liver injury by regulating other mechanisms such as pentose phosphate pathway and MAPK–JNK–ERK signaling pathway. Therefore, we conducted in-depth research on the hepatocyte protective effect of Sch B.

Fig. 1. Structure of Sch B in Schisandra

MATERIALS AND METHODS

Drugs

Sch B (110765) was procured from the National Institute of Pharmaceuticals and Biological Products Control. APAP (A7085) was procured from American Sigma-Aldrich company (St. Louis, MO, U.S.A.). The concentration of the Sch B mother liquor was 0.05 mol/L, and it was diluted 1000 times before administration. The concentration of the APAP mother liquor was 2.0 mol/L, and it was diluted 100 times before administration. Both Sch B and APAP were dissolved in dimethyl sulfoxide (DMSO).

Cell Culture

HHL-5 is a human embryonic liver cell line (MZ-1754), and it was purchased from Ningbo Mingzhou Biotechnology Co., Ltd. (China). HHL-5 cells were cultured with RPMI-1640 medium. The cells were passaged 1 : 3 at 37 °C and 5% CO₂, and the experiment was performed when the cell density reached 60–80%.

3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium Bromide (MTT) Determination

This experiment was used to determine the viability of the HHL-5 cells. First, a 96-well plate was used to plate the cells, and then the cells were incubated for 24 h. When all the cells in the 96-well plate proliferated to approximately 70%, the original culture supernatant was discarded and replaced with fresh RPMI-1640 medium. Sch B and APAP with different concentrations were added in the 96-well plate for exactly 48 or 72 h; and then, the cells were washed twice after the drug was sucked out. Afterwards, a mixture of MTT solution and the corresponding medium at a volume of 100 µL and a ratio of 1 : 9 was added into the cells, and the cells were then placed in a cell incubator and incubated for 4 h. After 4 h, the solution in each well was sucked out and replaced with 150 µL DMSO solution. After all operations were completed, the 96-well plate was shaken for about 15 min and the absorbance of each well was tested with a microplate reader (SPECTRA MAX 190, MD, U.S.A.). Based on the absorbance values, the cell viability of the drug treatment group and control group was compared.

Flow Cytometric Assay

HHL-5 cells were both inoculated into a 6-well plate, corresponding medium was added into the plates before placing them into an incubator overnight. The cells were divided into three groups, and each group was treated with APAP and Sch B for 48 h. After that, the cells were all collected into different flow tubes, labeled, and centrifuged. After centrifugation for 5 min, the supernatant was decanted. After that, the cells were centrifuged for 5 min after they were washed with phosphate-buffered saline (PBS). After centrifugation for 5 min, the PBS solution was aspirated and 50 µL 1× binding buffer was added. At last, Annexin-V-fluorescein isothiocyanate (FITC) (2.5 µL, 20 µg/mL) was added. Subsequently, all the cells were incubated at 4 °C for 30 min under dark conditions. After 30 min, the cells were added with 250 µL 1× binding buffer and 2.5 µL propidium iodide (PI). The concentration of PI is 50 µg/mL. In a dark environment, the HHL-5 cells were incubated for 5 min. At the end of all operations, the cells immediately were evaluated by flow cytometry. The scatter diagram of the flow cytometer showed that the cells in the lower right quadrant are early apoptotic cells; the cells in the upper right quadrant are late apoptotic cells; the cells in the lower left quadrant are live cells; and the cells in the upper left quadrant are necrotic cells.

Immunofluorescence Staining

HHL-5 cells were fixed, washed to remove the fixative, and then stained with 4′-6-diamidino-2-phenylindole (DAPI). DAPI staining solution (C1005) was purchased from Beyotime (China). Staining solution was added to cover the sample, which was left at room temperature for 3–5 min. After 3–5 min, the DAPI staining solution was discarded. HHL-5 cells were washed with PBS for approximately 3–5 min each time. There were 3 times in total. Then, under a fluorescence microscope (IX73P2F, SN: 2J44787, Olympus, Tokyo, Japan), the cells were investigated and photographed. Under the microscope, the nuclei of apoptotic cells showed dense staining.

Quantitative RT-PCR (qRT-PCR)

According to the products’ operating instructions, total RNA was isolated using TRIzol reagent. The concentration of RNA was tested using a Quawell Q5000 detector (U.S.A.). Finally, reverse transcription was performed using a TaKaRa Bio reverse transcription system (TaKaRa Bio, Shiga, Japan). Next, add PCR solution. The total volume of PCR solution was 10 µL, and it consisted of the cDNA sample (1 µL), 5′ and 3′ primers (0.4 µL each), ddH₂O (3.2 µL) and SYBR Premix Ex TaqII™ (5 µL). The β-actin was an internal control and amplification was carried out for a total of 40 cycles. Each cycle was carried out as follows: the first step was denaturation at 95 °C. The time was 5 s. The second step was annealing at 60 °C. The time was 30 s. And the third step was an extension at 60 °C. The time was 30 s. The primer sequences (5′ to 3′) were shown blow: G6PD forward, cgaggccgtcaccaagaac; G6PD reverse, gtagtggtcgatgcggtaga; p21-activated kinase 4 (PAK4) forward, ggacatcaagagcgactcgat; PAK4 reverse, cgaccagcgacttccttcg; Polo-like kinase 1 (PLK1) forward, cctgcaccgaaaccgagttat; PLK1 reverse, ccgtcatattcgactttggttgc; interleukin-6 (IL-6) forward, gacgaagctgcaggcacaga; IL-6 reverse, aagagccctcaggctggact; interleukin-1β (IL-1β) forward, ggcggcatccagctacgaat; IL-1β reverse, tcctggaaggtctgtgggca; tumor necrosis factor-alpha (TNF-α) forward, tcttcaagggccaaggctgc; TNF-α reverse, ctggcaggggctcttgatgg; β-actin forward, agctacgagctgcctgacg; β-actin reverse, tgccagggcagtgatctcct.

Western Blot Analysis

HHL-5 cells used for this experiment were treated with 20 mM APAP and different concentrations of Sch B in EP tubes for 48 h. The concentrations of Sch B were 0, 25, 50, and 100 µmol, respectively. Then the HHL-5 cells were collected and lysed by using radio immunoprecipitation assay (RIPA) lysis buffer. After all the protein extracted from different sample, the protein was electrophoresed with known molecular weight markers. In the electrophoresis process, a 12% sodium dodecyl sulfate polyacrylamide gel was used. After electrophoresis, the filter paper, gel, and polyvinylidene difluoride (PVDF) membrane were stacked and placed in transfer buffer for transfer treatment. After the transfer was completed, the front of the PVDF membrane was marked. At room temperature, the PVDF membrane was sealed in blocking solution for about 1 h sequence. The PVDF membrane was then incubated. During the incubation process, the membrane was at first washed three times. Next, the membrane was added with primary antibody diluent and incubated overnight in a refrigerator (4 °C). The concentrations of the primary antibody diluents were as follows: β-actin (1 : 5000), p-JNK (1 : 1000), p-ERK1/2 (1 : 1000), phospho-P38 mitogen-activated protein kinase (p-P38 MAPK) (1 : 1000), poly(ADP-ribose) polymerase (PARP) (1 : 1000), Caspase3 (1 : 1000), Cleaved caspase3 (1 : 1000), B-cell lymphoma/leukemia 2 (Bcl2) (1 : 1000), and Bcl2-associated X protein (Bax) (1 : 1000). Except that the β-actin antibody obtained from Proteintech (U.S.A.), other antibodies were obtained from Cell Signaling Technology company (U.S.A.). Afterwards, the PVDF membrane was washed twice. Next, the horseradish peroxidase secondary antibody dilution (mouse or rabbit, 1 : 10000) was added into the PVDF membrane. At room temperature, the PVDF membrane was incubated for 1 h. After incubation, the membrane was scanned and imaged.

Detection of Reactive Oxygen Species (ROS)

ROS levels were detected by measuring the fluorescence intensity of 2′,7′-dichlorofluorescein diacetate (DCFH-DA) in HHL-5 cells using reactive oxygen species detection equipment. DCFH-DA (#S0033) was purchased from the Beyotime Institute of Biotechnology, Jiangsu Province. Intracellular nonfluorescent DCFH-DA is converted into fluorescent DCFH by esterase deacetylation and ROS. First, the HHL-5 cells were washed two times in PBS. Next, 10 µM DCFH-DA was added to the cells. Then, the HHL-5 cells was incubated for half an hour in dark environment at 37 °C. After 30 min, the ROS level in the HHL-5 cells was measured after the cells were washed two times.

Statistical Analysis

One-way ANOVA followed by Tukey’s test was used for parametric data and Kruskal–Wallis followed by Mann–Whitney’s U test were used for non-parametric data. A p-value <0.05 was considered to be significant. The experimental results are expressed as mean ± standard deviation (S.D.) based on three independent experiments.

RESULTS

Effect of APAP and Sch B on the Survival Rate of HHL-5 Cells

At room temperature, HHL-5 cells were treated with 25, 50, 100, 200, and 400 µM of Sch B for 48 h. In addition, HHL-5 cells were treated with 3.125, 6.25, 12.5, 25, and 50 mM of APAP for 48 h. The IC₅₀ of each drug was determined by MTT method. The survival rate of HHL-5 cells reduced to 50% when the concentration of Sch B was 161.6 µM (Fig. 2A). A concentration of 50 µM Sch B did not cause the inhibition of cell viability. Therefore, this concentration of Sch B was determined to be the protective concentration and used for further experiments. Using the same method, APAP concentrations of approximately 18.36 mM corresponded to the 50% survival rate of HHL-5 cells (Fig. 2B). Therefore, 20 mM was determined as the model concentration of APAP. After establishing the protective concentration of Sch B and the model concentration of APAP, the two drugs were applied to HHL-5 cells for 72 h. In the experiment, there were three groups of cells: Control group, APAP group and APAP + Sch B group. Twenty millimolar APAP was added into HHL-5 cells in APAP group. In APAP + Sch B group, 20 mM APAP and 50 µM Sch B were added into HHL-5 cells. Finally, compared with APAP group, the survival rates of HHL-5 cells in the APAP + Sch B group raised obviously (Figs. 2C, D). To summarize, the experimental results showed that Sch B could cut down the damage to liver cells caused by APAP.

Fig. 2. Effect of APAP and Sch B on the Survival Rate of HHL-5 Cells

(A) Effect of different concentrations (25, 50, 100, 200, and 400 µM) of Sch B on the cell viability of HHL-5 cells for 48 h. (B) Effect of different concentrations (3.125, 6.25, 12.5, 25, and 50 mM) of APAP on the cell viability of HHL-5 cells for 48 h. (C) The cell viability of HHL-5 cells in Control group, APAP group and APAP + Sch B group at different times (0, 4, 8, 12, 24, 48, 72 h). (D) According to the statistics of Fig. 2C, the cell viability of HHL-5 cells in the APAP + Sch B group was significantly higher than that of APAP group after 12 h. (** p < 0.01 vs. Control and ^## p < 0.01 vs. APAP).

Sch B Restrains APAP-Induced Apoptosis of HHL-5 Cells

Flow cytometry and immunofluorescence experiments were performed to further verify whether Sch B could inhibit APAP-induced apoptosis of HHL-5 cells. HHL-5 cells were treated with 20 mM APAP for 48 h in the APAP group. In the APAP + Sch B group, HHL-5 cells were treated with 20 mM APAP and 50 µM Sch B for 48 h. The flow cytometry experimental results showed that Sch B significantly reduce the proportion of necrosis and late apoptosis induced by APAP (Fig. 3A). We selected the late apoptotic cells in the upper right quadrant for statistics. The results showed that Sch B could significantly reduce the late apoptosis of hepatocytes (Fig. 3B). In the immunofluorescence experiment, compared with Control group, the number of apoptotic cells in APAP group was significantly increased. Compared with APAP group, apoptosis of cells in APAP + Sch B group was significantly reduced. The experimental results indicated that APAP-induced apoptosis could be inhibited by Sch B (Fig. 3C).

Fig. 3. Sch B Inhibits APAP-Induced Apoptosis of HHL-5 Cells

(A) In Flow cytometry experiments, the results showed that Sch B could significantly reduce the proportion of necrosis and late apoptosis induced by APAP. (B) Statistical chart of the number of late apoptotic hepatocytes in the three groups. (C) Immunofluorescence experiments showed that Sch B could significantly reduce the number of apoptotic cells induced by APAP. (** p < 0.01 vs. Control and ^## p < 0.01 vs. APAP).

Sch B Attenuates the Inhibition of APAP on the Pentose Phosphate Pathway

In this study, HHL-5 cells in APAP group were treated with 20 mM APAP for 48 h. HHL-5 cells in APAP + Sch B group were treated with 20 mM APAP and 25, 50, and 100 µM Sch B also for 48 h. The results showed that the expression of G6PD, PAK4 and PLK1 genes in pentose phosphate pathway were significantly decreased in APAP group compared with control group (p < 0.01). The expression of G6PD, PAK4 and PLK1 genes in APAP + Sch B group were up-regulated compared with that in APAP group (p < 0.05). Upregulation was positively correlated with the dose of Sch B (Fig. 4).

Fig. 4. Sch B Attenuates the Inhibitory Effect of APAP on Pentose Phosphate Pathway Gene Express

HHL-5 cells were treated with 20 mM APAP or the combination of 25, 50, or 100 µM Sch B and 20 mM APAP for 48 h. Q-PCR analysis showed that 25 µM Sch B upregulated the APAP-induced gene expression of G6PD, PAK4, and PLK1. The upregulate effect of Sch B on gene expression was concentration-dependent. The gene expression of the Control group was set to 1.0. The experimental group data were compared with the Control group and expressed as the mean ± S.D. p < 0.05 was considered to be significant. (** p < 0.01 vs. Control and ^# p < 0.05, ^## p < 0.01 vs. APAP).

Sch B Restrains APAP-Induced Activation of the MAPK–JNK–ERK Pathway

In order to judge whether Sch B could inhibit MAPK–JNK–ERK pathway protein expression levels induced by APAP, HHL-5 cells were treated with drugs for 48 h. In APAP group, the cells were treated with 20 mM APAP. In APAP + Sch B group, the cells were treated with 20 mM APAP and 25, 50 and 100 µM Sch B. The experimental results showed that Sch B could effectively inhibit APAP-induced expression of MAPK–JNK–ERK pathway proteins, which was related to the dose of Sch B (Fig. 5).

Fig. 5. Sch B Inhibits APAP-Induced Activation of the MAPK–JNK–ERK Pathway

HHL-5 cells were treated with 20 mM APAP or the combination of 25, 50, or 100 µM Sch B and 20 mM APAP for 48 h. Western blot analysis showed that 25 µM Sch B could inhibit APAP-induced p-P38 MAPK, p-JNK and p-ERK1/2 protein expression, and the inhibitory effect of Sch B on protein expression was concentration-dependent. (A) WB protein electrophoresis picture. (B) Columnar analysis picture. p < 0.05 was considered to be significant. (** p < 0.01 vs. Control and ^## p < 0.01 vs. APAP).

Sch B Restrains the Expression Level of APAP-Induced Apoptosis Proteins

In order to judge whether Sch B can inhibit apoptotic protein expression induced by APAP, HHL-5 cells were treated with drugs for 48 h. In APAP group, the cells were treated with 20 mM APAP. In APAP + Sch B group, the cells were treated with 20 mM APAP and 25, 50, and 100 µM Sch B. The experimental results indicated that Sch B could inhibit the expression of the proapoptotic proteins PARP, Caspase3, Cleaved caspase3, and Bax induced by APAP. The inhibition was positively correlated with the dose of Sch B. At the same time, Sch B could upregulate the expression of Bcl2 protein, which inhibited apoptosis. These results suggested that Sch B could effectively suppress the expression of APAP-induced apoptotic proteins and reduce cell apoptosis (Fig. 6).

Fig. 6. Sch B Inhibits the Expression Level of APAP-Induced Apoptosis Proteins

HHL-5 cells were treated with 20 mM APAP or the combination of 25, 50, or 100 µM Sch B and 20 mM APAP for 48 h. Western blot analysis showed that 25 µM Sch B could inhibit the expression of the APAP-induced proapoptotic proteins PARP, Caspase3, Cleaved caspase3, and Bax protein expression, and the inhibitory effect of Sch B on protein expression was concentration-dependent. At the same time, Sch B upregulated the expression of Bcl2, which inhibits apoptosis. (A) WB protein electrophoresis picture. (B) Columnar analysis picture. p < 0.05 was considered to be significant. (** p < 0.01 vs. Control and ^## p < 0.01 vs. APAP).

Sch B Restrains APAP-Induced ROS Production

In reactive oxygen detection experiments, HHL-5 cells were treated with drugs for 48 h. In APAP group, the cells were treated with 20 mM APAP. In APAP + Sch B group, the cells were treated with 20 mM APAP and 50 µM Sch B. Reactive oxygen detection experiments showed that the cells in the APAP group produced the levels of ROS which were much higher than that in the APAP + Sch B group. It was confirmed that Sch B could suppress APAP-induced ROS production (Fig. 7).

Fig. 7. Sch B Inhibits the Production of Reactive Oxygen Species Induced by APAP

HHL-5 cells were treated with 20 mM APAP in APAP group. HHL-5 cells were treated with 50 µM Sch B and 20 mM APAP in APAP + Sch B group. The duration of drug action is 48 h. Reactive oxygen detection experiments showed that Sch B could inhibit APAP-induced reactive oxygen species production in the APAP + Sch B group. (A) Active oxygen flow diagram. (B) Columnar analysis picture. (** p < 0.01 vs. Control and ^## p < 0.01 vs. APAP).

Sch B Inhibits APAP-Induced Inflammatory Factor Expression Levels

In this study, HHL-5 cells were also treated with drugs and observed for 48 h. In APAP group, the cells were treated with 20 mM APAP. The results showed that APAP could increase the expression of the IL-6, IL-1β, and TNF-α genes. In APAP + Sch B group, the cells were treated with 20 mM APAP and 25, 50, and 100 µM Sch B and the expression of the IL-6, IL-1β, and TNF-α genes went down. The results suggested that Sch B had a protective effect on HHL-5 cells damaged by APAP, which was related to the dose of Sch B (Fig. 8).

Fig. 8. Sch B Inhibits APAP-Induced Inflammatory Factor Expression Levels

HHL-5 cells were treated with 20 mM APAP or the combination of 25, 50, or 100 µM Sch B and 20 mM APAP for 48 h. Q-PCR analysis showed that 25 µM Sch B inhibited the APAP-induced gene expression of IL-6, IL-1β, and TNF-α. The inhibitory effect of Sch B on gene expression was concentration-dependent. The gene expression of the Control group was set to 1.0. The experimental group data were compared with the Control group and expressed as the mean ± S.D. p < 0.05 was considered to be significant. (** p < 0.01 vs. Control and ^## p < 0.01 vs. APAP).

DISCUSSION

DILI can cause fatal hepatic failure threatening human health globally, and APAP is the main pathogeny of the disease.^34,35) Current treatments for DILI are usually unsatisfactory. Thus, safe and effective treatments are urgently required to serve patients. Traditional Chinese medicine represents an abundant source of valuable material. Researchers have found that Schisandra provides beneficial protection to the liver and could be able to treat drug-induced liver injury with few side effects.³⁶⁾ Sch B is the main active ingredient that confers Schisandra with a protective effect against liver cell damage.³⁷⁾ However, the mechanism underlying its ability to alleviate hepatocyte injury induced by APAP has not yet been completely known. Our research found that Sch B could significantly increase the survival rate of damaged HHL-5 cells and reduce cell apoptosis. At the same time, the regulation mechanism of Sch B inhibiting apoptosis and inflammation was further studied. We found that Sch B could not only activate pentose phosphate pathway, but also inhibit the expression of key factors related to MAPK–JNK–ERK signaling pathway, thereby reducing hepatocyte apoptosis, inhibiting liver inflammation and preventing drug-induced liver injury. The data we got also indicated that the abovementioned effects of Sch B was related to its dose. Results of these studies all prompt that the potential therapeutic value of Sch B is to alleviate liver injuries induced by APAP.

The pentose phosphate pathway plays a key role in the growth and development of cells, and G6PD is an important rate-limiting enzyme in this pathway.^38,39) An important product of this pathway is nicotinamide-adenine dinucleotide phosphate (NADPH). In cells, NADPH can maintain the content of reduced glutathione, thereby reducing ROS, cell oxidative damage and apoptosis.⁴⁰⁾ In leukemia, Recombinant Sirtuin 2 (SIRT2) in the cell modifies G6PD by acetylation, which can increase the activity of G6PD and promote tumor growth.⁴¹⁾ PLK1 is a crux protein that regulates mitosis as well as cell cycle processes, phosphorylates G6PD, promotes G6PD active dimer formation, activates G6PD, and increases NADPH and ribose production.⁴²⁾ Similarly, the G6PD activity can be adjusted by the PAK4 through mediating the degradation of p53 ubiquitination.⁴³⁾ Our research showed that Sch B could upregulate the expression levels of the PAK4, PLK1 and G6PD genes in pentose phosphate pathway to reduce apoptosis.

The MAPK–JNK–ERK signaling pathway is a classic key pathway closely related to cell multiplication, differentiation and apoptosis.⁴⁴⁾ P38 MAPK can regulate the generation of inflammatory mediators, for instance, TNF-α and IL-1.⁴⁵⁾ By inhibiting the degree of phosphorylation of this kinase, the occurrence of liver injury in rats can be reduced.⁴⁶⁾ JNK can be detected in different tissues in the human body and can be specifically activated by MAP Kinase Kinase 7 (MKK7) to promote cell apoptosis.^47,48) A large number of research have stated that extracellular signal-regulated kinase 1/2 (ERK1/2) has close relationship of the initiation and progression of liver fibrosis and liver cancer.^49–51) The active ingredients contained in many substances in nature, such as baicalin and paeonol, can reduce liver cell damage by downregulating the ERK1/2 signaling pathway and even hinder the occurrence of acute liver injury.^52–55) Sch B also inhibited the protein expression levels of p-P38 MAPK, p-JNK, and p-ERK1/2 in the MAPK–JNK–ERK signaling pathway and reduced liver cell damage, and this effect was strengthened as the dose of Sch B increased.

Our experiment also detected representative proteins that represent markers of apoptosis to further verify our experimental results. Among them, the Bcl2 family is the most representative protein family which participate in modulating cell death. This family is composed of antiapoptotic and proapoptotic members.⁵⁶⁾ The antiapoptotic member of this family is Bcl2, and the proapoptotic members mainly include Bax.⁵⁷⁾ Both Bcl2 and Bax can regulate the expression of Caspase3, which is a paramount protein factor in the mitochondrial apoptotic pathway. Caspase3 is a critical enzyme in cell apoptosis. It becomes Cleaved caspase3 after being cleaved and activated. Research has shown that once Caspase3 is activated in a cell, it can cause nuclease activation and DNA breakage, and then the cell will experience programmed death.⁵⁸⁾ Additionally, PARP is mainly cleaved by Caspase3 in the cell, which is an indicator of Caspase3 activation. The presence of PARP means that the cell begins to undergo apoptosis. Our experiments showed that Sch B could increase the level of Bcl2 protein, reduce the levels of Bax, Caspase3, Cleaved Caspase3 and PARP protein, and then inhibit APAP-induced hepatocyte apoptosis.

In addition, through the detection of ROS and inflammatory factors, we also found that the protection of Sch B against liver injury is related not only to its antioxidant effect but also to its anti-inflammatory effect. Studies have reported that ROS are important regulatory factors that can activate the cascade reaction of the caspase family to accelerate cell apoptosis.^59,60) Under physiological conditions, the production and removal of active oxygen in the human body are in a dynamic balance. When the imbalance of oxidative stress occurs, ROS generation greatly exceeds the body’s ROS elimination ability, and the excess ROS begin to attack proteins, thus promoting oxidative damage and disease.^61,62) The report has also shown that in addition to oxidative stress, APAP liver toxicity is also closely related to inflammation.⁶³⁾ APAP metabolites can cause the activation of liver Kupffer cell, infiltration of inflammatory cells and release of many inflammatory cytokines, for instance, TNF-α, IL-6, and IL-1β, thus triggering an inflammatory response.⁶⁴⁾ The recruitment of inflammatory cells into the liver will induce the production of a large amount of toxic ROS, which will aggravate oxidative stress damage. Compare HHL-5 cells of APAP group with HHL-5 cells of Control group, the concentration of ROS and TNF-α, IL-6 and IL-1β mRNA in the APAP group were significantly higher. Sch B intervention can significantly reduce the production of ROS and inhibit the upregulation of inflammatory factor mRNA, suggesting that its protective effect on the liver is relevant to its antioxidant and anti-inflammatory effects.

In conclusion, our results suggest that Sch B not only activates the pentose phosphate pathway, but also inhibits the MAPK–JNK–ERK signaling pathway. Sch B has antioxidant, anti-inflammatory and hepatocyte apoptosis inhibition effects. The liver-protecting mechanism of Sch B is verified in detail, and it is confirmed at the molecular level that Schisandra is an important liver-protecting medicine, thereby supplying a theoretical foundation for the better use of the Schisandra.

Acknowledgments

This research was supported by Grants from Anhui Province University Outstanding Young Talents Support Program Project (gxyq2019035 and gxyq2021184), the General Project of Anhui Natural Science Foundation (2008085MH266), the Natural Science Research Project of Anhui Universities (KJ2020A0448).

Conflict of Interest

The authors declare no conflict of interest.

REFERENCES

• 1) Sebode M, Schulz L, Lohse AW. “Autoimmune(-like)” drug and herb induced liver injury: new insights into molecular pathogenesis. Int. J. Mol. Sci., 18, 1954 (2017).
• 2) Shi Z, Wu J, Yang Q, Xia H, Deng M, Yang Y. Efficacy and safety of milk thistle preventive treatment of anti-tuberculosis drug-induced liver injury: a protocol for systematic review and meta-analysis. Medicine (Baltimore), 99, e23674 (2020).
• 3) Ballet F. FXR: big fish or small fry for drug-induced liver injury? Clin. Res. Hepatol. Gastroenterol., 40, 6–8 (2016).
• 4) He X, Wu Z, Wang L, Gao X, Hai Y, Liu W, Du L, Zhang L, Yang A, Huang N. An important mechanism of herb-induced hepatotoxicity: to produce RMs based on active functional groups-containing ingredients from phytomedicine by binding CYP450s. Chinese Herbal Medicines, 11, 239–257 (2019).
• 5) Grudzinski IP, Ruzycka M, Cieszanowski A, Szeszkowski W, Badurek I, Malkowska A, Bamburowicz-Klimkowska M. MRI-based preclinical discovery of DILI: a lesson from paracetamol-induced hepatotoxicity. Regul. Toxicol. Pharmacol., 108, 104478 (2019).
• 6) Darr U, Sussman NL. Drug-induced liver injury in the setting of analgesic use. Clin. Liver Dis., 24, 121–129 (2020).
• 7) Hidaka N, Kaji Y, Takatori S, Tanaka A, Matsuoka I, Tanaka M. Risk factors for acetaminophen-induced liver injury: a single-center study from Japan. Clin. Ther., 42, 704–710 (2020).
• 8) Bhushan B, Apte U. Acetaminophen test battery (ATB): a comprehensive method to study acetaminophen-induced acute liver injury. Gene Expr., 20, 125–138 (2020).
• 9) Li JQ, Huang WF, He HB, Zhao DX, Hu JZ, Lu SG, Ye JX, Zou K. Study on protective effect of water extract from Sabia parviflora on liver injury in mice induced by acetaminophen. Chung Kuo Chung Yao Tsa Chih, 45, 1433–1439 (2020).
• 10) Zhao L, Zhao J, Gao R, Tian Y, Zhang Y, Tang W, Jiang Y, Li C, Wang M, Yang F, Li G. Intrabody against prolyl hydroxylase 2 ameliorates acetaminophen-induced acute liver injury in mice via concomitant promotion of angiogenesis and redox homeostasis. Biomed. Pharmacother., 123, 109783 (2020).
• 11) Chen K, Guo R, Wei C. Synonymous mutation rs2515641 affects CYP2E1 mRNA and protein expression and susceptibility to drug-induced liver injury. Pharmacogenomics, 21, 459–470 (2020).
• 12) Fromenty B. Alteration of mitochondrial DNA homeostasis in drug-induced liver injury. Food Chem. Toxicol., 135, 110916 (2020).
• 13) Duan L, Ramachandran A, Akakpo JY, Woolbright BL, Zhang Y, Jaeschke H. Mice deficient in pyruvate dehydrogenase kinase 4 are protected against acetaminophen-induced hepatotoxicity. Toxicol. Appl. Pharmacol., 387, 114849 (2020).
• 14) Ben Fredj D, Barro C, Joly P, Thomassin N, Collardeau-Frachon S, Plantaz D, Adjaoud D. Transient liver injury and severe neonatal cholestasis in infant with glucose-6-phosphate dehydrogenase deficiency due to a new mutation. Arch. Pediatr., 26, 370–373 (2019).
• 15) Seo JA, Jung SH, Jeon HY, Lee YJ, Lee JY, Han ET, Park WS, Hong SH, Kim YM, Ha KS. Activity-expression profiling of glucose-6-phosphate dehydrogenase in tissues of normal and diabetic mice. Biochem. Biophys. Res. Commun., 524, 750–755 (2020).
• 16) Loza-Medrano SS, Baiza-Gutman LA, Manuel-Apolinar L, Garcia-Macedo R, Damasio-Santana L, Martinez-Mar OA, Sanchez-Becerra MC, Cruz-Lopez M, Ibanez-Hernandez MA, Diaz-Flores M. High fructose-containing drinking water-induced steatohepatitis in rats is prevented by the nicotinamide-mediated modulation of redox homeostasis and NADPH-producing enzymes. Mol. Biol. Rep., 47, 337–351 (2020).
• 17) Li M, He X, Guo W, et al. Aldolase B suppresses hepatocellular carcinogenesis by inhibiting G6PD and pentose phosphate pathways. Nat. Cancer, 1, 735–747 (2020).
• 18) Zhang Q, Yang Z, Ni Y, Bai H, Han Q, Yi Z, Yi X, Agbana YL, Kuang Y, Zhu Y. Correction to: NF-kappaB and pSTAT3 synergistically drive G6PD overexpression and facilitate sensitivity to G6PD inhibition in ccRCC. Cancer Cell Int., 20, 565 (2020).
• 19) Badmus OO, Olatunji LA. Involvement of glucocorticoid and mineralocorticoid receptors in lipid accumulation and depressed G6PD activity in the livers of rats treated with postpartum oral estrogen-progestin. Naunyn Schmiedebergs Arch. Pharmacol., 392, 913–924 (2019).
• 20) Haghi Aminjan H, Abtahi SR, Hazrati E, Chamanara M, Jalili M, Paknejad B. Targeting of oxidative stress and inflammation through ROS/NF-kappaB pathway in phosphine-induced hepatotoxicity mitigation. Life Sci., 232, 116607 (2019).
• 21) Yang SH, Sharrocks AD, Whitmarsh AJ. MAP kinase signalling cascades and transcriptional regulation. Gene, 513, 1–13 (2013).
• 22) Kim EK, Choi EJ. Compromised MAPK signaling in human diseases: an update. Arch. Toxicol., 89, 867–882 (2015).
• 23) Nho K, Ramanan VK, Horgusluoglu E, Kim S, Inlow MH, Risacher SL, McDonald BC, Farlow MR, Foroud TM, Gao S, Callahan CM, Hendrie HC, Niculescu AB, Saykin AJ. Comprehensive gene- and pathway-based analysis of depressive symptoms in older adults. J. Alzheimers Dis., 45, 1197–1206 (2015).
• 24) Ishitsuka Y, Kondo Y, Kadowaki D. Toxicological property of acetaminophen: the dark side of a safe antipyretic/analgesic drug? Biol. Pharm. Bull., 43, 195–206 (2020).
• 25) Rossi M, Colecchia D, Ilardi G, Acunzo M, Nigita G, Sasdelli F, Celetti A, Strambi A, Staibano S, Croce CM, Chiariello M. MAPK15 upregulation promotes cell proliferation and prevents DNA damage in male germ cell tumors. Oncotarget, 7, 20981–20998 (2016).
• 26) Cai S, Wu L, Yuan S, Liu G, Wang Y, Fang L, Xu D. Carvacrol alleviates liver fibrosis by inhibiting TRPM7 and modulating the MAPK signaling pathway. Eur. J. Pharmacol., 898, 173982 (2021).
• 27) Wang Y, Wang S, Wang R, Li S, Yuan Y. Neferine exerts antioxidant and anti-inflammatory effects on carbon tetrachloride-induced liver fibrosis by inhibiting the MAPK and NF-kappaB/IkappaBalpha Pathways. Evid. Based Complement. Alternat. Med., 2021, 4136019 (2021).
• 28) Hou L, Zhang Z, Yang L, Chang N, Zhao X, Zhou X, Yang L, Li L. NLRP3 inflammasome priming and activation in cholestatic liver injury via the sphingosine 1-phosphate/S1P receptor 2/Galpha(12/13)/MAPK signaling pathway. J. Mol. Med. (Berl.), 99, 273–288 (2021).
• 29) Zhu P, Li J, Fu X, Yu Z. Schisandra fruits for the management of drug-induced liver injury in China: a review. Phytomedicine, 59, 152760 (2019).
• 30) Li X, Li M, Deng S, Yu T, Ma Y, Yang H, Zhang J, Zheng Y, Ma L. A network pharmacology-integrated metabolomics strategy for clarifying the action mechanisms of Schisandrae Chinensis Fructus for treating drug-induced liver injury by acetaminophen. Bioorg. Med. Chem., 31, 115992 (2021).
• 31) Cheng L, Yang Z, Sun Z, Zhang W, Ren Y, Wang M, Han X, Fei L, Zhao Y, Pan H, Xie J, Nie S. Schizandrin B mitigates rifampicin-induced liver injury by inhibiting endoplasmic reticulum stress. Biol. Pharm. Bull., 43, 145–152 (2020).
• 32) Lu Y, Hu Q, Chen L, Zhang H, Huang S, Xiong Y, Xia C. Interaction of deoxyschizandrin and schizandrin B with liver uptake transporters OATP1B1 and OATP1B3. Xenobiotica, 49, 239–246 (2019).
• 33) Bai HY, Feng S. Protection effects of schizandrin B against liver injury induced by clozapine in mice. Yao Xue Xue Bao, 52, 390–396 (2017).
• 34) Ortega-Alonso A, Andrade RJ. Chronic liver injury induced by drugs and toxins. J. Dig. Dis., 19, 514–521 (2018).
• 35) Yan M, Huo Y, Yin S, Hu H. Mechanisms of acetaminophen-induced liver injury and its implications for therapeutic interventions. Redox Biol., 17, 274–283 (2018).
• 36) Rybnikář M, Smejkal K, Zemlicka M. Schisandra chinensis and its phytotherapeutical applications. Ceska Slov. Farm., 68, 95–118 (2019).
• 37) Jiang Y, Fan X, Wang Y, Tan H, Chen P, Zeng H, Huang M, Bi H. Hepato-protective effects of six schisandra lignans on acetaminophen-induced liver injury are partially associated with the inhibition of CYP-mediated bioactivation. Chem. Biol. Interact., 231, 83–89 (2015).
• 38) Giacomini I, Ragazzi E, Pasut G, Montopoli M. The pentose phosphate pathway and its involvement in cisplatin resistance. Int. J. Mol. Sci., 21, 937 (2020).
• 39) Ghergurovich JM, Garcia-Canaveras JC, Wang J, Schmidt E, Zhang Z, TeSlaa T, Patel H, Chen L, Britt EC, Piqueras-Nebot M, Gomez-Cabrera MC, Lahoz A, Fan J, Beier UH, Kim H, Rabinowitz JD. A small molecule G6PD inhibitor reveals immune dependence on pentose phosphate pathway. Nat. Chem. Biol., 16, 731–739 (2020).
• 40) Balsa E, Perry EA, Bennett CF, Jedrychowski M, Gygi SP, Doench JG, Puigserver P. Defective NADPH production in mitochondrial disease complex I causes inflammation and cell death. Nat. Commun., 11, 2714 (2020).
• 41) Xu SN, Wang TS, Li X, Wang YP. SIRT2 activates G6PD to enhance NADPH production and promote leukaemia cell proliferation. Sci. Rep., 6, 32734 (2016).
• 42) Ma X, Wang L, Huang D, et al. Polo-like kinase 1 coordinates biosynthesis during cell cycle progression by directly activating pentose phosphate pathway. Nat. Commun., 8, 1506 (2017).
• 43) Zhang X, Zhang X, Li Y, Shao Y, Xiao J, Zhu G, Li F. PAK4 regulates G6PD activity by p53 degradation involving colon cancer cell growth. Cell Death Dis., 8, e2820 (2017).
• 44) Zeyen T, Noristani R, Habib S, Heinisch O, Slowik A, Huber M, Schulz JB, Reich A, Habib P. Microglial-specific depletion of TAK1 is neuroprotective in the acute phase after ischemic stroke. J. Mol. Med., 98, 833–847 (2020).
• 45) Zhao X, Zou X, Li Q, Cai X, Li L, Wang J, Wang Y, Fang C, Xu F, Huang Y, Chen B, Tang J, Wang H. Total flavones of fermentation broth by co-culture of Coprinus comatus and Morchella esculenta induces an anti-inflammatory effect on LPS-stimulated RAW264.7 macrophages cells via the MAPK signaling pathway. Microb. Pathog., 125, 431–437 (2018).
• 46) Nafees S, Rashid S, Ali N, Hasan SK, Sultana S. Rutin ameliorates cyclophosphamide induced oxidative stress and inflammation in Wistar rats: role of NFkappaB/MAPK pathway. Chem. Biol. Interact., 231, 98–107 (2015).
• 47) Long Y, Yang Q, Xiang Y, Zhang Y, Wan J, Liu S, Li N, Peng W. Nose to brain drug delivery—a promising strategy for active components from herbal medicine for treating cerebral ischemia reperfusion. Pharmacol. Res., 159, 104795 (2020).
• 48) Zhu Y, Li S, Liu J, Wen Q, Yu J, Yu L, Xie K. Role of JNK signaling pathway in dexmedetomidine post-conditioning-induced reduction of the inflammatory response and autophagy effect of focal cerebral ischemia reperfusion injury in rats. Inflammation, 42, 2181–2191 (2019).
• 49) Huang Q, Zhang X, Bai F, Nie J, Wen S, Wei Y, Wei J, Huang R, He M, Lu Z, Lin X. Methyl helicterte ameliorates liver fibrosis by regulating miR-21-mediated ERK and TGF-beta1/Smads pathways. Int. Immunopharmacol., 66, 41–51 (2019).
• 50) Guo X, Cen Y, Wang J, Jiang H. CXCL10-induced IL-9 promotes liver fibrosis via Raf/MEK/ERK signaling pathway. Biomed. Pharmacother., 105, 282–289 (2018).
• 51) Lin Z, Li S, Guo P, Wang L, Zheng L, Yan Z, Chen X, Cheng Z, Yan H, Zheng C, Zhao C. Columbamine suppresses hepatocellular carcinoma cells through down-regulation of PI3K/AKT, p38 and ERK1/2 MAPK signaling pathways. Life Sci., 218, 197–204 (2019).
• 52) Zhang J, Zhang S, Bi J, Gu J, Deng Y, Liu C. Astaxanthin pretreatment attenuates acetaminophen-induced liver injury in mice. Int. Immunopharmacol., 45, 26–33 (2017).
• 53) Liao CC, Day YJ, Lee HC, Liou JT, Chou AH, Liu FC. ERK signaling pathway plays a key role in baicalin protection against acetaminophen-induced liver injury. Am. J. Chin. Med., 45, 105–121 (2017).
• 54) Gong X, Yang Y, Huang L, Zhang Q, Wan RZ, Zhang P, Zhang B. Antioxidation, anti-inflammation and anti-apoptosis by paeonol in LPS/d-GalN-induced acute liver failure in mice. Int. Immunopharmacol., 46, 124–132 (2017).
• 55) Lv H, Fan X, Wang L, Feng H, Ci X. Daphnetin alleviates lipopolysaccharide/d-galactosamine-induced acute liver failure via the inhibition of NLRP3, MAPK and NF-kappaB, and the induction of autophagy. Int. J. Biol. Macromol., 119, 240–248 (2018).
• 56) Adams CM, Clark-Garvey S, Porcu P, Eischen CM. Targeting the Bcl-2 family in B cell lymphoma. Front. Oncol., 8, 636 (2019).
• 57) Banjara S, Suraweera CD, Hinds MG, Kvansakul M. The Bcl-2 family: ancient origins, conserved structures, and divergent mechanisms. Biomolecules, 10, 128 (2020).
• 58) Liu X, He Y, Li F, Huang Q, Kato TA, Hall RP, Li CY. Caspase-3 promotes genetic instability and carcinogenesis. Mol. Cell, 58, 284–296 (2015).
• 59) Holze C, Michaudel C, Mackowiak C, Haas DA, Benda C, Hubel P, Pennemann FL, Schnepf D, Wettmarshausen J, Braun M, Leung DW, Amarasinghe GK, Perocchi F, Staeheli P, Ryffel B, Pichlmair A. Oxeiptosis, a ROS-induced caspase-independent apoptosis-like cell-death pathway. Nat. Immunol., 19, 130–140 (2018).
• 60) Xue D, Li Y, Jiang Z, Deng G, Li M, Liu X, Wang Y. A ROS-dependent and Caspase-3-mediated apoptosis in sheep bronchial epithelial cells in response to Mycoplasma Ovipneumoniae infections. Vet. Immunol. Immunopathol., 187, 55–63 (2017).
• 61) Ding R, Jiang H, Sun B, Wu X, Li W, Zhu S, Liao C, Zhong Z, Chen J. Advanced oxidation protein products sensitized the transient receptor potential vanilloid 1 via NADPH oxidase 1 and 4 to cause mechanical hyperalgesia. Redox Biol., 10, 1–11 (2016).
• 62) Elumalai S, Karunakaran U, Lee IK, Moon JS, Won KC. Rac1-NADPH oxidase signaling promotes CD36 activation under glucotoxic conditions in pancreatic beta cells. Redox Biol., 11, 126–134 (2017).
• 63) Manakkat Vijay GK, Ryan JM, Abeles RD, Ramage S, Patel V, Bernsmeier C, Riva A, McPhail MJ, Tranah TH, Markwick LJ, Taylor NJ, Bernal W, Auzinger G, Willars C, Chokshi S, Wendon JA, Ma Y, Shawcross DL. Neutrophil toll-like receptor 9 expression and the systemic inflammatory response in acetaminophen-induced acute liver failure. Crit. Care Med., 44, 43–53 (2016).
• 64) Zhao J, Kim J, Zhou Z, Qi J, Tian W, Lim CW, Han KM, Kim B. Macrophage-inducible C-Type lectin signaling exacerbates acetaminophen-induced liver injury by promoting kupffer cell activation in mice. Mol. Pharmacol., 99, 92–103 (2021).