Increased 20S Proteasome Expression and the Effect of Bortezomib during Cisplatin-Induced Muscle Atrophy

Abstract

Cisplatin is a chemotherapy drug used to treat a variety of cancers. Muscle loss in cancer patients is associated with increased cancer-related mortality. Previously, we suggested that cisplatin administration increases the atrophic gene expressions of ubiquitin E3 ligases, such as atrogin-1 and muscle RING finger-1 (MuRF1), which may lead to muscle atrophy. In this study, C57BL/6J mice were treated with cisplatin (3 mg/kg, intraperitoneally) or saline for 4 consecutive days. Twenty-four hours after the final injection of cisplatin, quadriceps muscles were removed from the mice. The gene expression of Psma and Psmb, which comprise the 20S proteasome, was upregulated by cisplatin administration in the quadriceps muscle of mouse. Systemic administration of cisplatin significantly reduced not only the quadriceps muscle mass but also the diameter of the myofibers. In addition, bortezomib (0.125 mg/kg, intraperitoneally) was administered 30 min before each cisplatin treatment. The co-administration of bortezomib, a proteasome inhibitor, significantly recovered the reductions in the mass of quadriceps and myofiber diameter, although it did not recover the decline in the forelimb and forepaw strength induced by cisplatin. Increased 20S proteasome abundance may play a significant role in the development of cisplatin-induced muscle atrophy. During cisplatin-induced skeletal muscle atrophy, different mechanisms may be involved between loss of muscle mass and strength. In addition, it is suggested that bortezomib has essentially no effect on cisplatin-induced muscle atrophy.

INTRODUCTION

Cisplatin or cis-diamminedichloroplatinum (II) is a major chemotherapeutic drug that is frequently used in clinical practice to treat a wide cancer. Although cancer cachexia is known to adversely affect the skeletal muscle during treatment,^1,2) details of the effects of anticancer drugs on the skeletal muscle have not been revealed. However, we previously suggested that muscle atrophy in mice was induced by cisplatin administration.³⁾

The discovery of the atrogenes, atrogin-1 and muscle RING Finger-1 (MuRF1), prompted renewed interest in the identification of muscle-specific targets for therapeutic manipulation. Atrogin-1 and MuRF1 are muscle-specific ubiquitin E3 ligases that play a role in the ubiquitin–proteasome pathway (UPS), the major pathway involved in the degradation of protein of the skeletal muscle.⁴⁾ The mRNA expression of these atrogenes is dramatically increased during muscle atrophy, and mice with deficiencies in either atrogene are partially resistant to muscle atrophy. Atrogin-1 and MuRF1 are thus likely to play important roles in muscle protein loss, and an increase in their mRNA expression is now considered to be specific markers of muscle atrophy. We have previously reported that cisplatin administration increases atrogin-1 and MuRF1 expression and may lead to muscle atrophy via the UPS in mice.³⁾

The 26S proteasome is a multi-subunit protein complex, which functions as a principal non-lysosomal protease in all eukaryotic cells by breaking down ubiquitinated substrates. The 26S proteasome is comprised of two sub-complexes: the 20S proteasome core particle and the 19S proteasome regulatory particle.^5–7) The 19S complex recognizes the ubiquitin-tagged substrate, cleaves the ubiquitin chain, unfolds the substrate, and transfers the unfolded protein to the catalytic chamber of the 20S core complex.^6,8,9) The 20S proteasome, the active site of the 26S proteasome, consists of seven α subunits (Psma1–7) and seven β subunits (Psmb1–7). Previously, we demonstrated that injection of cisplatin induced muscle atrophy in mouse. Under this condition, the expression of atrogenes was significantly increased.^10,11) These findings indicated that cisplatin treatment induces muscle atrophy as a result of protein ubiquitination and degradation by the proteasome. However, the changes in expression of 20S proteasome components in cisplatin-induced skeletal muscle atrophy are still unknown. Therefore, changes in the expression of the 20S proteasome, including its Psma and Psmb subunits, in cisplatin-induced skeletal muscle atrophy were investigated in this study.

In addition, bortezomib is a proteasome inhibitor that reversibly inhibits the chymotrypsin-like activity of the 20S proteasome complex.¹²⁾ Although some studies have demonstrated that proteasome inhibitors reduce proteolysis during muscle atrophy,^13,14) no study has demonstrated the effect of bortezomib on muscle atrophy induced by cisplatin in vivo. To address this issue, we examined the effect of bortezomib on the cisplatin-induced muscle atrophy in this study.

MATERIALS AND METHODS

Animals and Treatment Schedule

Male C57BL/6J mice (8–9 weeks old) were purchased from Tokyo Laboratory Animals Science Co., Ltd. (Tokyo, Japan) and housed in a pathogen-free facility. Each animal was used only once. All experiments were conducted in accordance with the Guiding Principles for the Care and Use of Laboratory Animals, as adopted by the Committee on Animal Research at Hoshi University. The mice were injected with 3 mg/kg cisplatin (intraperitoneally (i.p.)) once daily for 4 d (Days 0, 1, 2, 3), and its vehicle (saline) was used as a vehicle control (Fig. 1A). As the mice lost body weight due to cisplatin administration, we prepared dietary restriction (DR) as another control. We previously administered 3 mg/kg, i.p. for 4 d cisplatin and measured food intake, with normal mice receiving only 2, 2, 2, 1.5 g of food and 4, 4, 3, 3 mL of water on Days 0-1, 1-2, 2-3, 3-4, respectively. We found that the Day 4 body weights of the diet-restricted and cisplatin-treated mice were similar.³⁾ Hence, the same method was used for the dietary restriction group in this study. Bortezomib (0.125 mg/kg, i.p.) was administered to the mice 30 min before cisplatin treatment. Because we referenced a paper that used a dose (0.25 mg/kg, i.p., twice a week) at which bortezomib showed pharmacological effects in mice,¹⁵⁾ we administered it at 0.125 mg/kg/d for 4 d. Before the administration of bortezomib on day 0 and again 24 h after the final cisplatin administration (Day 3), the grip strength of the forelimb or forepaws was measured using a digital grip strength meter (GPM-101B/V, Melquest Ltd., Japan). The mean of the peak force (N) of three trials was determined. The mice were sacrificed under deep anesthesia with isoflurane 24 h after the last injection of cisplatin. The quadriceps muscles were then isolated, and their wet weight was measured. Subsequently, the quadriceps muscles were immediately washed with cold saline, frozen in liquid nitrogen, and stored at −80 °C.

Fig. 1. Effects of Cisplatin and Dietary Restriction (DR) on Body Weight and Quadriceps Muscle in Mice

Cisplatin (3 mg/kg) or its vehicle (saline) was intraperitoneally administered once daily for 4 d. (A) The quadriceps muscle mass was measured 24 h after the final injection. Effects of cisplatin and DR on body weight (B) and quadriceps muscle mass (C). Results are presented as mean ± S.E.M. (n = 4). ** p < 0.01 and *** p < 0.001 vs. vehicle control. ^### p < 0.001 vs. DR.

Quantitative RT-PCR

The gene expression levels of the Psma, Psmb, Psmc and Psmd isoforms, as well as atrogenes, were examined via real-time RT-PCR as described previously.^11,16) The PCR primer set used in this study is presented in Table 1. Data are expressed as the expression relative to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA as a housekeeping gene using the 2^−ΔΔCT method.^11,16,17)

Table 1. List of Specific Primers Used for Quantitative PCR Gene Expression Analysis

	Accession number		Primer Deoxyribonucleotide sequences	Pruduct size (base pairs)
GAPDH	NM_008084.2	Forward	CCTCGTCCCGTAGACAAAATG	100
		Reverse	TCTCCACTTTGCCACTGCAA
Psma1	NM_011965.2	Forward	CCTCAGGGCAGGATTCATCA	96
		Reverse	CAGCACTGCGTGCGTTTTT
Psma2	NM_008944.2	Forward	TCCGACTTTCCGGGTAAAGA	106
		Reverse	TACCGCAGCCAAGGCATATT
Psma3	NM_011184.4	Forward	TGCAGACAGAGTGGCCATGT	94
		Reverse	CGCACTGTAAGACCCCAACA
Psma4	NM_011966.3	Forward	CACATGCATTGGGAACAACAG	92
		Reverse	GAGCAAGCGCTGACTTCAGA
Psma5	NM_011967.3	Forward	GTTCCGCCTCCCTGTTAACC	96
		Reverse	CCGTGCTTCCCTTTTATTGG
Psma6	NM_011968.3	Forward	GCACGCTATGAGGCAGCTAAT	126
		Reverse	ACCGAGTGGCCTCATTTCAG
Psma7	NM_011969.2	Forward	CGGTTGGTGTTCGAGGAAAG	98
		Reverse	GGCGCAGATTTTTCGTACTGT
Psmb1	NM_011185.3	Forward	CTGTGCAGCTGCGGTTTTC	90
		Reverse	TGTCTGAAGCGACGATGGAA
Psmb2	NM_011970.4	Forward	CGCCAGCAATATTGTCCAGAT	90
		Reverse	CCAGCCTCTCCAACACATAGG
Psmb3	NM_011971.4	Forward	GCGGTTCGGTCCCTACTACA	90
		Reverse	CCAATGAGGTCCAGAGAGCAA
Psmb4	NM_008945.3	Forward	GCAGCCAGTGCTGAGTCAGA	90
		Reverse	CGGTTATACGAACGGGCATCT
Psmb5	NM_011186.1	Forward	GCTCGGCAGTGTCGAATCTAT	106
		Reverse	GCCCCATGCCTTTGTACTGA
Psmb6	NM_008946.4	Forward	GGAGACCAAATCCCCAAGTTC	92
		Reverse	CGTCGGTATGGACCATCCTT
Psmb7	NM_011187.1	Forward	GTCGCAGGAATGCTGTCTTG	90
		Reverse	CCCCCGCGATGGTAGTG
Psmc1 (Rpt2)	NM_008947.3	Forward	GCTCAGAACACTACGTCAGCA	109
		Reverse	ATTAGCACCCCTATCACAGCA
Psmc2 (Rpt1)	NM_011188.4	Forward	GAGTGAACAGCCATTACAGGTGG	106
		Reverse	CACCACGAACTTGGCAAACTGC
Psmd1 (Rpn2)	NM_027357.2	Forward	AGCAGTGGAGTCACTTGGCTTC	149
		Reverse	CCTTGTTTCCTGTACCAGCACAG
Psmd2 (Rpn1)	NM_134101.2	Forward	CAGAGCCATTCCGCAGTTTTGC	107
		Reverse	GTGCTCACTACAGATGTGGAGG
Atrogin-1	NM_026346.3	Forward	AGAAAAGCGGCAGCTTCGT	100
		Reverse	GCTGCGACGTCGTAGTTCAG
MuRF1	NM_001039048.2	Forward	ACACAACCTCTGCCGGAAGT	103
		Reverse	ACGGAAACGACCTCCAGACA

Immunoblots

Preparation of protein homogenate sample solutions and immunoblot analyses were performed as previously described.^11,16,18) The membranes were probed with anti-20S proteasome (1 : 1000 dilution; PeproTech) and anti-GAPDH (1 : 5000 dilution; Cell Signaling Technology) antibodies. Goat anti-rabbit immunoglobulin G (IgG) (Cell Signaling Technology) was used as the horseradish peroxidase-linked secondary antibody. Immunoreactive proteins were visualized using Chemi–Lumi One (Nacalai Tesque, Kyoto, Japan) and assessed using the ImageQuant LAS 500 Image analyzer (GE Healthcare Life Sciences, U.S.A.). The GAPDH protein levels were examined for comparison with Ponceau-S staining.

Proteasome Assay

Proteasome activity was determined using Proteasome-Glo™ Chymotrypsin-Like Assay (Promega, Madison, WI, U.S.A.). The protein homogenate samples were added 96-well plate to according to the manufacturer’s recommended instructions. The protein sample was incubated with Proteasome-Glo reagent and succinyl (Suc)-LLVY-Glo™ Substrate, and the fluorescence intensity was detected by GloMax^® Discover Microplate Reader (Promega).

Cell Culture

The skeletal muscle cell line C2C12 from mouse striated muscle (RIKEN BRC, Ibaraki, Japan) was grown in Dulbecco’s modified Eagle’s medium (DMEM), supplemented with 10% fetal bovine serum and 1% penicillin–streptomycin under a humidified atmosphere of 5% CO₂ and maintained at low confluence. To induce differentiation, we changed the culture medium to 2% horse serum when the cells reached 80% confluence. The cells were maintained in the differentiation medium for 8 d prior to further experiments and were treated with cisplatin (5, 15, 50 µM) for 24 h.

Histology

Standard hematoxylin and eosin (H&E) staining was conducted using a previously described method.³⁾ The diameters of the myofibers were analyzed using also the methods described previously.³⁾ Briefly, to analyze the length of the longest minor axis (the perpendicular bisector of the major axis) as the diameters of the myofibers, the sections of the quadriceps muscle were observed under a light microscope using the ImageJ software. For each animal, at least 80 fibers were measured.

Statistical Analysis

The results were expressed as means ± standard error of the mean (S.E.M.). The statistical significance of differences was determined via an unpaired one-way ANOVA with the Bonferroni/Dunn or Dunnett’s post hoc test. The error bars and statistical significance indicators in their response curves were calculated using GraphPad Prism 9 for macOS (GraphPad Software, Inc., CA, U.S.A.). Values of p < 0.05 were considered statistically significant.

RESULTS

Upregulation of the 20S and 19S Proteasome in the Skeletal Muscle of Cisplatin-Administered Mouse

Similarly, the mice body weight was significantly reduced by both cisplatin (3 mg/kg, i.p.) and DR (Fig. 1B). The injection of cisplatin significantly attenuated the quadriceps muscle mass compared with that of the vehicle and DR groups (Fig. 1C). The gene expression of not only proteasome α (Psma1–7, Fig. 2A) and β (Psmb1–7, Fig. 2B) subunits but also Rpt (Psmc1; Rpt2, Psmc2; Rpt1, Fig. 2C) and Rpn (Psmd1; Rpn2, Psmd2; Rpn1, Fig. 2D) subunits in the quadriceps muscle was upregulated by cisplatin administration compared with that of the vehicle and DR groups. GAPDH was used as a housekeeping or normalization protein as we demonstrated that the protein level of GAPDH relative to Ponceau-S staining did not vary among the groups (Figs. 3A, B, D). To investigate the protein levels of the 20S proteasome in the cisplatin-induced atrophy of the skeletal muscle, immunoblotting using a specific Psma + Psmb antibody was performed. Similar to the gene expression, the protein abundance of the 20S proteasome was upregulated by cisplatin administration, compared with that of the vehicle control and DR groups (Figs. 3A, C). In addition, the activity of proteasome was also increased by cisplatin administration (Fig. 3E).

Fig. 2. Effects of Cisplatin and DR on the Gene Expression Changes of Proteasome Isoforms α (Psma1–7, A), β (Psmb1–7, B), Rpt (Psmc1, 2, C) and Rpn (Psmd1, 2, D) in the Quadriceps Muscle

Results are presented as mean ± S.E.M. (n = 4). *** p  < 0.001 vs. vehicle control. ^# p < 0.05, ^## p < 0.01, and ^### p < 0.001 vs. DR.

Fig. 3. Effects of Cisplatin and DR on the Protein Abundance of the 20S Proteasome (Psma, α, and Psmb, β, Isoforms) in the Quadriceps Muscle

(A) Typical photographs of immunoblotting bands for 20S proteasome (Psma + Psmb) and GAPDH. (B) Representative Ponceau-S staining. (C) Changes in the protein levels of 20S proteasome. (D) Expression levels of GAPDH relative to Ponceau-S staining. (E) Changes in activity of proteasome. Results are presented as mean ± S.E.M. (n = 4). *** p < 0.001 vs. vehicle control. ^### p < 0.001 vs. DR.

Upregulation of the 20S Proteasome in Cisplatin-Treated C2C12 Myotubes

First, we investigated the effect of cisplatin on the cell viability in C2C12 myotubes. In this study, the use of up to 50-µM cisplatin did not affect cell viability. Therefore, in the subsequent experiments, 50 µM was used as the maximum concentration (Fig. 4A). Next, we investigated the effect of cisplatin on the gene expression of Psma and Psmb in the C2C12 myotubes. Treatment with cisplatin increased the gene expression of the proteasome α (Psma2, Psma4, Psma6) and β (Psmb1, Psmb2, Psmb5) subunits in C2C12 myotubes (Fig. 4B). Similarly, the abundance of the 20S proteasome α and β subunits was increased by cisplatin (Figs. 4C, E). In the C2C12 myotubes, the protein abundance of GAPDH was not altered by cisplatin (Figs. 4C, D, F); therefore, GAPDH was used as a housekeeping or normalization protein.

Fig. 4. Effects of Cisplatin on 20S Proteasome Expression in C2C12 Myotubes

(A) Effect of cisplatin (5, 15, and 50 µM for 24 h) on cell viability in C2C12 myotubes. Each column represents the mean ± S.E.M. (n = 3). (B) Effect of cisplatin on the gene expression of Psma2, Psma4, and Psma6 and Psmb1, Psmb2, and Psmb3 in C2C12 myotubes. Results are presented as the mean ± S.E.M. (n = 3). (C) Effects of cisplatin on the protein abundance of the 20S proteasome (Psma, α, Psmb, β, isoforms) in C2C12 myotubes. Typical photographs of immunoblotting bands for the 20S proteasome (Psma + Psmb) and GAPDH. (D) Representative Ponceau-S staining. (E) Changes in the protein abundance of the 20S proteasome. (F) Expression level of GAPDH relative to Ponceau-S staining. Results are presented as mean ± S.E.M. (n = 3). * p < 0.05, ** p < 0.01, and *** p < 0.001 vs. vehicle control.

Effect of Bortezomib on Cisplatin-Induced Muscle Atrophy

To investigate whether the increased expression of proteasomes by cisplatin treatment is involved in muscle atrophy, we analyzed the effects of the proteasome inhibitor, bortezomib, on the myofiber diameters. Although bortezomib administration did not affect the cisplatin-induced weight and food-intake loss (Figs. 5B, C), bortezomib significantly suppressed the mass loss of the cisplatin-induced quadriceps muscle (Fig. 5D). The shortening of the myofiber diameter by cisplatin was suppressed by bortezomib, as presented in Figs. 6A–D. However, the cisplatin-induced forelimb and forepaw muscle weakness was not suppressed by bortezomib (Figs. 6E, F), and the cisplatin-induced upregulation of atrogin-1 and MuRF1 genes was also not decreased by bortezomib treatment (Figs. 6G, H).

Fig. 5. Effects of Bortezomib on the Cisplatin-Induced Reduction of Body Weight, Food Intake, and Quadriceps Muscle Mass in Mice

(A) Schedules for the administration of cisplatin and bortezomib. Effect of bortezomib on cisplatin-induced loss of body weight (B), food intake (C), and quadriceps muscle mass (D). Results are presented as mean ± S.E.M. (n = 4). * p < 0.05, ** p < 0.01, and *** p < 0.001 vs. vehicle control (vehicle + saline). # p < 0.001 vs. vehicle + cisplatin.

Fig. 6. Effects of Bortezomib on Cisplatin-Induced Reduction of Myofiber Diameter, Muscle Strength, and Gene Expression of Atrogin-1 and MuRF1 in the Quadriceps Muscles of Mice

Hematoxylin and eosin staining of the quadriceps muscle in vehicle + saline (A), vehicle + cisplatin (B), and bortezomib (Bort) + Cis3 (C). Bar scale = 100 µm. (D) Effect of cisplatin and/or bortezomib on myofiber diameter. Effect of bortezomib on the cisplatin-induced muscle weakness of the forelimb (E) and forepaws (F) in mouse. Effect of bortezomib on the cisplatin-induced upregulation of atrogin-1 (G) and MuRF1 (H) mRNA in the quadriceps muscle of mouse. Results are presented as mean ± S.E.M. (n = 4). * p < 0.05, ** p < 0.01, and *** p < 0.001 vs. vehicle control (vehicle + saline). ^### p < 0.001 vs. vehicle + Cis3.

DISCUSSION

This study indicated that cisplatin increased expression and activity of the 20S proteasome, the active site of the 26S proteasome. Furthermore, it was demonstrated that bortezomib, a proteasome inhibitor, suppressed the cisplatin-induced reduction in muscle mass and myofiber diameter but not muscle strength.

Keeping the skeletal muscles healthy is important for an individual’s health and well-being. The skeletal muscles are comprised of 50–75% of all body proteins, and 30–50% of the whole-body protein turnover (the synthesis and degradation of proteins) occurs there.¹⁹⁾ Thus, protein turnover dominates the normal function of the skeletal muscle. Nevertheless, there are an increasing number of studies demonstrating that cisplatin breaks the dynamic balance in protein turnover, decreases the number and thickness of myocytes, and subsequently causes muscle atrophy.²⁰⁾ Reduced muscle mass worsens the prognosis of patients with melanoma,²¹⁾ ovarian cancer,²²⁾ hepatocellular carcinoma,²³⁾ colorectal cancer,²⁴⁾ and biliary tract cancer.²⁵⁾ In breast cancer, skeletal muscle atrophy occurs in one-third of patients and has been shown to be a more powerful predictor of death than the obesity index, as is fat mass.^26,27) In addition, Hou et al.²⁸⁾ recently reported that sarcopenia is an independent and stable risk factor for the prognosis of combined hepatocellular carcinoma and cholangiocarcinoma following surgery. Therefore, investigating the pathogenic mechanism of cisplatin-induced muscular atrophy is of utmost importance.

The ubiquitin–proteasome system is likely to play an important role during cisplatin-induced muscle atrophy.¹¹⁾ We have previously indicated that C2C12 myotubes with cisplatin increases the amount of ubiquitinated proteins. We hypothesized that this increase in ubiquitinated protein was the result of a “response to increased expression of muscle-specific ubiquitin E3 ligases (such as atrogin-1 and MuRF1) by cisplatin” minus “proteasome activity.” To confirm this hypothesis, the combination of cisplatin and MG-132, a proteasome inhibitor, further increased the amount of ubiquitinated proteins compared to cisplatin alone.¹¹⁾ Thus, the administration of cisplatin induces a protein degradation pathway in skeletal muscle. Although it has been suggested that ubiquitination of proteins increases and degradation occurs at the proteasome, changes in proteasome expression and activity have not been demonstrated. We here demonstrate that cisplatin increases proteasome expression and activity.

In the present study, an increase in the gene expression of atrogenes (atrogin-1 and MuRF1) was observed in both the mouse model and C2C12 myotubes. These results agree with the previous findings that the upregulation of the ubiquitin–proteasome may be responsible for cisplatin-induced muscle atrophy.^3,11) Tundo et al.²⁹⁾ reported that cisplatin also affects the expression and activity of the proteasome in bone marrow biopsy-derived cell lines. This finding suggests that cisplatin increases the abundance of ubiquitinated proteins in atrophied muscle by upregulating not only E3 ubiquitin–protein ligases but also the expression or activity of the 26S proteasome. Thus, the gene expressions of the core particle of 26S proteasome, 20S proteasome, were investigated in this study. As expected, the gene expressions of 20S proteasome were significantly increased in the quadriceps muscle of cisplatin-treated groups. To examine the protein level of the 20S proteasome in cisplatin-treated murine quadriceps muscle and C2C12 myotubes, the protein loading was verified by Ponceau-S staining. These results indicated that cisplatin did not affect the amount of GAPDH in murine quadriceps muscles and C2C12 myotubes. The protein abundance of the 20S proteasome was also increased. These results suggested that the upregulation of the gene expression and protein abundance of the 20S proteasome is partly responsible for cisplatin-induced muscle atrophy. In addtiton, the gene expression of some 19S regular particles (Psmc1; Rpt2, Psmc2; Rpt1, Psmd1; Rpn2, Psmd2; Rpn1) were examined and similarly increased. Moreover, we indicated that proteasome activity was enhanced by cisplatin in skeletal muscle of mouse. Therefore, it is reasonable to speculate that the expression/activity of the 26S proteasome is increased in cisplatin-induced muscular atrophy.

Although the mechanism of individual 20S proteasome subunit expression regulation has not been elucidated in detail, it has been well known that the nuclear factor erythroid 2-related factor 1 (Nrf1) plays an important role in the upregulation of the transcription of proteasome subunits. Nrf1 affects antioxidant response element (ARE)-drive motifs and upregulates many proteasome subunits.^30,31) Although not considered in this study, the increased activity and expression of Nrf1 induced by cisplatin may be involved in the increased expression of proteasome. Future studies need to be conducted to further describe this relationship.

Bortezomib is currently used for the treatment of relapsed/refractory multiple myeloma.^32,33) Proteasome inhibition by bortezomib has been reported to kill cancer cells by blocking inducible I-κBα degradation and subsequent nuclear factor-kappaB (NF-κB) activation.^34,35) In addition, NF-κB plays a very important role in inducing inflammation. Several NF-κB-regulated proinflammatory cytokines, such as interleukin (IL)-1β and tumor necrosis factor (TNF)-α, were found to increase during inflammation and may be modulated by treatment targeting NF-κB.³⁶⁾ IL-1β and TNF-α have been indicated to promote the breakdown of myofibrillar proteins and decrease protein synthesis, which leads to muscle loss.^37,38) Therefore, it can be inferred that cisplatin-induced skeletal muscle inflammation causes muscular atrophy, and bortezomib suppresses both the NF-kB activity to induce anti-inflammatory effects and cisplatin-induced muscular atrophy. However, no increased expression of the proinflammatory cytokines, TNF-α or IL-1, was observed in cisplatin-induced muscular atrophy in our previous study.^3,39)

It has been reported that the administration of bortezomib significantly attenuates the denervation-induced atrophy of posterior cricoarytenoid muscles¹⁴⁾ and soleus muscles.¹³⁾ However, these studies did not measure muscle strength and was evaluated only using muscle atrophy indicators: muscle weight, muscle fiber cross-sectional area, and muscle fiber number/mm². However, Penna et al.⁴⁰⁾ reported that bortezomib could not prevent muscle atrophy in experimental cancer cachexia. Therefore, the effects of bortezomib may vary depending on the cause of muscle atrophy. In this study, we demonstrated that bortezomib suppresses cisplatin-induced muscle mass loss and myofiber diameter shortening; however, it did not inhibit cisplatin-induced loss of muscle strength. During cisplatin-induced muscle atrophy, it is possible that different mechanisms involve between the loss of skeletal muscle mass and strength. Recently, it has been reported that cisplatin induces endoplasmic reticulum stress and the unfolded protein response.⁴¹⁾ Therefore, cisplatin causes an increase in unfolded proteins in the skeletal muscle cells, which can be degraded by the proteasome and cause muscle atrophy. When bortezomib is administered, the degradation of unfolded proteins by the proteasome is suppressed, which reduces muscle weight loss. However, it is possible that muscle weakness is maintained by increasing unfolded proteins.

In conclusion, the increases in expression and activity of 20S proteasome in the skeletal muscle may be a factor that plays a crucial role in the development of cisplatin-induced muscular atrophy. Bortezomib did not affect cisplatin-induced muscle weakness in cisplatin-induced muscle atrophy. Further research is needed, although this study suggests that bortezomib has essentially no effect on cisplatin-induced muscular atrophy.

Acknowledgments

This work was supported by the JSPS KAKENHI, Grant-in-Aid for Scientific Research (C), Grant No. 18K06706. We thank Ms. Yuko Ishikawa, Aya Oguchi, Junna Hayashida and Mr. Kenta Suma for their technical assistance.

Conflict of Interest

The authors declare no conflict of interest.

REFERENCES

• 1) Aoyagi T, Terracina KP, Raza A, Matsubara H, Takabe K. Cancer cachexia, mechanism and treatment. World J. Gastrointest. Oncol., 7, 17–29 (2015).
• 2) Martin A, Freyssenet D. Phenotypic features of cancer cachexia-related loss of skeletal muscle mass and function: lessons from human and animal studies. J. Cachexia Sarcopenia Muscle, 12, 252–273 (2021).
• 3) Sakai H, Sagara A, Arakawa K, Sugiyama R, Hirosaki A, Takase K, Jo A, Sato K, Chiba Y, Yamazaki M, Matoba M, Narita M. Mechanisms of cisplatin-induced muscle atrophy. Toxicol. Appl. Pharmacol., 278, 190–199 (2014).
• 4) Lecker SH, Solomon V, Mitch WE, Goldberg AL. Muscle protein breakdown and the critical role of the ubiquitin-proteasome pathway in normal and disease states. J. Nutr., 129 (Suppl.), 227S–237S (1999).
• 5) Besche HC, Peth A, Goldberg AL. Getting to first base in proteasome assembly. Cell, 138, 25–28 (2009).
• 6) Matyskiela ME, Lander GC, Martin A. Conformational switching of the 26S proteasome enables substrate degradation. Nat. Struct. Mol. Biol., 20, 781–788 (2013).
• 7) Tomko RJ Jr, Hochstrasser M. Molecular architecture and assembly of the eukaryotic proteasome. Annu. Rev. Biochem., 82, 415–445 (2013).
• 8) Hochstrasser M. Ubiquitin-dependent protein degradation. Annu. Rev. Genet., 30, 405–439 (1996).
• 9) Finley D. Recognition and processing of ubiquitin-protein conjugates by the proteasome. Annu. Rev. Biochem., 78, 477–513 (2009).
• 10) Sakai H, Sagara A, Arakawa K, Sugiyama R, Hirosaki A, Takase K, Jo A, Sato K, Chiba Y, Yamazaki M, Matoba M, Narita M. Mechanisms of cisplatin-induced muscle atrophy. Toxicol. Appl. Pharmacol., 278, 190–199 (2014).
• 11) Sakai H, Ikeno Y, Tsukimura Y, Inomata M, Suzuki Y, Kon R, Ikarashi N, Chiba Y, Yamada T, Kamei J. Upregulation of ubiquitinated proteins and their degradation pathway in muscle atrophy induced by cisplatin in mice. Toxicol. Appl. Pharmacol., 403, 115165 (2020).
• 12) Lü S, Wang J. The resistance mechanisms of proteasome inhibitor bortezomib. Biomark. Res., 1, 13 (2013).
• 13) Beehler BC, Sleph PG, Benmassaoud L, Grover GJ. Reduction of skeletal muscle atrophy by a proteasome inhibitor in a rat model of denervation. Exp. Biol. Med. (Maywood), 231, 335–341 (2006).
• 14) Sei H, Taguchi A, Nishida N, Hato N, Gyo K. Preventive effects of bortezomib on denervation-induced atrophy of the intrinsic laryngeal muscles: an experimental study in the rat. Acta Otolaryngol., 135, 713–717 (2015).
• 15) Philippe L, Ceroi A, Bole-Richard E, Jenvrin A, Biichle S, Perrin S, Limat S, Bonnefoy F, Deconinck E, Saas P, Garnache-Ottou F, Angelot-Delettre F. Bortezomib as a new therapeutic approach for blastic plasmacytoid dendritic cell neoplasm. Haematologica, 102, 1861–1868 (2017).
• 16) Sakai H, Asami M, Naito H, Kitora S, Suzuki Y, Miyauchi Y, Tachinooka R, Yoshida S, Kon R, Ikarashi N, Chiba Y, Kamei J. Exogenous insulin-like growth factor 1 attenuates cisplatin-induced muscle atrophy in mice. J. Cachexia Sarcopenia Muscle, 12, 1570–1581 (2021).
• 17) Sakai H, Sagara A, Matsumoto K, Hasegawa S, Sato K, Nishizaki M, Shoji T, Horie S, Nakagawa T, Tokuyama S, Narita M. 5-Fluorouracil induces diarrhea with changes in the expression of inflammatory cytokines and aquaporins in mouse intestines. PLOS ONE, 8, e54788 (2013).
• 18) Sakai H, Kimura M, Tsukimura Y, Yabe S, Isa Y, Kai Y, Sato F, Kon R, Ikarashi N, Narita M, Chiba Y, Kamei J. Dexamethasone exacerbates cisplatin-induced muscle atrophy. Clin. Exp. Pharmacol. Physiol., 46, 19–28 (2019).
• 19) Frontera WR, Ochala J. Skeletal muscle: a brief review of structure and function. Calcif. Tissue Int., 96, 183–195 (2015).
• 20) Conte E, Bresciani E, Rizzi L, Cappellari O, De Luca A, Torsello A, Liantonio A. Cisplatin-induced skeletal muscle dysfunction: mechanisms and counteracting therapeutic strategies. Int. J. Mol. Sci., 21, 1242 (2020).
• 21) Sabel MS, Lee J, Cai S, Englesbe MJ, Holcombe S, Wang S. Sarcopenia as a prognostic factor among patients with stage III melanoma. Ann. Surg. Oncol., 18, 3579–3585 (2011).
• 22) Aust S, Knogler T, Pils D, Obermayr E, Reinthaller A, Zahn L, Radlgruber I, Mayerhoefer ME, Grimm C, Polterauer S. Skeletal muscle depletion and markers for cancer cachexia are strong prognostic factors in epithelial ovarian cancer. PLOS ONE, 10, e0140403 (2015).
• 23) Fujiwara N, Nakagawa H, Kudo Y, Tateishi R, Taguri M, Watadani T, Nakagomi R, Kondo M, Nakatsuka T, Minami T, Sato M, Uchino K, Enooku K, Kondo Y, Asaoka Y, Tanaka Y, Ohtomo K, Shiina S, Koike K. Sarcopenia, intramuscular fat deposition, and visceral adiposity independently predict the outcomes of hepatocellular carcinoma. J. Hepatol., 63, 131–140 (2015).
• 24) Blauwhoff-Buskermolen S, Versteeg KS, de van der Schueren MA, den Braver NR, Berkhof J, Langius JA, Verheul HM. Loss of muscle mass during chemotherapy is predictive for poor survival of patients with metastatic colorectal cancer. J. Clin. Oncol., 34, 1339–1344 (2016).
• 25) Cho KM, Park H, Oh DY, Kim TY, Lee KH, Han SW, Im SA, Kim TY, Bang YJ. Skeletal muscle depletion predicts survival of patients with advanced biliary tract cancer undergoing palliative chemotherapy. Oncotarget, 8, 79441–79452 (2017).
• 26) Huh J, Park B, Lee H, An YS, Jung Y, Kim JY, Kang DK, Kim KW, Kim TH. Prognostic value of skeletal muscle depletion measured on computed tomography for overall survival in patients with non-metastatic breast cancer. J. Breast Cancer, 23, 80–92 (2020).
• 27) Iritani S, Imai K, Takai K, Hanai T, Ideta T, Miyazaki T, Suetsugu A, Shiraki M, Shimizu M, Moriwaki H. Skeletal muscle depletion is an independent prognostic factor for hepatocellular carcinoma. J. Gastroenterol., 50, 323–332 (2015).
• 28) Hou GM, Jiang C, Du JP, Yuan KF. Sarcopenia predicts an adverse prognosis in patients with combined hepatocellular carcinoma and cholangiocarcinoma after surgery. Cancer Med., 11, 317–331 (2022).
• 29) Tundo GR, Sbardella D, Ciaccio C, De Pascali S, Campanella V, Cozza P, Tarantino U, Coletta M, Fanizzi FP, Marini S. Effect of cisplatin on proteasome activity. J. Inorg. Biochem., 153, 253–258 (2015).
• 30) Yuan J, Zhang S, Zhang Y. Nrf1 is paved as a new strategic avenue to prevent and treat cancer, neurodegenerative and other diseases. Toxicol. Appl. Pharmacol., 360, 273–283 (2018).
• 31) Motosugi R, Murata S. Dynamic regulation of proteasome expression. Front. Mol. Biosci., 6, 30 (2019).
• 32) Chauhan D, Li G, Podar K, Hideshima T, Shringarpure R, Catley L, Mitsiades C, Munshi N, Tai YT, Suh N, Gribble GW, Honda T, Schlossman R, Richardson P, Sporn MB, Anderson KC. The bortezomib/proteasome inhibitor PS-341 and triterpenoid CDDO-Im induce synergistic anti-multiple myeloma (MM) activity and overcome bortezomib resistance. Blood, 103, 3158–3166 (2004).
• 33) Mitsiades N, Mitsiades CS, Richardson PG, Poulaki V, Tai YT, Chauhan D, Fanourakis G, Gu X, Bailey C, Joseph M, Libermann TA, Schlossman R, Munshi NC, Hideshima T, Anderson KC. The proteasome inhibitor PS-341 potentiates sensitivity of multiple myeloma cells to conventional chemotherapeutic agents: therapeutic applications. Blood, 101, 2377–2380 (2003).
• 34) Hideshima T, Richardson P, Chauhan D, Palombella VJ, Elliott PJ, Adams J, Anderson KC. The proteasome inhibitor PS-341 inhibits growth, induces apoptosis, and overcomes drug resistance in human multiple myeloma cells. Cancer Res., 61, 3071–3076 (2001).
• 35) Chauhan D, Singh A, Brahmandam M, Podar K, Hideshima T, Richardson P, Munshi N, Palladino MA, Anderson KC. Combination of proteasome inhibitors bortezomib and NPI-0052 trigger in vivo synergistic cytotoxicity in multiple myeloma. Blood, 111, 1654–1664 (2008).
• 36) Liu T, Zhang L, Joo D, Sun SC. NF-kappaB signaling in inflammation. Signal Transduct. Target. Ther., 2, 17023 (2017).
• 37) Schiaffino S, Dyar KA, Ciciliot S, Blaauw B, Sandri M. Mechanisms regulating skeletal muscle growth and atrophy. FEBS J., 280, 4294–4314 (2013).
• 38) Egerman MA, Glass DJ. Signaling pathways controlling skeletal muscle mass. Crit. Rev. Biochem. Mol. Biol., 49, 59–68 (2014).
• 39) Sakai H, Kimura M, Isa Y, Yabe S, Maruyama A, Tsuruno Y, Kai Y, Sato F, Yumoto T, Chiba Y, Narita M. Effect of acute treadmill exercise on cisplatin-induced muscle atrophy in the mouse. Pflugers Arch., 469, 1495–1505 (2017).
• 40) Penna F, Bonetto A, Aversa Z, Minero VG, Rossi Fanelli F, Costelli P, Muscaritoli M. Effect of the specific proteasome inhibitor bortezomib on cancer-related muscle wasting. J. Cachexia Sarcopenia Muscle, 7, 345–354 (2016).
• 41) Manohar S, Leung N. Cisplatin nephrotoxicity: a review of the literature. J. Nephrol., 31, 15–25 (2018).