Inhibition of Spred/Sprouty Expression in the Skin of a Contact Dermatitis-Like Model

Abstract

We have previously reported that swellings caused by haptens, such as 2,4,6-trinitrochlorobenzene (TNCB), may be associated with the extracellular signal-regulated kinase (ERK)-induced proliferation pathway. However, the involvement of the Spred/Sprouty family as critical negative regulators of the Ras/Raf/ERK signaling pathway at disease sites is not well-established. Thus, in the present study, the effects of hapten-challenge on the expression levels of genes and proteins associated with the Spred/Sprouty family in the ear of mice were investigated. The activation of ERK and epidermal growth factor receptor (EGFR) tyrosine kinase was inhibited by their selective inhibitors, namely, U0126 and PD168393, respectively. Twenty-four hours after the final challenge by the haptens TNCB, 2,4-dinitrofluorobenzene, or oxazolone, ear thickness was augmented by challenge with all haptens and the gene expression levels of Spred1, Spred2, Sprouty1, and Sprouty2 in swelling induced by all haptens were significantly decreased. Furthermore, Spred2, Sprouty1, and Sprouty2 genes were decreased in the epidermis and dermis of the TNCB-challenged ear. In conclusion, it is possible that the mechanism of hapten-challenge-induced skin thickening involves not only the enhancement of cell proliferative functions via the activation of ERK by EGFR tyrosine kinase activation but also the decreases expression of Spred/Sprouty family members.

INTRODUCTION

Contact dermatitis, which is induced as a result of contact with chemicals, is an increasing environmental and occupational health problem.¹⁾ There are two main types of contact dermatitis: allergic contact dermatitis, classified as type 4 allergy,^2,3) caused by repeated direct skin contact with contact allergens, and irritant contact dermatitis, caused by skin contact with irritating substances.¹⁾ Allergic contact dermatitis is skin disorder associated with delayed hypersensitivity and characterized by thickening, erythema, papules, and vesicles on the skin, and is an inflammatory response which is mediated by T cells at sites where sensitized individuals are exposed to contact allergens, such as haptens. Primarily, the pathogenesis of human contact dermatitis has been studied in rat and murine models. Therefore, the basic in vivo mechanisms of many inflammatory skin diseases as well as contact dermatitis have been elucidated.⁴⁾ It is difficult to clearly classify the pathogenesis of allergic contact dermatitis and irritant contact dermatitis in animal models. However, we have repeatedly challenged hapten-sensitized mice with hapten and used the pathological condition 24 h after the final challenge as an allergic contact dermatitis-like model. The Spred/Sprouty family functions as crucial negative regulators of the Ras/Raf/extracellular signal-regulated kinase (ERK) signaling pathway and is evolutionarily conserved from Drosophila to mammals.^5–8) In mammals, there are four Sprouty homologs (Sprouty1–4). Although Sprouty2 appears to be ubiquitously expressed in embryonic and adult tissues, the expression of other isoforms is associated with organ/tissue specificity.^9–11) Subsequently, Sprouty family members were shown to suppress the activation of ERK which is induced by various growth factors, such as fibroblast growth factor, platelet-derived growth factor, vascular endothelial growth factor, nerve growth factor, glial cell line-derived neurotrophic factor, amphiregulin (Areg) in a cell type- and growth factor-specific manner.^12,13)

Spred1 and 2 were first described as Sprouty-related proteins and they both function as negative regulators of the Ras/Raf/ERK signaling pathway by binding to Ras with the attendant suppression of Raf activation.^7,8) Therefore, Sprouty and Spred proteins have been identified as closely-related negative regulators of the receptor tyrosine kinase (RTK)-mediated ERK signaling pathway, resulting in inhibition of cellular proliferation, migration, and differentiation in many systems. Importantly, Spred family proteins have been found to be expressed in various organs,, such as the brain, heart, lung, kidney, uterus, thymus, testis, and ovary, but their expression patterns in the respective organs differ.¹²⁾

Previously, we suggested that ear swelling induced by repeated challenge with 2,4,6-trinitrochlorobenzene (TNCB) can be mediated by the ERK associated proliferation pathway.¹⁴⁾ Moreover, epidermal growth factor receptor (EGFR)/ERK signaling pathway may be activated by growth factors, such as Areg and epigen (Epgn) in the auricle as a result of TNCB-challenge. Therefore, in the present study, we examined the effects of inhibitors of ERK and EGFR tyrosine kinase on ear swelling model of contact dermatitis induced by TNCB-challenge. In addition, using the same model, we investigated the expression levels of Spred/Sprouty family.

MATERIALS AND METHODS

Animals

Female BALB/c mice aged 8–9 weeks and weighing 22–26 g, used in the study, were obtained from Tokyo Laboratory Animals Science Co., Ltd. (Tokyo, Japan). This study was approved by the Animal Care Committee at Hoshi University (Tokyo, Japan).

Animal Model of Allergic Contact Dermatitis

Mice were sensitized by applying 100 µL of 5.0% (w/v) TNCB, 0.5% (w/v) 2,4-dinitrofluorobenzene (DNFB), or 1.5% (w/v) oxazolone (Ox) dissolved in acetone to shaved abdominal skin at day 0. The mice were then challenged on days 5, 8, and 11 by applying 20 µL of 1.0% (w/v) TNCB, 0.2% (w/v) DNFB, and 0.5% (w/v) Ox to both sides of the ear. At day 0, sensitized-control (S.C.) mice were treated with 100 µL of 5% (w/v) TNCB, 0.5% (w/v) DNFB, or 1.5% (w/v) Ox and acetone alone on days 5, 8, and 11. The thickness of the auricle was measured one day after the last challenge using a dial thickness gauge (G-7C; Ozaki, Tokyo, Japan). For the isolation of epidermis and dermis, the auricle was incubated in 2.4 units/mL Dispase II (Roche) at 37 °C for 5 min, after which the epidermis and dermis were detached from the auricular cartilage. Thereafter, the epidermis and dermis were further incubated in 2.4 units/mL Dispase II (Roche) at 37 °C for 5 min and ice-cooled to inhibit the enzymatic reactions. Then, the epidermis and dermis were separated using precision tweezers under the guidance of a stereomicroscope. Thirty min before each TNCB-challenge, the inhibitors of ERK activation and EGFR tyrosine kinase, namely, U0126 (300 µg/20 µL) and PD168393 (100 µg/20 µL), respectively or their vehicle (acetone) were correspondingly applied to the ear.

Quantitative RT-PCR

The gene expression levels of the Spred/Sprouty famly were examined via real-time RT-PCR as previously described.¹⁴⁾ The PCR primer set used in this study is presented in Table 1. Data are expressed relative to the expression levels of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA as a housekeeping gene using the 2^−ΔΔCT method.

Table 1.  List of Specific Primers Used for Quantitative PCR Gene Expression Analysis

	Assession number	Primers deoxyribonucleotide sequences		Product size (base pairs)
GAPDH	NM_008084.2	forward	CCTCGTCCCGTAGACAAAATG	100
		reverse	TCTCCACTTTGCCACTGCAA
Spred1	NM_001277256.1	forward	GGAGACGGCGACTTCTGACA	98
		reverse	CTCCGAGTGGTAGCCATCCA
Spred2	NM_033523.4	forward	TCGGCGTGTGTAAGGTCATG	100
		reverse	TAGCATTCCAATACCACCAGTTTG
Spred3	NM_182927.3	forward	GTGAATCCCATCTTCCACCATT	97
		reverse	GCAGGCTCTTCTGGAACTCATC
Sprouty1 (Spry1)	NM_011896.3	forward	ACAGGGACACTCAGCCTGCTA	100
		reverse	GGTCTTCTCGCTACCGAAGGT
Sprouty2 (Spry2)	NM_011897.3	forward	CCACCGATTGCTTGGAAGTT	100
		reverse	ATCCTCTTCTTCCAGCGATGTG
Sprouty3 (Spry3)	NM_001030293.2	forward	CAGGCCAGTCCATCATCAGA	100
		reverse	CTGGAATGCCCTACAGATTGC
Sprouty4 (Spry4)	NM_011898.2	forward	CCCTCGGACGTTACCTTCCT	105
		reverse	AAGATACCTTGCACCAGACACATG

Immunoblots

The preparation of protein homogenate sample solutions and immunoblot analyses were performed as previously described.¹⁴⁾ The membranes were probed with anti-p44/42 mitogen-activated protein kinase (MAPK) (ERK1/2, 1 : 3000 dilution; Cell Signaling Technology, Danvers, MA, U.S.A.), anti-phospho-p44/42 MAPK (p-ERK1/2, 1 : 1000 dilution; Cell Signaling Technology), anti-Spred1 (1 : 1000 dilution; Santa Cruz Biotechnology, Dallas, TX, U.S.A.), anti-Spred2 (1 : 1000 dilution; Proteintech), anti-Sprouty1 (1 : 1000 dilution; Santa Cruz Biotechnology), anti-Sprouty2 (1 : 1000 dilution; Santa Cruz Biotechnology) and anti-GAPDH (1 : 5,000 dilution; Cell Signaling Technology) antibodies. Goat anti-rabbit immunoglobulin G (IgG) (Cell Signaling Technology) or horse anti-mouse IgG (Cell Signaling Technology) were used as the horseradish peroxidase-linked secondary antibody. Immunoreactive proteins were visualized using Chemi-Lumi One (Nacalai Tesque, Shiga, Japan) and assessed using the ImageQuant LAS 500 Image analyzer (GE Healthcare Life Sciences, MA, U.S.A.). The protein levels of GAPDH used as an internal control were examined for comparison with Ponceau-S staining of immunoblotted membrane.

Statistical Analysis

The results were expressed as means ± standard error of the mean (S.E.M.). The statistical significance of differences was determined via an unpaired ANOVA with the Bonferroni/Dunn or Dunnett’s post hoc test. The error bars and statistical significance indicators in their response curves were determined using GraphPad Prism 9 for macOS (GraphPad Software, Inc., San Diego, CA, U.S.A.). Values of p < 0.05 were considered statistically significant.

RESULTS AND DISCUSSION

To examine the phosphorylated/activated form of ERK in TNCB-challenged ears, immunoblotting was performed using specific antibodies that recognize the phosphorylated/activated form of ERK. The results showed that phosphorylation/activation of ERK was increased in TNCB-challenged ears compared to S.C. controls. We confirmed that ERK was activated as a result of TNCB-challenge (Fig. 1). Furthermore, the activation of ERK was inhibited by its selective inhibitor (U0126; Figs. 1A, B), as we also obtained for EGFR tyrosine kinase (PD168393; Figs. 1C, D). The activation of ERK might be mediated by EGFR. Previously, we reported that the ear swelling induced by TNCB-challenge was attenuated by the selective inhibitors of ERK and EGFR tyrosine kinase.¹⁴⁾

Fig. 1. Effects of Selective Inhibitors of ERK Phosphorylation/Activation (U0126; A and B) and Epidermal Growth Factor Receptor (EGFR) Tyrosine Kinase (PD168393; PD, C, and D) on the 2,4,6-Trinitrochlorobenzene (TNCB)-Challenge Induced ERK Activation in the Auricle of Mice

Representative photographs of bands showing phosphorylation of ERK in the TNCB-challenged ear (A and C). The phosphorylated form of ERK (p-ERK) was increased one day after the last challenge and the increase was significantly suppressed by treatment with U0126 or PD (B and D). Data represents the mean ± S.E.M. from four experiments. *** p < 0.001 vs. sensitized-control (S.C.). ### p < 0.001 vs. Vehicle + TNCB-challenge (Chall.).

It has been reported that the Spred/Sprouty family functions as crucial negative regulators of ERK signaling pathway. Thus, possibly, the Spred/Sprouty family may be involved in the activation of ERK associated with TNCB-challenge. Firstly, we examined the gene expression levels of Spred/Sprouty family in the auricles of normal mice. The genes encoding Spred1, Spred2, Sprouty1, and Sprouty2 were observed to be fully expressed in the auricles of normal mice, although little expression of Spred3, Sprouty3, and Sprouty4 was observed (Figs. 2A, B). Subsequently, we investigated the gene expression levels of Spred1, Spred2, Sprouty1, and Sprouty2 in skin swelling associated with TNCB, DNFB, or Ox-induced models of contact dermatitis. Twenty-four hours after the final challenge with TNCB, DNFB, and Ox-, ear thickness was augmented by all haptens-challenge. Thus, ear swellings were induced by all haptens (Figs. 2C, E, G) and the gene expression levels of Spred1, Spred2, Sprouty1, and Sprouty2, in swellings induced by all haptens, were significantly decreased. As well as gene expression, the protein levels of Spred1, Spred2, Sprouty1, and Sprouty2 were decreased in TNCB-induced swelling ear (Fig. 2J). However, no change was observed in Ponceau-S staining and GAPDH expression (Figs. 2I, J).

Fig. 2. The Gene Expression Levels of Spred/Sprouty Family in the Auricle of Normal Mice and Changes in Gene Expression of Spred/Sprouty Family in Hapten-Induced Ear Swelling

The gene expressions of Spred1–3 (A) and Sprouty1–4 (B) in the auricle of normal mice. The genes for Spred/Sprouty family in normal murine are shown as 2^−ΔCT values (A and B). TNCB, 2,4-dinitrofluorobenzene (DNFB), and oxazolone (Ox)-induced ear swelling (C, E, and G, respectively). Data represents the mean ± S.E.M. from four experiments. *** p < 0.001 vs. sensitized-control (S.C.). The gene expression level of Spred 1-2 and Sprouty 1-2 during hapten-indued ear swelling are shown as 2^−ΔΔCT values (D, F and H). Data represents the mean ± S.E.M. from four experiments. * p < 0.05, * p < 0.01, and p < 0.001 vs. Vehicle + TNCB-challenge (Chall.). The protein levels of Spred/Sprouty family in TNCB-induced ear swelling. Representative Ponceau-S staining (I). Typical photographs of immunoblotting bands for the Spred1, Spred2, Sprouty1, and Sprouty2 and GAPDH.

Next, we investigated whether the expression levels of Spred/Sprouty decreased in the epidermis or dermis during hapten-induced skin thickening. Although the gene expression of Spred1 was decreased by TNCB-challenge in the epidermis but not in the dermis (Figs. 3A, B); however, the expression levels of Spred2, Sprouty-1, and Sprouty-2 genes were decreased in the epidermis and dermis of the ear. Hence, it can be inferred that Spred1 in the dermis is not involved in hapten-induced skin thickening.

Fig. 3. Effects of TNCB-Challenge on the Gene Expression of Spred/Sprouty Family in Epidermis and Dermis

The gene expression of Spred1 (A and B), Spred2 (C and D), Sprouty1 (E and F) and Sprouty2 (G and H) in epidermis and dermis 24 h after last TNCB-challenge are shown as 2^−ΔΔCT values. Data represents the mean ± S.E.M. from four experiments. * p < 0.05, ** p < 0.01 and *** p < 0.001 vs. sensitized-control (S.C.).

Furthermore, we demonstrated that the expression levels of Spred/Sprouty family were decreased in the skin of contact dermatitis model. During contact dermatitis, this phenomenon might contribute to the skin thickening due to the proliferation of the cells that make up the skin. However, it is necessary to examine in detail which cells in the epidermis and dermis during contact dermatitis are responsible for activation of ERK and decreased expression of the Spred/Sprouty family.

Oncologically, the expression of Spred/Sprouty family is of critical interest since overactivation of Ras-ERK signaling pathway contributes to tumor cell growth, survival, metastasis, and many other characteristic features. Therefore, negative regulators of this pathway have been reported to prevent tumorigenesis; in fact, Spred/Sprouty family members were considered putative tumor suppressors due to their ability to downregulate Ras-ERK signaling.¹²⁾ To the best of our knowledge, there are no reports involving Spred/Sprouty in skin diseases except cancer. It has been reported that the levels of Spred/Sprouty mRNA and protein are tightly regulated by epigenetic and posttranslational modifications, including microRNA.¹²⁾ Therefore, future studies should target the epigenetic regulation of Spred/Sprouty expression and ERK-mediated pathological changes in contact dermatitis in more detail. We previously suggested that hapten-challenge-induced ear swelling may be mediated by the ERK-induced proliferation pathway. We further suggested that the EGFR/ERK pathway may be activated by increased expression of growth factors, such as Areg and Epgn.¹⁴⁾ Taken together, although the gain and loss function experiments of Speed/Sprouty family need to be performed, the mechanism of hapten-challenge-induced skin thickening might involve not only the enhancement of cell proliferative functions via the activation of ERK by Areg and Epgn, but also the decreased expression of Spred/Sprouty family members.

Acknowledgments

We thank Mr. Kazutaka Mandokoro for his technical assistance.

Conflict of Interest

The authors declare no conflict of interest.

REFERENCES

• 1) Brites GS, Ferreira I, Sebastiao AI, Silva A, Carrascal M, Neves BM, Cruz MT. Allergic contact dermatitis: from pathophysiology to development of new preventive strategies. Pharmacol. Res., 162, 105282 (2020).
• 2) Mittermann I, Aichberger KJ, Bunder R, Mothes N, Renz H, Valenta R. Autoimmunity and atopic dermatitis. Curr. Opin. Allergy Clin. Immunol., 4, 367–371 (2004).
• 3) Jin H, He R, Oyoshi M, Geha RS. Animal models of atopic dermatitis. J. Invest. Dermatol., 129, 31–40 (2009).
• 4) Christensen AD, Haase C. Immunological mechanisms of contact hypersensitivity in mice. APMIS, 120, 1–27 (2012).
• 5) Mason JM, Morrison DJ, Basson MA, Licht JD. Sprouty proteins: multifaceted negative-feedback regulators of receptor tyrosine kinase signaling. Trends Cell Biol., 16, 45–54 (2006).
• 6) Masoumi-Moghaddam S, Amini A, Morris DL. The developing story of Sprouty and cancer. Cancer Metastasis Rev., 33, 695–720 (2014).
• 7) Bundschu K, Walter U, Schuh K. Getting a first clue about SPRED functions. BioEssays, 29, 897–907 (2007).
• 8) Yoshimura A. Regulation of cytokine signaling by the SOCS and Spred family proteins. Keio J. Med., 58, 73–83 (2009).
• 9) Leeksma OC, Van Achterberg TA, Tsumura Y, Toshima J, Eldering E, Kroes WG, Mellink C, Spaargaren M, Mizuno K, Pannekoek H, de Vries CJ. Human sprouty 4, a new ras antagonist on 5q31, interacts with the dual specificity kinase TESK1. Eur. J. Biochem., 269, 2546–2556 (2002).
• 10) Minowada G, Jarvis LA, Chi CL, Neubuser A, Sun X, Hacohen N, Krasnow MA, Martin GR. Vertebrate Sprouty genes are induced by FGF signaling and can cause chondrodysplasia when overexpressed. Development, 126, 4465–4475 (1999).
• 11) Ding W, Bellusci S, Shi W, Warburton D. Genomic structure and promoter characterization of the human Sprouty4 gene, a novel regulator of lung morphogenesis. Am. J. Physiol. Lung Cell. Mol. Physiol., 287, L52–L59 (2004).
• 12) Kawazoe T, Taniguchi K. The Sprouty/Spred family as tumor suppressors: Coming of age. Cancer Sci., 110, 1525–1535 (2019).
• 13) Cheng JC, Chang HM, Xiong S, So WK, Leung PC. Sprouty2 inhibits amphiregulin-induced down-regulation of E-cadherin and cell invasion in human ovarian cancer cells. Oncotarget, 7, 81645–81660 (2016).
• 14) Sakai H, Sato K, Sato F, Kai Y, Mandokoro K, Matsumoto K, Kato S, Yumoto T, Narita M, Chiba Y. Curcumin inhibits epigen and amphiregulin upregulated by 2,4,6-trinitrochlorobenzene associated with attenuation of skin swelling. Inflamm. Res., 66, 663–678 (2017).