Lymphatic Transport and Immune Activation Effect by Locally Administered Extracellular Vesicles from Saccharomyces cerevisiae as Biocompatible Vaccine Adjuvants

Abstract

The yeast strain Saccharomyces cerevisiae is an eukaryotic organism that has been widely used for the production of fermented foods. Most cells secrete extracellular vesicles (EVs), small particles composed of lipid membranes. Elucidating the role of EVs as a new intercellular communication system and developing novel EV-based therapies have attracted the increased attention of researchers. Although recent studies have reported the secretion of EVs from S. cerevisiae, their in vivo fate and subsequent EV-mediated biological responses in the host are unclear. In this study, we characterized both the biodistribution of locally (intradermally and subcutaneously) administered Saccharomyces cerevisiae-derived EVs (S-EVs) and the EV-mediated immune responses to evaluate their potential use as biocompatible vaccine adjuvants. S-EVs were round but heterogeneous in size and contained glucan, DNA, and RNA. Their mean particle sizes and zeta potentials were approximately 177.5 nm and −14.6 mV, respectively. We provided evidence that locally administered S-EVs were delivered to the lymph nodes, mainly reaching the B-cell zone. Measurement of host immune reactions revealed that administration of S-EVs increased the expression of cytokine (tumor necrosis factor (TNF)-α) and costimulatory molecules (CD40, CD80, CD86), which are indicators of immune activation. Especially, subcutaneously injected S-EVs showed potent adjuvanticity, indicating that subcutaneous administration of S-EVs is the desirable approach for achieving effective immune stimulation. These findings will facilitate the development of novel EV-based immunotherapies.

INTRODUCTION

Yeasts are unicellular eukaryotic organisms covered by a cell wall and membrane.¹⁾ They are widely used in the production of fermented foods such as bread, beer, and wine.²⁾ In addition, β-glucan, a substance extracted from yeast, has been reported to enhance host immunity via interaction with pattern-recognition receptors (PRRs) on immune cells, and is thus used as a dietary supplement and an adjuvant in immunotherapy.^3,4) In recent years, various yeast-derived secreted materials have been thought to be beneficial to the host; however, these substances have not been well defined.

Cells secrete extracellular vesicles (EVs), which are small particles composed of lipid membranes, approximately 100 nm in diameter.⁵⁾ The role of EVs as an intercellular communication system has attracted considerable attention.⁶⁾ As the messenger substances contained in EVs reflect the properties of parent cells, both cancer metastasis by EVs derived from cancer cells and tissue regeneration by mesenchymal stem cell-derived EVs have been reported.^7,8) Based on these findings, the development of EV-based biomarkers and therapeutic agents are also expected.^9,10) Additionally, the secretion of EVs has been shown to be a common phenomenon in microorganisms and is highly involved in the crosstalk between different species.¹¹⁾ For example, EVs secreted by Staphylococcus aureus, a pathogenic bacterium, induced cytolytic activity in mammalian cells.¹²⁾ In contrast, EVs derived from beneficial bacteria exhibited immunomodulatory and protective effects against cytotoxicity.^13,14) Recently, we demonstrated the utility of EVs derived from the yeast strain Saccharomyces cerevisiae as vaccine adjuvants by determining their immunostimulatory effects on cultured cells.¹⁵⁾ Compared with the safety concerns associated with the use of adjuvant components derived from pathogenic bacteria,¹⁶⁾ probiotic Saccharomyces cerevisiae-derived EVs (S-EVs) have greater potential as biocompatible vaccine adjuvants.

Most vaccine adjuvants are locally administered with antigens to activate immune cells located at the injection site, including those at the skin.¹⁷⁾ Furthermore, the transfer of vaccine components to lymph nodes, where many immunocompetent cells accumulate, is important for effective antigen presentation.^18,19) However, the distribution and immune responses to S. cerevisiae-derived EVs following their local administration to the host have not been sufficiently investigated. In this study, we aimed to characterize the biodistribution of locally (intradermally and subcutaneously) administered S-EVs and EV-mediated immune responses to evaluate their potential application as vaccine adjuvants. We specifically evaluated the lymphatic transport and localization of S-EVs with T- and B-cells, the major cells in the lymph nodes, after intradermal and subcutaneous administration of S-EVs to mice. We further investigated the expression patterns of cytokines and costimulatory molecules, which are indicators of the immune response.

MATERIALS AND METHODS

Chemicals and Reagents

S. cerevisiae was purchased from Oriental Yeast (Tokyo, Japan). YPD medium and TB Green Premix Ex Taq II were purchased from TaKaRa Bio, Inc. (Shiga, Japan). The Cy7 NHS ester was purchased from BroadPharm (San Diego, CA, U.S.A.). Glucan from baker’s yeast (S. cerevisiae) and PKH26 were purchased from Sigma-Aldrich (St. Louis, MO, U.S.A.). Alexa Fluor 488 labeled anti-mouse F4/80, anti-mouse CD169, anti-mouse CD3, and anti-mouse/human CD45R/B220 antibodies were purchased from BioLegend (San Diego, CA, U.S.A.). OCT compound was purchased from Sakura Finetek (Tokyo, Japan). Silkworm larval plasma (SLP)-HS Single Reagent Set II kit, 2-propanol, ethanol, sodium citrate, and NaOH were purchased from FUJIFILM Wako Pure Chemical Corp. (Osaka, Japan). Sepasol-RNA I Super G was purchased from Nacalai Tesque, Inc. (Kyoto, Japan). Ultrapure deoxyribonuclease (Dnase)/ ribonuclease (Rnase)-free distilled water was obtained from Invitrogen (Carlsbad, CA, U.S.A.). The ReverTra Ace qPCR RT kit was purchased from Toyobo Co. (Osaka, Japan).

Animals

Male ddY mice (5-week-old) were purchased from Japan SLC (Shizuoka, Japan). All animal experiments were conducted in accordance with the principles and procedures outlined in the National Institutes of Health Guide for the Care and Use of Laboratory Animals. All animal experiments were approved by the Animal Experimentation Committee of the Kyoto Pharmaceutical University.

Isolation and Physicochemical Characterization of S-EVs

S. cerevisiae was grown aerobically in YPD medium at 37 °C and the culture supernatant was purified by centrifugation at 4000 × g for 10 min and 10000 × g for 30 min. After removal of cell debris using a 0.22-µm filter, the supernatant was again centrifuged at 100000 × g for 70 min at 4 °C. The pellet was then washed twice with phosphate buffered saline (PBS) (100000 × g for 70 min), and the protein content of obtained S-EVs was estimated by performing the Bradford assay. S-EVs were also subjected to the limulus amebocyte lysate assay using the Limulus Color KY test Wako for the detection of lipopolysaccharide (LPS) level. Collected EVs were observed under the NanoScope IIIa tapping-mode atomic force microscope (AFM; Veeco, Plainview, NY, U.S.A.). The particle sizes and zeta potentials were evaluated using a Zetasizer PRO Blue Label (Malvern Instruments Ltd., Malvern, U.K.).

Compositional Analysis

S-EVs were subjected to an SLP assay to measure the content of glucan. In brief, S-EVs were mixed with SLP-HS Reagent II solution and incubated for 30 min at 30 °C. Absorbance was then measured at 650 nm. Nucleic acids from S-EVs were extracted according to the method described for Sepasol-RNA I Super G. Briefly, RNA from S-EVs was extracted using Sepasol-RNA I Super G and precipitated with 2-propanol. After washing with 75% ethanol, RNA was dissolved in ultrapure water and quantified using a Tecan Infinite 200 PRO (Tecan, Männedorf, Switzerland). DNA was precipitated from RNA-extracted samples by adding ethanol and further washed with 0.1 M sodium citrate in 10% ethanol. The pelleted DNA was centrifuged at 2000 × g for 5 min, dissolved in 8 mM NaOH, and quantified using a Tecan Infinite 200 PRO.

In Vivo Imaging of Locally Administered S-EVs

S-EVs were labeled with the Cy7 NHS ester according to the manufacturer’s instructions, and the free probe was removed by ultracentrifugation. Subsequently, Cy7-labeled S-EVs (40 µg/shot) were intradermally or subcutaneously administered to ddY mice. Mice were deeply anesthetized with medetomidine-midazolam-butorphanol and euthanized at the indicated time points after administration. Images were captured using a Lumina IIIXR in vivo imaging system (PerkinElmer, Inc., Waltham, MA, U.S.A.) with an excitation filter of 740 nm and an emission filter of 790 nm. Image analysis was performed using the Living Image 4.4 Software.

Immunofluorescence Staining of Mice after Administration of S-EVs

After labeling with PKH26 according to the manufacturer’s instructions, EVs were intradermally or subcutaneously administered to the center of the dorsal skin of mice (40 µg/shot). At 24 h after administration, mice were euthanized, and the inguinal lymph nodes were collected and embedded in OCT compound. A cryostat was used to prepare tissue sections, which were fixed with 4% paraformaldehyde. Then, tissue sections were mixed with 25 mM citrate buffer (pH 3.0) and blocked with 20% fetal bovine serum (FBS) for 1 h. Thereafter, sections were washed with PBS and incubated with Alexa Fluor 488 labeled anti-mouse CD3 or anti-mouse/human CD45R/B220 antibody (1 : 200 dilution) for 1 h at 37 °C. Sections were observed under a BZ-X800 All-in-One fluorescence microscope (Keyence Corporation, Osaka, Japan).

Evaluation of Host Immunoreaction by S-EVs

S-EVs (5 or 25 µg/shot) were intradermally or subcutaneously administered to the dorsal skin of mice. The glucan group (50 µg/shot) was used as a positive control. Each administration was repeated thrice at 24 h intervals. Twenty-four hours after the last administration, the injection site of mice was collected and total RNA was extracted using Sepasol-RNA I Super G. Following cDNA synthesis using the ReverTra Ace qPCR RT kit, quantitative real-time PCR (RT-qPCR) was performed using TB Green Premix Ex Taq II. Table 1 lists the primer sequences used in this study.

Table 1. RT-PCR Primer Sequences

Gene	Forward (5′→ 3′)	Reverse (3′→ 5′)
GAPDH	TGTGTCCGTCGTGGATCTG	TTGCTGTTGAAGTCGCAGG
TNF-α	AAAATTCGAGTGACAAGCCTGTAG	CCCTTGAAGAGAACCTGGGAGTAG
TGF-β1	TTGCTTCAGCTCCACAGAGA	TGGTTGTAGAGGGCAAGGAC
CD40	GCTATGGGGCTGCTTGTTGA	ATGGGTGGCATTGGGTCTTC
CD80	GACTCGCAACCACACCATTAAG	CGATGACGACGACTGTTATTACTG
CD86	GTGTTCTGGAAACGGAGTCAAT	GAGCAGCATCACAAGGAGGAG

GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

As for the measurement of EV-mediated function in the lymph, the inguinal lymph nodes of mice administered with S-EVs were collected and lymphocytes were then washed by centrifugation at 1500 rpm for 5 min. Subsequently, lymphocytes were incubated with anti-mouse CD16/32 antibody (1 : 200 dilution; BioLegend) on ice for 30 min to prevent non-specific Fc receptor binding. Then the cells were incubated with fluorescein isothiocyanate (FITC)-CD40, PE-CD80, or FITC-CD86 antibodies (1 : 200 dilution; BioLegend) for 30 min on ice. After wash with PBS, fluorescent intensity was measured by a FACS Calibur flow cytometer (Becton Dickinson and Co., Franklin Lakes, NJ, U.S.A.).

Statistical Analyses

Statistical significance was assessed using the Tukey–Kramer test for multiple comparisons. A p-value of <0.05 was considered statistically significant.

RESULTS

Physicochemical and Compositional Analysis of S-EVs

We characterized the isolated S-EVs using atomic force microscopy and a Zetasizer PRO Blue Label. We observed that S-EVs were round in shape but heterogeneous in size, as shown in Fig. 1A. We found that the mean particle sizes and zeta potentials were approximately 177.5 ± 4.81 nm and −14.6 ± 0.31 mV, respectively (Figs. 1B, C, Table 2). In addition, we determined that the polydispersity index (PDI) of S-EVs was 0.24 ± 0.01. Subsequently, we measured the glucan and nucleic acid of S-EVs. It was found that the glucan was 0.39 ± 0.07 ng/µg protein. We also confirmed that the amount of DNA and RNA contained in S-EVs was 33.3 ± 2.04 and 865.4 ± 3.23 ng/µg protein, respectively. There was no LPS contamination in S-EVs sample.

Fig. 1. Physicochemical Characteristics of EVs

(A) Observation of S-EVs using AFM. Scale = 100 nm. (B, C) Histogram of particle sizes and zeta potentials of S-EVs by Zetasizer PRO Blue Label.

Table 2. Physicochemical and Compositional Analysis of S-EVs

Particle sizes (nm)	177.5 ± 4.81
PDI	0.24 ± 0.01
Zeta potentials (mV)	−14.6 ± 0.31
Glucan content (ng/µg protein of S-EVs)	0.39 ± 0.07
DNA content (ng/µg protein of S-EVs)	33.3 ± 2.04
RNA content (ng/µg protein of S-EVs)	865.4 ± 3.23

Data are presented as the mean ± standard error (S.E.) of 3 experiments.

Lymphatic Transport of Locally Administered S-EVs into Mice

After labeling with Cy7 NHS, we intradermally or subcutaneously injected S-EVs into ddY mice and then performed in vivo imaging. Figures 2A and B show the distribution of intradermally administered S-EVs. We confirmed that the fluorescent signals of Cy7, which indicated S-EVs, were mainly detected in the inguinal lymph nodes of mice 24 h after administration. Similar to the imaging results obtained from the intradermal administration of S-EVs, subcutaneously administered S-EVs were also delivered to the inguinal lymph nodes of mice and then gradually disappeared (Figs. 2C–E, Supplementary Fig. 1).

Fig. 2. Observation of Lymphatic Transport of Locally Administered S-EVs

Cy7-labeled S-EVs (40 µg/mouse) were intradermally or subcutaneously administered into mice. In vivo imaging of mice and their isolated inguinal lymph nodes was performed 24 h after intradermal (i.d.) (A, B) and subcutaneous (s.c.) administration (C, D) of Cy7-labeled S-EVs. (E) Disappearance of S-EVs from lymph nodes after intradermal and subcutaneous administration. Data are presented as the mean ± standard error (S.E.) from 3 mice.

Localization of Administered S-EVs in Lymph Nodes

We subsequently performed immunofluorescence staining of the lymph nodes of mice after the administration of S-EVs. As shown in Fig. 3A, intradermally administered S-EVs (red; PKH26) were partially colocalized with T-cells (green; CD3⁺). In contrast, we noticed that most S-EVs were colocalized with CD45R/B220⁺ cells (green), indicating B-cells (Fig. 3B). Regarding the subcutaneous administration of S-EVs, we observed a lower distribution of S-EVs to the T-cell zone in lymph nodes (Fig. 4A). Conversely, we detected that subcutaneously administered S-EVs were mainly colocalized with B-cells (Fig. 4B).

Fig. 3. Immunofluorescence Staining of Intradermally Administrated S-EVs in Mice Lymph Nodes

PKH26-labeled S-EVs (red) were intradermally administrated into mice. After 24 h, sections were collected from inguinal lymph nodes and reacted with (A) Alexa Fluor 488-labeled anti-mouse CD3 or (B) Alexa Fluor 488-labeled anti-mouse/human CD45R/B220, respectively (green). Scale = 100 µm. (C) Colocalization of T cells and B cells with S-EVs were calculated from 3 mice. Data are presented as the mean + S.E.

Fig. 4. Immunofluorescence Staining of Subcutaneously Administrated S-EVs in Mice Lymph Nodes

PKH26-labeled S-EVs (red) were subcutaneously administrated into mice. After 24 h, sections were collected from inguinal lymph nodes and reacted with (A) Alexa Fluor 488-labeled anti-mouse CD3 or (B) Alexa Fluor 488-labeled anti-mouse/human CD45R/B220, respectively (green). Scale = 100 µm. (C) Colocalization of T cells and B cells with S-EVs were calculated from 3 mice. Data are presented as the mean + S.E.

Immune Response Induced by S-EVs after Intradermal and Subcutaneous Administration into Mice

We measured the levels of mRNA expression of genes associated with immune responses after the administration of S-EVs. As shown in Fig. 5A, intradermal administration of a high dose of S-EVs (25 µg/shot) significantly enhanced the expression of the costimulatory molecule CD40 by approximately 8.1-fold compared with that in the PBS group. Interestingly, we found that a low dose of S-EVs (5 µg/shot) also enhanced the expression of CD40 by approximately 5.1-fold; although not statistically significant. We detected that the mRNA levels of the CD80 costimulatory molecule were upregulated by approximately 2.6-fold (S-EVs 5 µg/shot) and 2.7-fold (S-EVs 25 µg/shot), respectively, as shown in Fig. 5B. Regarding CD86, we found that both the low and high dose of S-EVs increased its level of expression by approximately 4-fold (Fig. 5C). The expression of the proinflammatory cytokine TNF-α, an indicator of the activation of immune cells, was also enhanced by approximately 3-fold (Fig. 5D). In contrast, we noticed that the levels of expression of the anti-inflammatory cytokine transforming growth factor (TGF)-β1 were hardly changed after intradermal administration of S-EVs (Fig. 5E).

Fig. 5. Immune Response at Injection Site after Intradermal Administration of S-EVs

The level of mRNA expression of (A) CD40, (B) CD80, (C) CD86, (D) TNF-α, and (E) TGF-β1 at the injection site was evaluated by RT-PCR. Data are presented as the mean + S.E. from 3 mice. * p < 0.05, compared with PBS.

Figure 6 shows the mRNA expression at the injection site in mice after subcutaneous administration of S-EVs. We observed that a high dose of S-EVs significantly increased the expression of CD40 compared with those in PBS and low dose S-EV groups (Fig. 6A). Furthermore, we found that the expression of CD80 was greatly enhanced by the high dose of subcutaneously administered S-EVs by approximately 27-fold, which was greater than that induced by the low dose of S-EVs (9.7-fold), as shown in Fig. 6B. In contrast, subcutaneously administered S282-EVs only weakly enhanced the expression of CD86 (Fig. 6C). As for the expression of TNF-α, we determined that the high dose of S-EVs significantly increased the mRNA levels by approximately 9.7-fold (Fig. 6D). Although we observed a certain degree of upregulation (3-fold) of TNF-α after administration of a low dose of S-EV, the response was not statistically significant. We also confirmed the moderate expression (not significant) of TGF-β1 after subcutaneous administration of S-EVs (Fig. 6E).

Fig. 6. Immune Response at Injection Site after Subcutaneous Administration of S-EVs

The level of mRNA expression of (A) CD40, (B) CD80, (C) CD86, (D) TNF-α, and (E) TGF-β1 at the injection site was evaluated by RT-PCR. Data are presented as the mean + S.E. from 3 mice. * p < 0.05, compared with PBS. † p < 0.05, compared with 5 µg S-EVs.

We further investigated the immune responses induced by S-EVs at the mice lymph (Figs. 7, 8). As shown in the Fig. 7, expressions of costimulatory molecules (CD40, CD80, and CD86) were hardly changed after the intradermal administration of S-EVs. On the other hand, although there was not significant difference, costimulatory molecules were slightly upregulated at the lymph after receiving the subcutaneous administration of S-EVs (Fig. 8).

Fig. 7. Immune Responses at the Lymph after Intradermal Administration of S-EVs

The expression of (A) CD40, (B) CD80, and (C) CD86 at the lymph was evaluated by flow cytometer. Data are presented as the mean + S.E. from 3 mice.

Fig. 8. Immune Responses at the Lymph after Subcutaneous Administration of S-EVs

The expression of (A) CD40, (B) CD80, and (C) CD86 at the lymph was evaluated by flow cytometer. Data are presented as the mean + S.E. from 3 mice.

DISCUSSION

Elucidation of the in vivo fate of exogenously administered EVs and subsequent EV-mediated biological responses in the host is regarded as an important process for the development of EV-based therapeutics. However, most EV-based research has been limited to evaluating only one of these properties. In this study, we characterized both the biodistribution of locally (intradermally and subcutaneously) administered S-EVs and EV-mediated immune responses to elucidate their potential use as immune adjuvants.

We provided evidence that locally administered S-EVs were distributed in the lymph nodes of mice (Fig. 2), which agrees with a previous investigation on lymphatic transport of locally administered EVs derived from mammalian cells.²⁰⁾ It has been also confirmed that the particle sizes and electric charge of mammalian cell-derived EVs are similar to those of S-EVs obtained in this study^21,22) (Table 2). On the other hand, particle surface proteins of mammalian cell-derived EVs are also important to determine their pharmacokinetics.²³⁾ Although these factors of S-EVs have not yet been fully elucidated, further studies investigating on their compositional analysis will be helpful for understanding the determinant of in vivo fate of S-EVs. Our AFM observations however, revealed that the sizes of collected S-EVs were heterogeneous (Fig. 1A). Importantly, the distribution pathway of particles after local administration has been reported to be mainly dependent on their size.²⁴⁾ Particles smaller than 10 nm in diameter are preferably removed from the injected interstitial space via the blood circulation.²⁵⁾ In contrast, particles with size of 40–170 nm are known to promote lymphatic delivery²⁶⁾ suggesting that the distribution of injected S-EVs in the body would be heterogeneous owing to their diverse sizes. To develop EV-based therapeutic systems, controlling the distribution of administered EVs is indispensable.²⁷⁾ In this study, we isolated S-EVs using ultracentrifugation, which has been widely used in EV-based research.²⁸⁾ Although this method provides a high recovery rate of EVs, it tends to result in a wider range of purified EV sizes.²⁹⁾ In contrast, a combination of other EV separation methods, such as density gradients and size-exclusion chromatography, has been reported to improve their size heterogeneity.³⁰⁾ Therefore, the application of these methods is desirable for the future use of homogenous S-EVs as promising adjuvants.

In this study, immunofluorescent staining demonstrated that the red signals of S-EVs were mainly detected in B-cells located in the outer cortex of follicles rather than in T-cells present in the paracortex²⁴⁾ (Figs. 3, 4). Two pathways are known to exist for the lymphatic transport of administered particles. In addition to the direct transport of particles to B-cells via the interstitial space, subcapsular sinus (SCS) macrophages in lymph nodes have been shown to actively capture foreign substances or particles and transfer them to B-cells for immune reactions.³¹⁾ Furthermore, in our previous study, we reported the preferable uptake of S-EVs by macrophages.¹⁵⁾ Accordingly, it is possible that both the direct lymphatic and cell-mediated transport routes of S-EVs to B-cells were observed in this study. In addition, a B cell-targeting strategy that can elicit effective humoral immune responses is a promising approach for vaccine therapies,³²⁾ suggesting that our findings are helpful for the development of novel B-cell delivery systems based on S-EVs.

As adjuvanticity including the enhancement of proinflammatory cytokines and costimulatory molecules at the injection site is crucial for vaccine efficacy,¹⁷⁾ we investigated the expression profiles of these molecules mediated by locally administered S-EVs. Both intradermally and subcutaneously administered S-EVs were confirmed to increase the levels of proinflammatory cytokine TNF-α, an indicator of enhanced innate immunity, as well as those of CD40, CD80, and CD86 that are signal of immune cell maturation (Figs. 5, 6). Glucan, a major component of the cell wall of S. cerevisiae can trigger immune stimulation through interactions with the Toll-like receptor 2 (TLR2).³³⁾ Moreover, the glucans contained in S-EVs have been shown to play important roles in the activation of immune cells via the TLR2 pathway.¹⁵⁾ Combined with the finding that professional skin immune cells, including dermal dendritic cells also express TLR2,³⁴⁾ the S-EV-induced increase in gene expression could be attributed to the recognition of TLR2 on immune cells located in the skin and the glucan in S-EVs. Nucleic acids from S. cerevisiae have also been shown to activate host immune cells.³⁵⁾ Based on the composition analysis in this study, DNA and RNA were also present in S-EVs (Table 2), suggesting that these cargoes, along with glucan, are important sensors for host immune activation. Overall, subcutaneous administration of S-EVs strongly enhanced gene expression compared with intradermal administration (Figs. 5–8). In addition to the preferential upregulation of the levels of proinflammatory TNF-α and costimulatory molecules, the levels of TGF-β1, an anti-inflammatory cytokine were also increased after subcutaneous administration. This was consistent with a finding that glucan from S. cerevisiae promotes both the proinflammatory as well as anti-inflammatory cytokines release in immune cells.³⁶⁾ Consequently, subcutaneous administration of S-EVs as adjuvants appears to be the desirable approach to achieve effective immune stimulation. On the other hand, some adjuvants have also been used by intravenous administration.³⁷⁾ While the primary target cells of intravenously administered adjuvants are antigen-presenting cells in the spleen, nonspecific accumulation in the liver is often a problem with intravenous administration of EVs.³⁸⁾ Although further study investigating the pharmacokinetics of intravenously administered S-EVs will be needed, applying a targeting strategy that can selectively deliver to the spleen is expected to expand the potential use of S-EVs as novel adjuvants.³⁹⁾

In conclusion, we provided evidence that locally administered S-EVs were delivered to the lymph nodes and mainly reached the B-cell zone. Measurement of the host immune reaction demonstrated that increased expression of cytokines and costimulatory molecules, which are indicators of immune activation, was achieved by the administration of S-EVs. In particular, the subcutaneous administration of S-EVs showed potent adjuvanticity. These findings will facilitate the development of novel EV-based immunotherapies.

Conflict of Interest

The authors declare no conflict of interest.

Supplementary Materials

This article contains supplementary materials.

REFERENCES

• 1) Rocha-Arriaga C, Cruz-Ramirez A. Yeast and nonyeast fungi: the hidden allies in pulque fermentation. Curr. Opin. Food Sci., 47, 100878 (2022).
• 2) Sicard D, Legras JL. Bread, beer and wine: yeast domestication in the Saccharomyces sensu stricto complex. C. R. Biol., 334, 229–236 (2011).
• 3) Brown GD, Gordon S. Fungal β-glucans and mammalian immunity. Immunity, 19, 311–315 (2003).
• 4) Chen C, Huang X, Wang H, Geng F, Nie S. Effect of β-glucan on metabolic diseases: a review from the gut microbiota perspective. Curr. Opin. Food Sci., 47, 100907 (2022).
• 5) Stahl PD, Raposo G. Extracellular vesicles: exosomes and microvesicles, integrators of homeostasis. Physiology, 34, 169–177 (2019).
• 6) Berumen Sánchez G, Bunn KE, Pua HH, Rafat M. Extracellular vesicles: mediators of intercellular communication in tissue injury and disease. Cell Commun. Signal., 19, 104 (2021).
• 7) Maacha S, Bhat AA, Jimenez L, Raza A, Haris M, Uddin S, Grivel JC. Extracellular vesicles-mediated intercellular communication: roles in the tumor microenvironment and anti-cancer drug resistance. Mol. Cancer, 18, 55 (2019).
• 8) Casado-Díaz A, Quesada-Gómez JM, Dorado G. Extracellular vesicles derived from mesenchymal stem cells (MSC) in regenerative medicine: applications in skin wound healing. Front. Bioeng. Biotechnol., 8, 146 (2020).
• 9) Georgantzoglou N, Pergaris A, Masaoutis C, Theocharis S. Extracellular vesicles as biomarkers carriers in bladder cancer: diagnosis, surveillance, and treatment. Int. J. Mol. Sci., 22, 2744 (2021).
• 10) Herrmann IK, Wood MJA, Fuhrmann G. Extracellular vesicles as a next-generation drug delivery platform. Nat. Nanotechnol., 16, 748–759 (2021).
• 11) Díaz-Garrido N, Badia J, Baldomà L. Microbiota-derived extracellular vesicles in interkingdom communication in the gut. J. Extracell. Vesicles, 10, e12161 (2021).
• 12) Wang X, Koffi PF, English OF, Lee JC. Staphylococcus aureus extracellular vesicles: a story of toxicity and the stress of 2020. Toxins (Basel), 13, 75 (2021).
• 13) Hu R, Lin H, Wang M, Zhao Y, Liu H, Min Y, Yang X, Gao Y, Yang M. Lactobacillus reuteri-derived extracellular vesicles maintain intestinal immune homeostasis against lipopolysaccharide-induced inflammatory responses in broilers. J. Anim. Sci. Biotechnol., 12, 25 (2021).
• 14) Morishita M, Horita M, Higuchi A, Marui M, Katsumi H, Yamamoto A. Characterizing different probiotic-derived extracellular vesicles as a novel adjuvant for immunotherapy. Mol. Pharm., 18, 1080–1092 (2021).
• 15) Higuchi A, Morishita M, Nagata R, Maruoka K, Katsumi H, Yamamoto A. Functional characterization of extracellular vesicles from baker’s yeast Saccharomyces cerevisiae as a novel vaccine material for immune cell maturation. J. Pharm. Sci., 112, 525–534 (2023).
• 16) Coffman RL, Sher A, Seder RA. Vaccine adjuvants: putting innate immunity to work. Immunity, 33, 492–503 (2010).
• 17) O’Hagan DT, Valiante NM. Recent advances in the discovery and delivery of vaccine adjuvants. Nat. Rev. Drug Discov., 2, 727–735 (2003).
• 18) Rincon-Restrepo M, Mayer A, Hauert S, Bonner DK, Phelps EA, Hubbell JA, Swartz MA, Hirosue S. Vaccine nanocarriers: coupling intracellular pathways and cellular biodistribution to control CD4 vs. CD8 T cell responses. Biomaterials, 132, 48–58 (2017).
• 19) Gracia G, Cao E, Kochappan R, Porter CJH, Johnston APR, Trevaskis NL. Association of a vaccine adjuvant with endogenous HDL increases lymph uptake and dendritic cell activation. Eur. J. Pharm. Biopharm., 172, 240–252 (2022).
• 20) Srinivasan S, Vannberg FO, Dixon JB. Lymphatic transport of exosomes as a rapid route of information dissemination to the lymph node. Sci. Rep., 6, 24436 (2016).
• 21) Kang JY, Kim H, Mun D, Yun N, Joung B. Co-delivery of curcumin and miRNA-144-3p using heart-targeted extracellular vesicles enhances the therapeutic efficacy for myocardial infarction. J. Control. Release, 331, 62–73 (2021).
• 22) Lee Y, Kim M, Ha J, Lee M. Brain-targeted exosome-mimetic cell membrane nanovesicles with therapeutic oligonucleotides elicit anti-tumor effects in glioblastoma animal models. Bioeng. Transl. Med., 8, e10426 (2022).
• 23) Hoshino A, Costa-Silva B, Shen TL, et al. Tumour exosome integrins determine organotropic metastasis. Nature, 527, 329–335 (2015).
• 24) Nakamura T, Harashima H. Dawn of lipid nanoparticles in lymph node targeting: potential in cancer immunotherapy. Adv. Drug Deliv. Rev., 167, 78–88 (2020).
• 25) Ryan GM, Kaminskas LM, Porter CJH. Nano-chemotherapeutics: maximising lymphatic drug exposure to improve the treatment of lymph-metastatic cancers. J. Control. Release, 193, 241–256 (2014).
• 26) Oussoren C, Zuidema J, Crommelin DJA, Storm G. Lymphatic uptake and biodistribution of liposomes after subcutaneous injection I. Influence of the anatomical site of injection. J. Liposome Res., 7, 85–99 (1997).
• 27) Pinheiro A, Silva AM, Teixeira JH, Gonçalves RM, Almeida MI, Barbosa MA, Santos SG. Extracellular vesicles: intelligent delivery strategies for therapeutic applications. J. Control. Release, 289, 56–69 (2018).
• 28) Chen YS, Lin EY, Chiou TW, Harn HJ. Exosomes in clinical trial and their production in compliance with good manufacturing practice. Ci Ji Yi Xue Za Zhi, 32, 113–120 (2020).
• 29) Yamashita T, Takahashi Y, Nishikawa M, Takakura Y. Effect of exosome isolation methods on physicochemical properties of exosomes and clearance of exosomes from the blood circulation. Eur. J. Pharm. Biopharm., 98, 1–8 (2016).
• 30) Théry C, Witwer KW, Aikawa E, et al. Minimal information for studies of extracellular vesicles 2018 (MISEV2018): a position statement of the International Society for Extracellular Vesicles and an update of the MISEV2014 guidelines. J. Extracell. Vesicles, 7, 1535750 (2018).
• 31) Moran I, Grootveld AK, Nguyen A, Phan TG. Subcapsular sinus macrophages: the seat of innate and adaptive memory in murine lymph nodes. Trends Immunol., 40, 35–48 (2019).
• 32) Kaur K, Sullivan M, Wilson PC. Targeting B cell responses in universal influenza vaccine design. Trends Immunol., 32, 524–531 (2011).
• 33) Su Y, Chen L, Yang F, Cheung PCK. Beta-D-glucan-based drug delivery system and its potential application in targeting tumor associated macrophages. Carbohydr. Polym., 253, 117258 (2021).
• 34) Combadiere B, Liard C. Transcutaneous and intradermal vaccination. Hum. Vaccin., 7, 811–827 (2011).
• 35) Sabatini A, Guerrera G, Corsetti M, Ruocco G, De Bardi M, Renzi S, Cavalieri D, Battistini L, Angelini DF, Volpe E. Human conventional and plasmacytoid dendritic cells differ in their ability to respond to Saccharomyces cerevisiae. Front. Immunol., 13, 850404 (2022).
• 36) Karumuthil-Melethil S, Gudi R, Johnson BM, Perez N, Vasu C. Fungal β-glucan, a Dectin-1 ligand, promotes protection from type 1 diabetes by inducing regulatory innate immune response. J. Immunol., 193, 3308–3321 (2014).
• 37) Alfagih IM, Aldosari B, Alquadeib B, Almurshedi A, Alfagih MM. Nanoparticles as adjuvants and nanodelivery systems for mRNA-based vaccines. Pharmaceutics, 13, 45 (2020).
• 38) Charoenviriyakul C, Takahashi Y, Morishita M, Matsumoto A, Nishikawa M, Takakura Y. Cell type-specific and common characteristics of exosomes derived from mouse cell lines: yield, physicochemical properties, and pharmacokinetics. Eur. J. Pharm. Sci., 96, 316–322 (2017).
• 39) Nakamura T, Sato Y, Yamada Y, Abd Elwakil MM, Kimura S, Younis MA, Harashima H. Extrahepatic targeting of lipid nanoparticles in vivo with intracellular targeting for future nanomedicines. Adv. Drug Deliv. Rev., 188, 114417 (2022).