2023 Volume 46 Issue 11 Pages 1527-1534
Osmundacetone (DHBAc) is an antioxidant compound that has been shown to have neuroprotective and immunomodulatory activities. However, few studies have estimated its effect on cerebral ischemia–reperfusion (I/R) injury. In this study, we investigated the protective effect of DHBAc on the brain tissue of rats with cerebral I/R injury. Rats were respectively given nimodipine (NI), low dose (L-DHBAc) and high dose (H-DHBAc) Osmundacetone, and they were killed under anesthesia after 24 h of reperfusion. And neurological impairment scores, cerebral infarct size and cerebral pathological changes were respectively detected, and mRNA expression of recombinant kelch like ECH associated protein 1 (Keap1) and nuclear factor erythroid 2-related factor 2 (Nrf2), protein expression levels of caspase 3, cleaved caspase 3, heme oxygenase-1 (HO-1) and quinone oxidoreductase1 (NQO1) in ischemic brain tissue were measured. Compared with the I/R group, neurological impairment scores of the DHBAc groups were significantly decreased, and their infarct sizes were significantly smaller. DHBAc could improve the pathological status of brain tissue with cerebral I/R injury, including reducing number of inflammatory cells and area of vacuoles and restoring number of normal neurons. Expression levels of Keap1 mRNA and proteins of cleaved caspase3 were significantly decreased in the DHBAc groups than those of the I/R group, while expression levels of Nrf2 mRNA, HO-1 and NQO1 proteins were remarkably increased. The effect of H-DHBAc was similar to those of NI. These results suggest that DHBAc could mitigate damage to brain tissue in rats with cerebral I/R injury.
Stroke is one of the principal diseases imperiling human life, accounting for 5.2% of all mortality worldwide.1) And ischemic stroke accounts for 80 percent of all stroke cases. Thrombolysis and endovascular thrombectomy are currently the key treatment protocols to reconstruct blood supply after ischemic stroke, which is usually accompanied by inflammation, oxidative stress response,2) a large number of reactive oxy-gen species (ROS),3) nitric oxide (NO), peroxynitrite (ONOO-)4) and other free radicals.
Therefore, these subsequent events of reperfusion are urgent to be solved in the treatment of cerebral ischemia–reperfusion (I/R) injury.
Traditional Chinese medicine (TCM) has significant advantages in the clinical treatment of ischemic stroke. Under the guidance of syndrome differentiation and treatment, Chinese herbal formulas have significant clinical efficacy, which can restore the level of hemorheological indicators and improve the motor function of patients.5) Anti-cerebral I/R mechanisms of TCM compound, single Chinese herb and its effective components include reduction of infarct sizes,6) inflammation,7) toll-like receptor-4 (TLR-4)/nuclear factor (NF)-kappa B pathway,7) platelet activator factor,8) nuclear factor erythroid 2-related factor 2 (Nrf2)/heme oxygenase-1 (HO-1) pathway9) and other signaling pathways.
Osmundacetone (DHBAc; Fig. 1), which is also named 3′,4′-dihydroxy-benzalacetone, is a kind of small molecule phenolic compound. It was first discovered from Osmunda japonica Thunb.10) and used for quality control of Osmunda japonica Thunb.11) DHBAc has been reported to have neuroprotective effects. It could protect glutamic-intoxicated HT22 hippocampal cells at a concentration of 2 µmol/L by reducing ROS accumulation, promoting expression of heat shock protein 70 (HSP70) and HO-1.12) In addition, DHBAc could inhibit the generation of immune cytokines tumor necrosis factor (TNF)-α, interleukin (IL)-1β, IL-6, NO and prostaglandin E2 (PGE2) with approximate IC50 values of 5–10 µmol/L.13)
However, the effect and mechanism of DHBAc on cerebral I/R injury remain unclear. In previous work, we found that Osmunda japonica Thunb. and Osmundacetone had significant antioxidant activity.14) In order to determine the effect of DHBAc on cerebral I/R injury, we investigated effects of DHBAc on expression of cytokines and proteins related to Nrf2 signaling pathway, including mRNA expression levels of Keap1 and Nrf2, protein expression levels of caspase 3, cleaved caspase 3, HO-1 and quinone oxidoreductase1 (NQO1). It has been reported that nimodipine (NI) has a significant protective effect on cerebral I/R injury.15) And it could interfere Nrf2 signal pathway to protect against oxidative stress.16) Therefore, NI was regarded as a positive control drug. In this study, we have further shown that effects of DHBAc on cerebral I/R injury and whether Nrf2 signaling pathway is involved in the cerebral protective effects of DHBAc.
Healthy male Sprague–Dawley (SD) rats of clean grade, weighing 240–280 g, were purchased from Liaoning Changsheng Biotechnology Co., Ltd. (China) (License Number: SCXK (Liao) 2020-0001). The rats were maintained in a standard laboratory environment (12 h/12 h, light/dark cycle, 22 ± 1 °C, 45–55% humidity) with free access to food, and they were adaptively fed for one week. All experiments were performed to conform to the guide for the care and use of laboratory animals, which was published by the United States National Institutes of Health (NIH) (NIH publication, 8th edition, 2011). This study was conducted to conform to the recommendations of the Declaration of Helsinki. The protocol was approved by the Animal Ethics Committee of Hebei University of Chinese Medicine.
ReagentsDHBAc was purchased from National Institutes for Food and Drug Control (No. 111888). Nimodipine was purchased from Aladdin (CAS No.66085-59-4).
Pre-experimentRat model of cerebral I/R injury was established according to literature reports, including the method of cerebral I/R model, modeling cycle, animal experiment stability and safety issues. The rat model of focal cerebral I/R injury was built by the modified thread embolism method, and its obvious pathological changes were in coincidence with those from other reports.17) The result showed that the cerebral I/R model was successful, safe and reliable.
After 12 h fasted and being deprived of water, rats were administered for the last time. Then, the focal cerebral I/R injury model was built by ameliorated thread embolism method after 2 h’ administration. Rats were fasted for 12 h before the operation, and water was deprived for 4 h. Their body temperatures were kept at 37.0 ± 0.5 °C during the whole operation. Rats were narcotized by intraperitoneal injection of 50 mg/kg pentobarbital sodium (Xiya Chemistry Technology, Shandong, China), and they were fixed on operating platform. Skin preservation and sterilization were conducted, and skin was cut 2 cm to the left in the middle of the neck. And the left muscle tissue was separated to fully expose and separate the left common carotid artery (CCA), internal carotid artery (ICA) and external carotid artery (ECA). Then, distal and proximal ends of ECA were ligated, and small vessels were coagulated to prevent bleeding. CCA and ICA were temporarily clipped by small artery clamps. A small V-shaped incision was cut near the distal end of the ECA, and a nylon line bolt was inserted into ICA through the ECA, the fork of ECA and ICA. After taking out the clamps on ICA, the bolt was inserted into the middle cerebral artery (MCA), and MCA was kept blocked for 2 h. Then, the bolt was removed, and blood flow of the left ICA and CCA were restored to induce produce cerebral I/R injury. After 24 h of reperfusion, the rats were narcotized and executed.
Experimental DesignFifty healthy SD rats were randomized into 5 groups according to the random number table method and treated with different drugs by intragastric administration (i.g.) once a day for 7 consecutive days: (1) sham-operated group (Sham, n = 10), rats were intragastric administered normal saline (4.0 g/kg/d); (2) cerebral I/R model group (I/R, n = 10), rats were intragastric administered normal saline (4.0 g/kg/d) ; (3) NI group (NI, n = 10), rats were intragastric administered 4 mL/kg/d of NI solution containing NI (1.0 mg/kg/d) and normal saline (4.0 g/kg/d); (4) low dose DHBAc group (L-DHBAc, n = 10), rats were intragastric administered 4 mL/kg/d of low-dose DHBAc solution containing DHBAc (1.0 mg/kg/d) and normal saline (4.0 g/kg/d); (5) High-dose DHBAc group (H-DHBAc, n = 10), rats were intragastric administered 4 mL/kg/d of high-dose DHBAc solution containing DHBAc (2.0 mg/kg/d) and normal saline (4.0 g/kg/d).
Fasting and water deprivation were carried out before the last administration, and the cerebral I/R model was established at 2 h after the last administration. All rats were sacrificed at 24 h after reperfusion. Brain tissues of rats in each group were taken and fixed with 4% paraformaldehyde or congealed in liquid nitrogen and stored at −70 °C.
Neurological Function AssessmentNeurobehavioral changes were observed, and neurological impairment scores were performed by Zea–Longa’s method after rats woke up from surgery of I/R model establishment.18) Final neurological impairment scores were the average of three independent scores. Zero points indicated no neurological dysfunction symptoms; 1 point indicated contralateral forepaw of ischemic brain could not be fully extended; 2 points indicated that the rat circled to the contralateral side of the ischemic brain; 3 points indicated that the rat fell to the opposite side of the ischemic brain; and 4 points indicated that the rat could not spontaneously walk, and lost consciousness. Rats with 0, 4 points and death were excluded, and rats with 1–3 scores were regarded as successful models.
2,3,5-Triphenyl Tetrazolium Chloride (TTC) StainingRat brain tissue was taken out and congealed at −20 °C for 20 min and was sliced into 5 equal pieces with a thickness 2 mm. And the sections were placed into 2 mL of 1% TTC staining solution and incubated at 37 °C in the dark for 15 min. Then the reverse side of the brain slices were stained for another 15 min, and they were taken out for photographing. Photographs were taken and recorded, and the cerebral infarction areas were calculated by Image-Pro Plus 6.0 software. The formula was as follows: infarction rate (%) = (total infarct area/total section area) × 100%.
Hematoxylin–Eosin (H&E) StainingRat brain tissues were fixed in 4% paraformaldehyde solution at 4 °C, and they were taken out and sequentially processed by dehydrated in an ethanol gradient, infiltrated with xylene and paraffin, and embedded into wax blocks, followed by cutting into 5 µm paraffin tissue sections. Then, the sections were dewaxed to water and sequentially processed by stained with H&E, dehydrated, transparent and mounted. Finally, the degree of cerebral cortex injury and pathological changes of brain tissue were detected in rats of each group under the microscope.
Quantitative Real-Time PCR (qRT-PCR)The ischemic brain tissue was collected in a cryopreservation tube, and total RNA was extracted with Tripure lysis reagent, and the corresponding cDNA was obtained by reverse transcription of total RNA. A 20 µL cDNA sample was obtained by reverse transcription. Primer sequences were synthesized by Gensry Biotech. Using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as the internal control gene, qPCR reaction conditions were initial denaturation at 95 °C for 5 min, followed by 40 cycles of denaturation at 95 °C for 10 s, primer annealing at 60 °C for 10 s, and extension at 72 °C for 10 s. Exicycler TM 96 fluorescence quantitative analyzer (Korea Bioneer Co., Ltd.) was used for fluorescence quantitative analysis, and experimental data were obtained and analyzed by the 2−△△CT method. The primer sequences are shown in Table 1.
| Target gene | Primer sequences (from 5′ to 3′) | Product length |
|---|---|---|
| KEAP1 F | GGTCGCCCTGTGCCTCTAT | 290 |
| KEAP1 R | CATCCGCCACTCATTCCT | |
| Nrf2 F | CCCATTGAGGGCTGTGAT | 249 |
| Nrf2 R | TGTTGGCTGTGCTTTAGG | |
| GAPDH F | CGGCAAGTTCAACGGCACAG | 143 |
| GAPDH R | CGCCAGTAGACTCCACGACAT |
The ischemic brain tissue was placed in ice bath, and the whole protein kit lysis solution (1% phenylmethylsulfonyl fluoride (PMSF)) was added and kept for 5 min. Then, samples were centrifuged at 12000 rpm for 10 min at 4 °C, and the supernatant were separated and diluted 20-fold with phosphate buffered saline (PBS) buffer. Then, the protein concentration was determined by the bicinchoninic acid (BCA) method (BCA kit, Sangon Biotech, Shanghai, China) and calculated with the regression equation.
The proteins were diluted with 5 × loading buffer and PBS, separated by sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) and transferred to a polyvinylidene fluoride membrane. The membranes were blocked with 5% skim milk powder at 23 °C for 1 h and then incubated with primary antibody caspase3 and cleaved caspase 3 (1 : 500 dilution), HO-1 (1 : 400 dilution), NQO-1 (1: 1000 dilution) and GAPDH (1 : 400 dilution). After incubation at 4 °C for 15h, the membranes were rewarmed to 37 °C and incubated with secondary antibody goat anti-rabbit immunoglobulin G (IgG)-HRP (1 : 5000, dilution) for 45 min. Then, the membranes were washed, subjected to chemiluminescence, developed, fixed, and scanned. The optical density values of the target bands were analyzed with a gel image processing system (Gel-Pro-Analyzer software). Image acquisition was performed using the Fluorescence Chemistry Q Multifunction Imaging and Quantification System. With GAPDH as the internal reference, the ratio of the absorbance value of the target protein to the reference absorbance value represented the relative expression amount of the target protein.
Statistical AnalysisData were analyzed by SPSS 22.0 (Chicago, IL, U.S.A.), and calculated data were expressed as mean ± standard deviation (x̄ ± s) of at least 3 experiments. Dunnett’s t-test was used for comparison between the sham group and other groups. Differences between groups were quantified using analysis of Tukey’s test. p < 0. 05 or p < 0. 01 was statistically significant.
Neurological impairment scores in each group were higher after cerebral I/R operation than before. There were significant differences in neurological impairment among different experimental groups. Compared with the Sham group, neurological impairment score of I/R group was significantly higher (** p < 0.01). Neurological impairment scores in the DHBAc groups and NI group were significantly decreased than that in the I/R group (# p < 0.05 and ## p < 0.01). Neurological impairment score of the H-DHBAc group was lower than that of the L-DHBAc group, which suggested that H-DHBAc could better reduce neurological impairment score than L-DHBAc (Fig. 2).
Compared with the sham group (* p < 0.05 and ** p < 0.01). Compared with the I/R group (# p < 0.05 and ## p < 0.01).
TTC staining showed that color of brain tissue was bright red, and there was no white infarct brain tissue in the sham group. Compared with the sham group, the infarct size of the I/R group was significantly larger (** p < 0.01). Infarct sizes of the DHBAc groups were smaller than I/R group (## p < 0.01), and H-DHBAc could reduce infarct size much better than L-DHBAc in cerebral I/R rats (Fig. 3), which indicated that different doses of DHBAc could reduce cerebral infarct sizes of rats with cerebral I/R injuries, and effect of H-DHBAc was much better than that of L-DHBAc.
(A) Sham. (B) I/R. (C) NI. (D) L-DHBAc. (E) H-DHBAc. (F) Quantification of TTC staining expressed as the proportion of cerebral infarction area. Note. Red, Normal brain tissue. White, Infarcted brain tissue. Data represent mean ± standard error of the mean (S.E.M.). Compared to the sham group (* p < 0.05 and ** p < 0.01). Compared with the I/R group (# p < 0.05 and ## p < 0.01).
H&E staining of brain tissue in each group is shown in Fig. 4. In the sham group, there were no pathological changes in brain tissue, and size of neurons was uniform. In the I/R group, there were obvious vacuoles in the cortex area of brain, and neuronal cells disappeared. Brain tissues were disrupted and disordered with a small number of inflammatory cells infiltration. Compared with the I/R group, high dose of DHBAc could significantly ameliorate pathological status of brain tissue with cerebral I/R injuries, including increasement of number of normal neurons (## p < 0.01), reduction of number of inflammatory cells (## p < 0.01) and area of vacuoles (## p < 0.01). Low dose DHBAc also had improvement effect, but there was no significance between the L-DHBAc group and the I/R group. The result indicated that different doses of DHBAc could ameliorate pathological changes of brain tissue in cerebral I/R rats, and effect of H-DHBAc was much better than that of L-DHBAc.
(A) Sham. (B) I/R. (C) NI. (D) L-DHBAc. (E) H-DHBAc. (F) Numbers of normal neurons. (G) Numbers of inflammatory cells. (H) Areas of vacuoles. Black arrows, red arrows and blue arrows represented inflammatory cells, normal neurons and vacuoles, respectively.
The expression levels of Keap1 mRNA and Nrf2 mRNA were analyzed by q RT-PCR (Fig. 5). Compared with the sham group, mRNA expression of Keap1 dramatically decreased in the I/R group (** p < 0.01), while Nrf2 expression significantly increased (** p < 0.01). Each DHBAc group had a significant decrease in Keap1 mRNA expression in brain tissue (## p < 0.01), while Nrf2 mRNA expression significantly increased (# p < 0.05 and ## p < 0.01), which indicated that different doses of DHBAc could regulate and control mRNA expression of Keap1 and Nrf2 in brain tissue of rats with cerebral I/R injury, and effect of H-DHBAc was much better than that of L-DHBAc.
(A) Keap1 mRNA levels. (B) Nrf2 mRNA levels. Data are calculated as mean ± S.E.M. of three independent experiments. Compared with the sham group (** p < 0.01). Compared with the I/R group (# p < 0.05 and ## p < 0.01).
Western blotting was used to analyze protein expression of caspase 3, cleaved caspase 3, HO-1 and NQO1 in brain tissue of rats. As shown in Fig. 6, there were no dramatic differences in expression of caspase 3 between different groups (p > 0.05), and expression level of caspase 3 in each group was similar. Compared with the sham group, protein expression of cleaved caspase 3, HO-1 and NQO1 increased dramatically in the I/R group (** p < 0.01). Compared with the I/R group, each DHBAc group had a significant increase in HO-1 and NQO1 expressions in brain tissue (## p < 0.01), while cleaved caspase 3 expression significantly decreased (## p < 0.01), which suggested that different doses of DHBAc could regulate and control protein expression of cleaved caspase 3, HO-1 and NQO1 in brain tissue of rats with cerebral I/R injury, and effect of H-DHBAc was much better than that of L-DHBAc.
(A–C) Caspase3 and cleaved caspase 3 protein levels. (D, E) HO-1 protein levels. (F, G) NQO1 protein levels. Data were calculated and expressed as mean ± S.E.M. of three independent experiments. Compared with the sham group (* p < 0.05 and ** p < 0.01). Compared with the I/R group (# p < 0.05 and ## p < 0.01).
DHBAc, the index component of Osmundae rhizoma, has been included in the 2022 edition of Pharmacopoeia of the People’s Republic of China,19) and it has been applied to quality control and extraction process research of Osmundae rhizoma.20,21) And it also has been isolated and used for research on quality control, extraction process and metabolism of other plants.22–25) Neuroprotective and antitumor effects are the two main pharmacological activities of DHBAc. DHBAc has potential anti-dementia effects as a water-soluble 5-lipoxygenase inhibitor.26) It can protect glutamic-intoxicated HT22 hippocampal cells by reducing ROS accumulation and stimulating expression of HSP70 and HO-1under concentration of 2 µM, and it also can protect brain cells by anti-apoptosis and inhibition of mitogen-activated protein kinase phosphorylation.12) DHBAc has a significant inhibitory effect on lung cancer cells, and it can inhibit growth and proliferation of tumor cells by regulating mitochondrial metabolism of non-small cell lung cancer cells, including down-regulating key enzymes in glutamine metabolism, inhibiting glutamine/glutamate/α-KG metabolic axis and oxidative phosphorylation.27) And, it has good binding ability to lung cancer cell core targets including CASP3, PARP1 and TP53.28)
In the previous study, we found that DHBAc had significant antioxidant activity,14) and its EC50 values of 2,2-diphenyl-1-picrylhydrazyl and oxygen radical absorbance capacity assays were 0.25 ± 0.01 and 12.20 ± 0.92 mmol TE/g, respectively.29) Therefore, we conducted a study on effect of DHBAc on neurological impairment score, cerebral infarct size, Nrf2 mRNA, HO-1 and NQO1 proteins, and Nrf2-related factors were used as testing indexes of cerebral I/R injury. Our results provided an experimental basis for the prevention and treatment of cerebral I/R injury by DHBAc, which is beneficial to expand clinical prevention and treatment of ischemic stroke. The results of in vivo experiments showed that expression levels of Nrf2 mRNA, HO-1and NQO1 proteins were significantly increased in rat brain tissue after intragastric administration of DHBAc for 7 d and reperfusion for 24 h, while expression levels of Keap1 mRNA and cleaved caspase 3 protein were significantly decreased. The results of TTC staining showed that DHBAc could significantly reduce infarct size in brain tissue of rats with cerebral I/R injury, and effects of H-DHBAc and nimodipine on infarct size were similar. The results of H&E staining also showed that DHBAc could improve the pathological status of brain tissue in rats with cerebral I/R injury. It could significantly alleviate inflammation and cavitation and restore neurons to normal. Effects of H-DHBAc were slightly weaker than those of NI.
NI is a dihydropyridine calcium antagonist that can act on cerebral vessels and nerve cells. It can significantly reduce neuronal Ca2+ spikes,30) infarct size and apoptosis during ischemia-reperfusion.31) It directly eliminates free radicals and regulates Nrf2 signal pathways, including increasing activity of entry nuclear of Nrf2 and expression of its downstream products HO-1 and NQO1.16)
Expression of Keap1 in the infarct area of rat brain decreased at 2 h of reperfusion after 60 min of transient middle cerebral artery occlusion (tMCAO). Nrf2 expression increased at 2 h of reperfusion after tMCAO, and downstream antioxidant proteins such as HO-1 increased significantly from 24 to 72 h.17) Nrf2 is an important transcription factor of antioxidant stress response, which can regulate expression of many cytoprotective genes and proteins, and then affect inflammation, autophagy, apoptosis and other signal pathways. Nrf2 interacts with Keap1, which regulates Nrf2 activity under steady-state conditions. Under the condition of oxidative stress, the conformation of Keap1 homodimer changes lead to so that Nrf2 is not degraded by proteasome, and then Nrf2 activates expression of downstream antioxidant genes such as HO-1 and NQO1.32) These reported results indicated NQO1 is a downstream product of Nrf2, and activation of Nrf2 stimulates expression of NQO1.
In addition, our results were further verified by molecular structural characteristics of DHBAc in two pieces of literature, of which one reported natural compound containing α, β-unsaturated ketone structure may be more prone to activate Nrf2 because of its Michael addition reactions with cysteines on Keap1.32) And the other one reported activation of Nrf2 by polyphenols not only inhibit ROS generation and Keap1-Nrf2 protein–protein interaction, but also degrade Keap1 and regulate Nrf2-related pathways, thereby protecting against exogenous and endogenous oxidative stress damage through Keap1/Nrf2 signaling pathway.33) Based on the results of this study and related pieces of literature,32–34) it is suggested that DHBAc may be used as a small molecule activator of Nrf2 signaling pathway, that is, a potential candidate drug for the treatment of cerebral I/R injury.
However, the protective mechanism of DHBAc against cerebral I/R injury will require further investigation. Is DHBAc involved in other regulatory mechanisms of Nrf2? Are there other signal pathways activated by DHBAc against cerebral I/R injury? These questions still need further research to answer.
LimitationsThis study was to explore expression changes of Nrf2 mRNA, its downstream product, including HO-1 and NQO1 proteins and its related factors, including Keap1 mRNA, caspase 3 and cleaved caspase 3 proteins in DHBAc treatment groups. Although increased Nrf2 protein expression is often consistent with upregulation of Nrf2 mRNA in reported pieces of literature,35,36) there is still a limitation that expression of Nrf2 protein was not involved in this study. Therefore, future studies will comprehensively assess the expression of protein of Nrf2 and Keap 1and mRNA of HO-1 and NQO1 in DHBAc treatment groups.
In summary, the present results suggest that DHBAc has a significant protective effect on brain tissue in rats with cerebral I/R injury. This protection could be achieved by inhibiting the expression of Keap1 mRNA and cleaved caspase3 protein and increasing expression levels of Nrf2 mRNA, HO-1 and NQO1 proteins. Therefore, DHBAc may significantly improve symptoms of cerebral I/R rats by activating Nrf2 signaling pathway.
The authors would like to thank Prof. Yunfeng Li, Prof. Jingshan Zhao and Donglai Ma (associate professor) for their good pieces of advice.
This work was supported by Scientific Research Project of Hebei Administration of Traditional Chinese Medicine (Nos. 2021109 and 2023352), Basic Scientific Research Business Fee Project of Hebei Provincial Universities (No. JCYJ20-21006), Doctoral Program Foundation of Hebei University of Chinese Medicine (No. BSZ2020006) and Construction Program of new research and development platform and institution, Hebei Province Innovation Ability Promotion Plan (No. 20567626H).
BL conceived and conducted the experiments. BL wrote the manuscript. WY checked the Article. LY did language editing for the Article. All authors read and approved the final manuscript.
The authors declare no conflict of interest.
This article contains supplementary materials.
