Androgen-Dependent Expression of CUX2 mRNA in the Pig Liver Is Associated with That of Drug Metabolizing Enzymes and Drug Transporters

Abstract

We previously identified androgen-dependent sex differences in the mRNA expression of drug metabolizing enzymes (DMEs), including CYPs, sulfotransferases and uridine 5′-diphospho-glucuronosyltransferases, and drug transporters in the pig liver and kidney. To elucidate the mechanism for such sex differences in pigs, we herein focused on the key regulators cut-like homeobox 2 (Cux2), B-cell lymphoma 6 (Bcl6), and signal transducer and activator of transcription 5b (Stat5b), which are reported to be responsible for the sex-biased gene expression of Cyps in the mouse liver. We used real-time RT-PCR to examine androgen-dependent sex differences in the mRNA levels of these regulators in the liver and kidney basically using Meishan and Landrace pigs. Significant sex differences (male > female) in the level of CUX2 mRNA were detected in the liver of both breeds, and levels were significantly decreased in males by castration and increased in castrated males and intact females by administering testosterone propionate. No such clear androgen-dependent sex differences in hepatic BCL6 or STAT5B mRNA expression were observed in either breed. In the kidney, androgen-dependent gene expression of these regulators was not observed. In the liver, CUX2 mRNA expression closely correlated with that of DMEs and drug transporters, which were previously shown to have androgen-dependent expression. Together, these findings demonstrate that hepatic CUX2 mRNA is expressed in an androgen-dependent manner, and strongly suggest that CUX2 plays a key role in the androgen-dependent gene expression of hepatic DMEs and drug transporters.

INTRODUCTION

Sex differences in the expression of hepatic drug metabolizing enzymes (DMEs) in rodents were previously shown to occur because of the different secretion pattern of plasma growth hormone (GH) between males and females.^1,2) Signal transducer and activator of transcription 5b (Stat5b),²⁾ B-cell lymphoma 6 (Bcl6),^3–5) and cut-like homeobox 2 (Cux2)^6–8) have been considered key GH-associated regulators for sex-biased gene expression in the mouse liver.

In our earlier work, we reported the androgen-dependent gene expression of several DMEs, including CYPs, sulfotransferases (SULTs), uridine 5′-diphospho-glucuronosyltransferases (UGTs), and drug transporters in the liver and kidney of the pig.^9–11) However, the mechanism of this has not been clarified. Therefore, we herein examined androgen-dependent sex differences in the expression of CUX2, BCL6, and STAT5B in the liver and kidney mainly using Meishan and Landrace pigs. The androgen-dependent mRNA expression of CUX2, but not BCL6 or STAT5B, was observed in the liver, while no such expression of all the factors examined was observed in the kidney. We further proposed that CUX2 was a key factor responsible for the androgen-dependent gene expression of hepatic DMEs and drug transporters.

MATERIALS AND METHODS

Animals and Testosterone Administration

Both sexes of 1- and/or 5-month-old Meishan, Landrace, and their crossbred F₁ (ML, female Meishan × male Landrace; LM, female Landrace × male Meishan) pigs were used, as described in our previous studies.^11,12) Some of the male Meishan and Landrace pigs were castrated at 1 month of age and killed at the age of 5 months. Testosterone propionate (TP, Sigma Chemical Corp., St. Louis, MO, U.S.A.) administration was performed as described previously.¹¹⁾ Briefly, TP dissolved in corn oil was injected intramuscularly (10 mg/kg body weight) five times every 48 h into the rear leg of each pig. The pigs were killed 24 h after the final injection.

All animal experiments were conducted under the guidelines of the Animal Care Committee of the National Institute of Livestock and Grassland Science (Tsukuba, Japan).

Serum Testosterone Concentrations

Previously obtained data were used for serum testosterone measurements.^11,12)

Measurement of mRNA Expression

CUX2, BCL6, and STAT5B mRNA expression levels in individual pigs were measured by real-time RT-PCR. Primer pairs are shown in Table 1. Ribosomal protein L7 (RPL7) was used as an internal standard. Total RNA was prepared from each tissue using TRIzol Reagent (Invitrogen Corp., Carlsbad, CA, U.S.A.). A portion (4 µg) of total RNA was converted to cDNA in 20 µL of reverse transcription (RT)-reaction mixture using the SuperScript First-Strand Synthesis System for RT-PCR (Invitrogen) and oligo d(T)_12-18 according to the manufacturer’s instructions. Real-time RT-PCR was performed with an ABI PRISM 7500 Sequence Detection System using Power SYBR green master mix (PE Applied Systems, Tokyo, Japan) in a total reaction mixture (25 µL) containing 0.5 µL of the RT-reaction mixture and 200 nM of each primer set (forward and reverse in Table 1). The amplification protocol consisted of a cycle at 95 °C for 10 min and then 40 cycles at 95 °C for 15 s and at 60 °C for 1 min. Finally, dissociation stage was performed according to the manufacturer’s protocol (1 cycle at 95 °C for 15 s, at 60 °C for 1 min, at 95 °C for 15 s and at 60 °C for 15s) to confirm a single peak that means an amplification of one PCR product. The amount of each cDNA was determined by the relative standard curve method according to PE Applied Biosystems User Bulletin#2 (1997). Standard curves were generated using an RT-reaction mixture with total RNA extracted from the liver or kidney of 5-month-old female Landrace pigs and used for the corresponding tissues.

Table 1. Primer Pairs Used in This Study

Gene	Forward primer (5′-3′)	Reverse primer (5′-3′)	Amplicon size (bp)	Accession No.
CUX2	acctcaagaccaacaccgtcat	tcaaggtctggttcctcttggg	100	XM_021073976
BCL6	ccgacgttccccgaggag	aagcggcagtcacactcattg	96	NM_001315701
STAT5B	tgcttggaagtttgattctcagga	cggatagagaagtctctggtggta	75	NM_214168
RPL7	tcttcgcctccgtcagatctt	tggatacccccaggcgatata	103	NM_001113217

Statistical Analysis

Statistical differences were assessed by Tukey’s post hoc test after ANOVA or the Student’s t-test. Correlations between indicated parameters were examined by regression analysis.

RESULTS

Androgen-Mediated Expression of Hepatic CUX2 mRNA

We first examined the mRNA expression of hepatic CUX2, BCL6, and STAT5B in 5-month-old Meishan, Landrace, ML, and LM pigs and observed significant sex differences (male > female) in the level of CUX2 mRNA in all breeds (Table 2). Furthermore, the level of CUX2 mRNA in male Meishan, ML, and LM pigs was higher than that of male Landrace pigs (p < 0.01, as assessed by Tukey’s post hoc test among male pigs of each breed). Because male Meishan, Landrace, ML, and LM pigs have different serum testosterone concentrations (Meishan, ML and LM > Landrace),¹³⁾ we further examined the correlation between serum testosterone concentration and hepatic CUX2 mRNA expression, and observed a positive correlation (Fig. 1). Significant sex differences in the level of BCL6 mRNA were also observed in all breeds except for Landrace pigs. In contrast, no sex differences were observed in STAT5B mRNA expression in all breeds examined.

Table 2. Sex Differences in the Amount of Hepatic CUX2, BCL6 and STAT5B mRNAs in 5-Month-Old Meishan, Landrace, ML and LM Pigs

Breed Sex	Genes
	CUX2	BCL6	STAT5B
Meishan
Male	34.491 ± 8.553b)	1.317 ± 0.439a)	0.740 ± 0.122
Female	2.883 ± 0.960	0.840 ± 0.236	0.876 ± 0.076
Landrace
Male	10.458 ± 2.754b)	1.041 ± 0.510	1.246 ± 0.891
Female	1.302 ± 0.624	1.113 ± 0.426	0.938 ± 0.365
ML
Male	26.136 ± 8.682b)	1.350 ± 0.647a)	1.167 ± 0.339
Female	1.164 ± 0.368	0.711 ± 0.242	0.920 ± 0.242
LM
Male	24.895 ± 7.920b)	1.202 ± 0.413a)	1.217 ± 0.514
Female	0.854 ± 0.314	0.839 ± 0.160	0.948 ± 0.253

The level of each mRNA was expressed as relative ratio to the level of RPL7 mRNA in each individual liver, and each datum represents the mean ± S.D. (n = 8 for both sexes of Meishan pigs; n = 7 and 8 for males and females of Landrace pigs, respectively; n = 7 and 10 for males and females of ML pigs, respectively; n = 7 and 9 for males and females of LM pigs, respectively). Significant differences were evaluated using the Student’s t-test. _a,b) Significant sex differences in each breed: _a) p < 0.05, _b) p < 0.01.

Fig. 1. Correlation between Serum Testosterone Concentration and Hepatic CUX2 mRNA Expression

The level of CUX2 mRNA is shown as a ratio to that of RPL7 mRNA, and each symbol represents each individual pig. ○, all female pigs; ● and □, 5- and 1-month-old male Meishan pigs, respectively; ■ and △, 5- and 1-month-old male Landrace pigs, respectively; ▼, 5-month-old male ML pigs; and ▲, 5-month-old male LM pigs. Correlations were assessed by regression analysis, where r is the correlation coefficient.

Based on the aforementioned sex differences, we next examined the effects of androgen on CUX2 and BCL6 mRNA expression in Meishan and Landrace pigs. The level of CUX2 mRNA was lower in 5-month-old castrated male pigs of both breeds than in corresponding intact male pigs, while TP administration to castrated male and intact female pigs resulted in a clear increase in the level of CUX2 mRNA (Fig. 2a). Additionally, the level of CUX2 mRNA was higher in males than in females of both breeds at the age of 1 month (p < 0.05, as assessed by the Student’s t-test), while TP administration to these pigs resulted in a clear increase in the level of CUX2 mRNA (Fig. 2b). Castration and TP administration had no effect on the level of BCL6 mRNA (data not shown).

Fig. 2. Effects of Castration and/or TP Administration on Hepatic CUX2 mRNA Expression in Meishan and Landrace Pigs at the Age of 5 Months (a) and 1 Month (b)

TP was injected intramuscularly into 5-month-old castrated males and intact females of Landrace and Meishan pigs, as described in Materials and Methods. The level of hepatic CUX2 mRNA is shown as a ratio to that of RPL7 mRNA. Columns represent the mean of each experimental group; bars represent standard deviation (S.D.) (n = 8 for 5-month-old intact Meishan pigs of both sexes; n = 7 and n = 8 for 5-month-old intact male and female Landrace pigs, respectively; n = 3 for others). *Significant differences from corresponding intact male pigs were assessed by Tukey’s post hoc test: *p < 0.01. ^#,##Significant differences from corresponding TP-untreated pigs were assessed by the Student’s t-test : ^# p < 0.05, ^## p < 0.01. M, male; CM, castrated male; F, female.

Correlations between CUX2 mRNA Expression and Androgen-Mediated mRNA-Expression of DMEs and Drug Transporters in the Liver

We previously reported that testosterone down-regulated the mRNA expression of CYP1A1, CYP1A2, CYP2A19, CYP2E1, SULT1A1, SULT2A1, and organic cation transporter 1 (OCT1) in the liver,^11–14) and up-regulated that of CYP2B22, CYP2C33, UGT1A1, UGT1A6, and UGT2B31.^14,15) Therefore, using previously obtained data,^11,13–15) we examined the relationships between the mRNA expression of CUX2 and that of DMEs and OCT1 using 5-month-old pigs. We observed negative correlations between CUX2 mRNA expression and that of CYP1A1, CYP1A2, CYP2A19, CYP2E1, SULT1A1, SULT2A1, and OCT1 (Fig. 3a), and positive correlations with that of CYP2B22, CYP2C33, UGT1A1, UGT1A6, and UGT2B31 (Fig. 3b).

Fig. 3. Correlations between CUX2 mRNA Expression and That of Several DMEs and OCT1 in the Pig Liver

a), DME and OCT1 genes negatively regulated by testosterone; b), DME genes positively regulated by testosterone. Symbols are the same as in Fig. 1. The data shown in Fig. 1 were used for CUX2 mRNA expression, and previously obtained data were used for mRNA expression of DMEs and OCT1.^11,13–15) The mRNA levels of all the genes examined are each shown as a ratio to that of RPL7 mRNA. Correlations were assessed by regression analysis, where r is the correlation coefficient.

Renal Expression of CUX2 and BCL6 mRNAs

We previously reported the androgen-dependent mRNA expression of some CYP isoforms and drug transporters in the kidney.^10,11) Therefore, we next examined the dependency of androgen on the expression of renal CUX2 and BCL6 mRNAs in both sexes of 5-month-old Meishan and Landrace pigs. We observed sex differences (male > female) in renal CUX2 and BCL6 mRNA levels in Meishan pigs, but not in Landrace pigs (Fig. 4). TP administration had no effect on CUX2 mRNA expression in intact females or castrated males in either breed, although castration was observed to have a significant effect on CUX2 mRNA expression in Meishan but not Landrace pigs (Fig. 4a). Similarly, for BCL6 mRNA, neither castration nor TP administration to castrated males affected expression in both breeds; however, TP administration significantly increased the level of BCL6 mRNA in females of both breeds (Fig. 4b). No sex differences in the level of STAT5B mRNA were detected in either breed (data not shown).

Fig. 4. Sex Differences and Effects of Castration and/or TP Administration on mRNA Expression of CUX2 (a) and BCL6 (b) in the Kidney of 5-Month-Old Meishan and Landrace Pigs

TP was injected intramuscularly into 5-month-old castrated males and intact females of Landrace and Meishan pigs, as described in Materials and Methods. The level of CUX2 mRNA in the kidney is shown as a ratio to that of RPL7 mRNA. Columns represent the mean of each experimental group; bars represent S.D. The number of pigs examined was the same as in Fig. 2. *^, **Significant differences from corresponding intact male pigs were assessed by Tukey’s post hoc test: * p < 0.05, ** p < 0.01. ^#Significant differences from corresponding TP-untreated pigs were assessed by the Student’s t-test: ^# p < 0.01.

DISCUSSION

The present study aimed to elucidate the mechanism of androgen-dependent mRNA expression of DMEs and drug transporters in the pig liver and kidney^10–15) by examining androgen-dependent sex differences in the mRNA expression of CUX2, BCL6, and STAT5B in Meishan, Landrace, and/or crossbred F₁ (ML and LM) pigs.

The observed sex difference (male > female) in the level of hepatic CUX2 mRNA in pigs is the opposite to that reported in mice and rats,⁷⁾ indicating the existence of species differences in the expression of CUX2. Conversely, the observed sex difference (male > female) in the level of hepatic BCL6 mRNA in pigs in this study, except for Landrace pigs which showed no sex differences, was the same as that reported in rats and mice.³⁾ No sex differences in the level of hepatic STAT5B mRNA were observed in any breed of pig in the present study.

Given that castration of male pigs decreased the expression of hepatic CUX2 mRNA, but not BCL6 mRNA, and TP administration increased it in castrated males and intact females, androgen can be considered responsible for the observed sex difference in CUX2 mRNA expression. In addition, androgen receptor binding sites are found within 2.7 kb 5′upstream region of the pig CUX2 gene by analyzing with JASPAR database (https://jaspar.genereg.net).¹⁶⁾

Examining the relationship between mRNA expression of CUX2 and that of androgen-dependent DMEs and drug transporters^11–15) in the present study revealed significant negative and positive correlations: negative correlations, CYP1A1, CYP1A2, CYP2A19, CYP2E1, SULT1A1, SULT2A1 and OCT1; positive correlations, CYP2B22, CYP2C33, UGT1A1, UGT1A6 and UGT2B31. These findings suggest that DME and OCT1 genes are expressed in an androgen/CUX2-dependent manner. Mammalian CUX2 was previously reported to function as a transcriptional repressor,⁶⁾ indicating that it may be involved in the androgen-dependent down-regulation of hepatic DME and OCT1 genes. However, a mechanism for the CUX2-mediated up-regulation of the DME genes is unclear. Although we observed sex differences in hepatic CUX2 mRNA levels in 1-month-old Landrace and Meishan pigs, no such differences were previously detected in hepatic mRNA expression of CYPs.^12,15) This suggests that the androgen-dependent mRNA expression of hepatic DMEs and drug transporters occurs through an unknown androgen receptor-mediated pathway accompanied by the androgen-mediated induction of CUX2 expression.

In rodent livers, Cux2 and Bcl6 are involved in the expression of female-biased and male-biased genes, respectively.^1–5,8) However, our current findings do not support a similar role for CUX2 and BCL6 in pigs, indicating that these functions differ between species. In contrast to the liver, we detected no androgen-dependent expression of CUX2 or BCL6 mRNA in the pig kidney, suggesting that they are not involved in renal androgen-dependent mRNA expression of DMEs and drug transporters.^10,11)

As far as we know, no studies have been reported on CUX2 involvement in sex-dependent expression of DMEs and drug transporters in the human liver. In addition, the sex-related expression patterns of pig genes examined in this study were not necessarily consistent with those in the corresponding human genes.^17,18) For representative examples, sex differences (male < female) in the expression of pig CYP2A19¹³⁾ and OCT1¹¹⁾ are consistent with those of the corresponding human CYP2A6 and OCT1, whereas a sex difference (male > female) in the expression of pig CYP2B22¹⁵⁾ is the opposite to that in the corresponding human CYP2B6. The causes of species differences in the pattern of sex-dependent expression of those genes remain unclear.

In conclusion, we demonstrate for the first time that CUX2 was up-regulated by testosterone in the pig liver, but not in the kidney, and further propose that CUX2 regulates the androgen-dependent gene expression of hepatic DMEs and drug transporters. Further studies are needed to clarify the molecular mechanisms underlying this regulation.

Acknowledgments

This work was supported in part by a Grant-in-Aid for Scientific Research from the Japan Society for the Promotion of Science (No. 19K06463, M.K.). The authors thank Tsukuba Operation Unit 7 (Technical Support Center of Central Region, NARO, Tsukuba, Japan) for animal care and collecting tissues.

Conflict of Interest

The authors declare no conflict of interest.

REFERENCES

• 1) Waxman DJ, O’Connor C. Growth hormone regulation of sex-dependent liver gene expression. Mol. Endocrinol., 20, 2613–2629 (2006).
• 2) Waxman DJ, Holloway MG. Sex differences in the expression of hepatic drug metabolizing enzymes. Mol. Pharmacol., 76, 215–228 (2009).
• 3) Meyer RD, Laz EV, Su T, Waxman DJ. Male-specific hepatic Bcl6: Growth hormone-induced block of transcription elongation in females and binding to target genes inversely coordinated with STAT5. Mol. Endocrinol., 23, 1914–1926 (2009).
• 4) Zhang Y, Laz EV, Waxman DJ. Dynamic, sex-differential STAT5 and BCL6 binding to sex-biased, growth hormone-regulated genes in adult mouse liver. Mol. Cell. Biol., 32, 880–896 (2012).
• 5) Chikada H, Ida K, Ando E, Inagaki Y, Sakamoto A, Kamiya A. Establishment and analysis of a mouse model that regulates sex-related differences in liver drug metabolism. Lab. Invest., 98, 1500–1511 (2018).
• 6) Gingras H, Cases O, Krasilnikova M, Bérubé G, Nepveu A. Biochemical characterization of the mammalian Cux2 protein. Gene, 344, 273–285 (2005).
• 7) Laz EV, Holloway MG, Chen C-S, Waxman DJ. Characterization of three growth hormone-responsive transcription factors preferentially expressed in adult female liver. Endocrinology, 148, 3327–3337 (2007).
• 8) Conforto TL, Zhang Y, Sherman J, Waxman DJ. Impact of CUX2 on the female muse liver transcriptome: activation of female-biased genes and repression of male-biased genes. Mol. Cell. Biol., 32, 4611–4627 (2012).
• 9) Kojima M. Sex and breed differences in the constitutive gene expression of hepatic drug metabolizing enzymes in Meishan and Landrace pigs: testosterone-mediated differences. Jpn. Agric. Res. Q., 54, 7–12 (2020).
• 10) Kojima M, Degawa M. Androgen-dependent differences in the amounts of CYP mRNAs in the pig kidney. Biol. Pharm. Bull., 44, 1120–1128 (2021).
• 11) Kojima M, Degawa M. Sex, organ, and breed differences in the mRNA expression of drug transporters in the liver and kidney of pigs. Biol. Pharm. Bull., 45, 508–516 (2022).
• 12) Kojima M, Sekimoto M, Degawa M. Androgen-mediated down-regulation of CYP1A subfamily genes in the pig liver. J. Endocrinol., 207, 203–211 (2010).
• 13) Kojima M, Degawa M. Serum androgen level is determined by autosomal dominant inheritance and regulates sex-related CYP genes in pigs. Biochem. Biophys. Res. Commun., 430, 833–838 (2013).
• 14) Kojima M, Degawa M. Sex differences in the constitutive gene expression of sulfotransferases and UDP-glucronosyltransferases in the pig liver: androgen-mediated regulation. Drug Metab. Pharmacokinet., 29, 192–197 (2014).
• 15) Kojima M, Degawa M. Sex differences in constitutive mRNA levels of CYP2B22, CYP2C33, CYP2C49, CYP3A22, CYP3A29 and CYP3A46 in the pig liver: comparison between Meishan and Landrace pigs. Drug Metab. Pharmacokinet., 31, 185–192 (2016).
• 16) Castro-Mondragon JA, Riudavets-Puig R, Rauluseviciute I, et al. JASPAR 2022: the 9th release of the open-access database of transcription factor binding profiles. Nucleic Acids Res., 50 (D1), D165–D173 (2022).
• 17) Yang L, Li Y, Hong H, Chang CW, Guo LW, Lyn-Cook B, Shi L, Ning B. Sex differences in the expression of drug-metabolizing and transporter genes in human liver. J. Drug Metab. Toxicol., 3, 1000119 (2012).
• 18) Uno Y, Takata R, Kito G, Yamazaki H, Nakagawa K, Nakamura Y, Kamataki T, Katagiri T. Sex- and age-dependent gene expression on human liver: an implication for drug-metabolizing enzymes. Drug Metab. Pharmacokinet., 32, 100–107 (2017).