Ononin Relieves the Thyroid Cancer Progression through Targeting the Caspase 3 and CD274 Expression Levels

Abstract

Thyroid cancer (TC) is the most common malignant tumor of endocrine system and head and neck. Ononin is an isoflavone component, which exhibited great antioxidant and anti-inflammatory activities. This study was conducted to explore the functions of ononin in the TC progression. The cell counting kit-8 (CCK8) assay was applied for the cell viability determination. The cell death and apoptosis rate were analyzed by terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate nick-end labeling (TUNEL) staining and flow cytometry. The quantitative real-time PCR (qRT-PCR) and Western blot assays were performed for the relative expressions determination. Lactate dehydrogenase (LDH) release assay was used to assess cytotoxicity. Ononin treatment prominently inhibited the cell viability and induced the cell apoptosis of the TC cells. Besides, caspase 3 (CASP3) was down-regulated and CD274 was up-regulated in TC. Ononin treatment prominently decreased the CD274 levels and increased the CASP3 levels in the TC cells. Additionally, ononin treatment dramatically enhanced the LDH release of the cytotoxicity of T cells. What is more, CASP3 overexpression or CD274 knockdown promoted the role of ononin in TC cells. Ononin treatment induced the cell death of the TC cells through regulating the CASP3 and CD274 expressions.

INTRODUCTION

Thyroid cancer (TC) is the most common malignant tumor of endocrine system and head and neck, and more than 90% of them are differentiated TC.¹⁾ In recent years, the incidence rate of TC is increasing worldwide.²⁾ It is reported that TC is the most commonly diagnosed cancer among women in China before the age of 30.³⁾ At present, the treatment methods of TC mainly include surgical treatment, postoperative ¹³¹I treatment and thyroid stimulating hormone inhibition treatment.^4,5) If the patient does not undergo surgery or the tumor does not take iodine, chemotherapy can be used. However, chemotherapy is not effective and has serious side effects.⁶⁾ Additionally, there are many subtypes of TC that are prone to distant metastasis and postoperative recurrence. The effect of surgery and chemotherapy is not obvious in this type of patients.⁷⁾ Therefore, finding effective antitumor drugs and molecular targets is of great significance to improve the prognosis of patients with TC.

In the past years, many studies have reported various biological functions of lots of promising plants as well as herbs in TC.^8,9) Ononin belongs to isoflavone component in legumes or traditional Chinese medicines, such as soy, red clover, Glycyrrhiza uralensis, hedysarum and so on.¹⁰⁾ Ononin is a white crystalline powder, soluble in methanol, ethanol, dimethyl sulfoxide (DMSO) and other organic solvents. The antioxidant and anti-inflammatory activities of ononin are widely explored.^11,12) Additionally, recent reports revealed that ononin can modulate the cell biological function, including cell death and proliferation.¹³⁾ Meng et al.¹⁴⁾ have demonstrated that ononin exhibited an excellent anti-apoptosis effect in rheumatoid arthritis through regulating the mitogen-activated protein kinase (MAPK) as well as nuclear factor-kappaB (NF-κB) signaling pathways. Yang et al.¹⁵⁾ analyzed the effect of active ingredients in Astragali Radix on lung cancer and found ononin may be the effective component of Astragali Radix through participating in the autophagy of lung cancer cells. However, as far as we know, the specific mechanism of ononin in TC was not previously reported.

Therefore, our study was carried out to explore the role of ononin in the TC progression and provide a theoretical basis for clinical treatment of TC.

MATERIALS AND METHODS

Clinical Sample Collection

The 42 TC cancer tissues (CA) and para-TC cancer tissues (PA) of the TC patients were collected in the Yueyang Hospital of Traditional Chinese Medicine. All patients agreed to participate in the study and this study was also approved by the ethics committee of Yueyang Hospital of Traditional Chinese Medicine. The clinical samples were stored in −80 °C for the further experiments.

Reagents

Ononin and Cisplatin used in this study were purchased from Chengdu Madesheng Technology Co., Ltd. (Chengdu, China). antibodies for cleaved-CAP3, CD274, Bax, Bcl2, were purchased from Abcam (Cambridge, MA, U.S.A.); secondary antibodies were purchased from Beyotime Institute of Technology (Shanghai, China). Small infection RNAs and overexpressed vectors were purchased from GenePharma Co., Ltd. (Shanghai, China). Cell counting kit-8 (CCK-8) kit was purchased from Sigma-Aldrich (U.S.A.). Bovine serum, 1% penicillin and 1% streptomycin were purchased from Gibco (Carlsbad, CA, U.S.A.).

Cell Culture and Treatment

The human thyroid cancer cell lines (TPC-1 and C643 TC cell lines), HTori-3.1control cell lines and T cells were obtained from the Procell Life Technology Co., Ltd. (Wuhan, China). The RPMI-1640 (Gibco) containing 10% fetal bovine serum (Gibco), 1% penicillin (Gibco), as well as 1% streptomycin (Gibco) were used to culture all cells. The culture condition is set to 37 °C and 5% CO₂. Subsequently, 10, 25, 50 µM ononin were added in the cells and cultured for 24 h at the same condition. Additionally, for the positive control, the cells were treated with 5 µmol/L cisplatin for 24 h.

Cell Transfection

The small infection RNA caspase-3 (si-CASP3), si-CD274, caspase-3 overexpression plasmids (oe-CASP3), oe-CD274 and their controls (si-nc and oe-nc) were provided by GenePharma Co., Ltd. (Shanghai, China). All plasmids were transfected to the cells with Lipofectamine 2000 reagent (Thermo Fisher Scientific, MA, U.S.A.). All operations shall be carried out in strict accordance with the instructions.

Cell Viability Analysis

The cells were incubated in a 96-well plates (2 × 10³ cells/well) for 24 h. Then, the 10 µL CCK-8 solution (Sigma-Aldrich) were used to treat the cells for another 2 h (37 °C, 5% CO₂). Finally, the absorbance of the cultured cells was tested at 450 nm wavelength using a microplate reader (Bio-Rad, Hercules, CA, U.S.A.).

Quantitative Real-Time PCR (qRT-PCR)

Total RNAs were separated from the cells with TRIzol reagent (Beyotime, Shanghai, China). Then, we analyzed the quality of the obtained RNA with nanodrop1000. Next, a reverse transcription kit (TaKaRa, Kusatsu, Japan) was purchased to convert RNA into cDNA. Subsequently, the cDNAs were used to perform the qRT-PCR using a SYBR^® Premix Ex TaqTM kit (TaKaRa) at the condition of 95 °C, 10 min; 95 °C, 15 s, 35 cycles; 60 °C, 20 s; 72 °C, 45 s. Finally, the results were analyzed with 2 ^−ΔΔCt method and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was selected as housekeeping gene. The main primer sequences were as follows (5′ → 3′):

CASP3: Forward Primer CATGGAAGCGAATCAATGGACT, Reverse Primer CTGTACCAGACCGAGATGTCA.

CD274: Forward Primer TGGCATTTGCTGAACGCATTT, Reverse Primer TGCAGCCAGGTCTAATTGTTTT.

BAX: Forward Primer CCCGAGAGGTCTTTTTCCGAG, Reverse Primer CCAGCCCATGATGGTTCTGAT.

Bcl2: Forward Primer ACAGGAGCTATACTCCAGGACA, Reverse Primer GATCATACCCGTCATGGGGATA.

GAPDH: Forward Primer TGTGGGCATCAATGGATTTGG, Reverse Primer ACACCATGTATTCCGGGTCAAT.

Western Blot

The cells were lysed to obtain the proteins, the concentration of which was analyzed by bicinchoninic acid (BCA) methods (Beyotime). The 50 µg proteins per well were separated by 10% sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) before transferring to the polyvinylidene difluoride (PVDF) membrane (Millipore, U.S.A.). Then the membranes were sealed with TBST buffer containing 5% bovine serum albumin (BSA) (Gibco) for 1 h. After that, the membranes were incubated with the primary antibodies in a refrigerator at 4 °C for 12 h. (cleaved-CAP3, 1 : 1000; CD274, 1 : 600; Bax, 1 : 800; Bcl2, 1 : 1200; Abcam). Subsequently, TBST was used to wash the membranes for 3 times, and the membrane was incubated with the secondary antibody for 1 h. Finally, the membranes was observed by ECL luminescence liquefaction (Beyotime). The ImageJ software (NIH, MD, U.S.A.) was used to analyze the gray value of the membranes, and GAPDH was set as the internal reference.

Detection of Apoptosis

Annexin V-PE/propidium iodide (PI) cell apoptosis kit (Beyotime) was purchased to evaluate cell apoptosis rate after treatment. Briefly, the cell in each group was collected after centrifugation. Cell resuspension was treated with the binding buffer (400 µL) and the cell concentration was adjusted to 1 × 10⁶ cells/mL. Annexin V-PE staining solution (5 µL) and PI solution (10 µL) was incubated with the cells for 15 min. Finally, the apoptosis rate was immediately tested by a flow cytometer (Becton, Dickinson and Company).

Terminal Deoxynucleotidyl Transferase-Mediated Deoxyuridine Triphosphate Nick-End Labeling (TUNEL) Staining

TUNEL staining kit (Beyotime) was selected for cell death analysis. Briefly, the cells were fixed with 4% paraformaldehyde and permeated using 0.3% Triton X-100. After that, 50 µL Biotin-dUTP buffer was added to the cells and cultured at 37 °C for 1 h. Finally, the TUNEL positive cells were observed with fluorescence microscope.

Cytotoxicity Assay

Cytotoxicity of activated T cells against TC cells was analyzed using lactate dehydrogenase (LDH) release assay. Briefly, after treatment, the TC cells were cultured at in 96-well plates (5 × 10³ cells/well) for 24 h. Next, after washing, the TC cells were co-cultured with activated T cells (1 : 10). After 4 h, cytotoxicity assay was performed with a cytotoxicity detection kit (Abcam).

Animal Experiments

BALB/c nude mice were provided by the Animal Center of the Yueyang Hospital of Traditional Chinese Medicine. One hundred microliters C643 cells (3 × 10⁶ cells/mL) were injected subcutaneously into the right flank of the mice. The mice were divided into control group and ononin group. The mice in the ononin group were intragastric injection 2 mg/kg ononin daily. The mice in the Control group received the same volume of normal saline daily. After the tumor volume was measured on day 7, 14, 21 and 28, all rats were euthanized, the subcutaneous tumor was weighed as well as photographed.

Statistical Analysis

All data statistics was treated with SPSS 20.0 software (IBM Corp., Armonk, NY, U.S.A.). Comparison between groups used student’s t-test or one-way ANOVA. The results were displayed as mean ± standard deviation (S.D.). p < 0.05 indicates a significant difference.

RESULTS

Ononin Depressed the Cell Viability of TC Cells

The structural formula of ononin was displayed in Fig. 1A. Besides, we found that ononin treatment prominently elevated the inhibition rate of cell viability in the TC cells. And the inhibition rate was increased with the increase of concentration of ononin (Fig. 1B). Therefore, 50 µM ononin was applied for the further experiments.

Fig. 1. Ononin Depressed the Cell Viability of TC Cells

A: The structural formula of ononin. B: The cell viability of the TC cells was detected by CCK-8 methods after different concentrations of ononin (10, 25, 50 µM) treatment. * p < 0.05. ** p < 0.01.

Ononin Promoted the CASP3 Levels and Depressed the CD274 Levels in the TC Cells

According to a previous study,¹⁵⁾ ononin was reported to be related to the regulation of apoptosis and immune related genes. We found that after ononin treatment, the CASP3 was up-regulated and CD274 was down-regulated in the TC cells (Fig. 2A). Additionally, the protein–protein interaction network exhibited that CASP3 and CD274 have more connections with other nodes and belong to core target gene proteins (Fig. 2B). Besides, compared with the paracancerous tissues, the CASP3 was down-regulated and CD274 was up-regulated in the TC tissues (Fig. 2C), which was also confirmed in the TC cells (Figs. 2D, E).

Fig. 2. Ononin Promoted the Apoptosis of the TC Cells

A: The apoptosis and immune related genes were tested by qRT-PCR after 50 µM ononin treatment. B: Protein–protein interaction network of CASP3 and CD274. C: The CASP3 and CD274 expressions in TC tissues were tested by qRT-PCR. The CASP3 and CD274 expressions in TC cell were measured by qRT-PCR (D) and Western blot (E). * p < 0.05. ** p < 0.01. *** p < 0.001.

Ononin Promoted the Apoptosis of the TC Cells

Next, after cisplatin or ononin treatment, the flow cytometry showed that the apoptosis rate of the TC cells was prominently elevated (Fig. 3A), which was also demonstrated by TUNEL staining (Fig. 3B). Additionally, after cisplatin or ononin treatment, the Bax was prominently elevated and Bcl2 was prominently declined at mRNA and protein levels in the TC cells (Figs. 3C, D). What is more, the cytotoxicity of T cells treated TC cells was analyzed by LDH releasing assay. Cisplatin or ononin treatment prominently elevated the T cell-mediated cell death in the TC cells (Fig. 3E). All these results indicated that compared with cisplatin treatment, ononin has a similar therapeutic effect in TC cells.

Fig. 3. Ononin Promoted the Apoptosis of the TC Cells

The apoptosis rate of the 50 µM ononin or 5 µM cisplatin treated TC cells were tested by Flow cytometry (A) and TUNEL staining (B). The Bax and Bcl2 levels of the 50 µM ononin or 5 µM cisplatin treated TC cells were analyzed by qRT-PCR (C) and Western blot (D). E: Cytotoxicity of activated T cells against TC cells after 50 µM ononin or 5 µM cisplatin treated was analyzed using LDH release assay. ** p < 0.01.

Ononin Promoted the Apoptosis of the TC Cells via Targeting CASP3

After si-CASP3 transfection, the cleved-CASP3 expression in the TC cells was declined at mRNA and protein levels, and oe-CASP3 transfection displayed an opposite effect (Figs. 4A, B). Additionally, si-CASP3 neutralized the inhibitory effects of ononin on cell viability of TC cells and oe-CASP3 promoted it (Fig. 4C). The flow cytometry and TUNEL staining results showed si-CASP3 neutralized the promoting effects of ononin on apoptosis rate of TC cells and oe-CASP3 promoted it (Figs. 4D, E). Besides, si-CASP3 decreased the Bax and elevated the Bcl2 at mRNA and protein levels in the ononin treated TC cells and oe-CASP3 displayed an opposite effect (Figs. 4F, G).

Fig. 4. Ononin Promoted the Apoptosis of the TC Cells via Targeting CASP3

A, B: Validation of si-CASP3 and oe-CASP3 transfection efficiency. C: The cell viability of the 50 µM ononin treated TC cells was detected by CCK-8 methods after si-CASP3 and oe-CASP3 transfection. The apoptosis rate of the 50 µM ononin treated TC cells were tested by Flow cytometry (D) and TUNEL staining (E) after si-CASP3 and oe-CASP3 transfection. The Bax and Bcl2 levels of the 50 µM ononin treated TC cells were analyzed by qRT-PCR (F) and Western blot (G) after si-CASP3 and oe-CASP3 transfection. * p < 0.05, ** p < 0.01 vs. control group. ^## p < 0.01 vs. ononin + si-nc group. ^& p < 0.05, ^&& p < 0.01 vs. ononin + oe-nc group.

Ononin Promoted the LDH Release via Targeting CD274

After si-CD274 transfection, the CD274 expression in the TC cells co-cultured with T cells was declined at mRNA and protein levels, and oe-CD274 transfection displayed an opposite effect (Figs. 5A, B). Additionally, the oe-CD274 transfection prominently neutralized the T cell-mediated cell death in the ononin treated TC cells, and si-CD274 transfection prominently promoted it (Fig. 5C).

Fig. 5. Ononin Promoted the LDH Release via Targeting CD274

A, B: Validation of si-CD274 and oe-CD274 transfection efficiency. C: Cytotoxicity of activated T cells against TC cells after ononin treated and si-CD274 and oe-CD274 transfection was analyzed using LDH release assay. ** p < 0.01 vs. control group. ^## p < 0.01 vs. ononin + oe-nc group. ^&& p < 0.01 ononin + si-nc group.

Ononin Suppressed the TC Progression in Vivo

Finally, after establishing a TC mice xenograft model, we found that ononin treatment prominently declined the size (Fig. 6A), volume (Fig. 6B) as well as weight (Fig. 6C) of the tumors.

Fig. 6. Ononin Suppressed the TC Progression in Vivo

A: The images of the tumor. The tumor volume (B) as well as weight (C) were calculated. ** p < 0.01.

DISCUSSION

As a malignant tumor prone to recurrence and metastasis, the treatment of TC has always been a major challenge.¹⁶⁾ This research demonstrated ononin, a novel plant derived compounds, effectively inhibited the TC progression through promoting generation of CASP and degradation of CD274. In addition, ononin enhanced apoptosis related genes levels and the cytotoxicity of co-cultured T cells, thus activating the cell apoptosis and immune microenvironment in TC.

In the past years, various phytochemicals have been applied to the TC treatment.¹⁷⁾ The phytochemicals are active substances that occur naturally in plants, which are easily obtained via ingesting a variety of plants. They have gradually become a research hotspot in the treatment of cancer due to their unique anti-inflammatory, antioxidant as well as anticancer effects.^18,19) For example, in medullary TC or anaplastic TC, resveratrol, a natural stilbenoid, was confirmed to elevate re-differentiation and apoptosis, and suppress growth of the TC cells through regulating the Notch1 signaling pathway.^20,21) Besides, the combination of thymoquinone and genistein effectively inhibited the cell viability as well as angiogenesis, and induced the cell apoptosis in TC.²²⁾ As a natural isoflavone, ononin is widely used in the treatment of various diseases. Gong et al. found ononin functioned as a promising target drug for the treatment of angiogenetic-related disease.¹³⁾ Xu et al. revealed that ononin relieved the inflammation and cartilage degradation in osteoarthritis via modulating the MAPK as well as NF-κB pathways.²³⁾ Additionally, in lung cancer¹⁵⁾ and breast cancer,²⁴⁾ ononin exhibited the ability to inhibit proliferation and promote apoptosis, indicating the anti-tumor effects of ononin. Similarly, this research demonstrated that ononin effectively induced the cell apoptosis and declined the cell viability of the TC cells, which preliminarily expressed the therapeutic effect of ononin on TC. Compared with the previous studies, our study further expanded the application of ononin in cancers. However, the specific mechanism of ononin still needs our follow-up experiments to investigate.

Caspase is the central link of cell apoptosis. Among the caspase family, CASP3 is critical in the process of apoptosis. CASP3 usually exists in cells in the form of pro-CASP3.²⁵⁾ Under the action of oxidants, UV rays and other inducements, it is released from mitochondria to cytoplasm and activated by cutting. Activated CASP3 has the ability to cut peptide bonds after aspartic acid residues, and degrade and inactivate important proteins in cytoplasm, nucleus and cytoskeleton.²⁶⁾ CASP3 is not only the most key enzyme to execute mammalian cell apoptosis, but also the core protease in the protease cascade that causes apoptosis.²⁷⁾ Bcl2 is an important inhibitor of apoptosis gene, which can inhibit the occurrence of apoptosis caused by a variety of stimuli and injuries; when Bax is overexpressed, it can synthesize homodimer by itself and promote the occurrence of apoptosis. Bcl-2 and Bax can activate caspase-3 together.²⁸⁾ Accumulating studies demonstrated focusing on CASP3 mediated apoptosis is an effective method for the treatment of various cancers.^29–31) In our research, we found that CASP3 was down regulated in TC, and ononin treatment elevated the CASP3 levels in TC cells. As reported by previous study, ononin could regulate the apoptosis in many cancers.^32,33) Combined with our research results, we speculated that ononin might promote apoptosis of cancer cells by regulating the expression of CASP3.

CD274, also known as PD-L1 or B7-H1, is an important immune checkpoint protein. By binding with its receptor programmed cell death protein 1, CD274 can inhibit T cell activation and promote tumor immune escape.³⁴⁾ At present, anti-CD274 therapy is one of the latest tumor immunotherapy methods in addition to surgery, chemotherapy, radiotherapy, targeted drugs and other common treatment methods. In many cancers, high CD274 expression was observed and closely related poor prognosis.³⁵⁾ Zhang et al. found that Iinterleukin-6 promoted the CD274 expression in TC cells, resulting in the metastasis of TC.³⁶⁾ In our research, through LDH release analysis, we confirmed ononin treatment promoted the cytotoxicity of co-cultured T cells. Additionally, we demonstrated that ononin treatment declined the CD274 levels in TC cells, which might be the reason for its activation of the immune microenvironment and the increase of apoptosis rate in TC cells.

However, there are still some limitations in our study. Our research is a basic research. The effects of ononin on clinical treatment needs to be explored through further clinical trials.

To sum up, this research confirmed that ononin effectively induced the cell death in TC progression through targeting and regulating the CASP3 and CD274 expressions. Our research provided a novel drug for the TC treatment.

Conflict of Interest

The authors declare no conflict of interest.

REFERENCES

• 1) Prete A, Borges de Souza P, Censi S, Muzza M, Nucci N, Sponziello M. Update on fundamental mechanisms of thyroid cancer. Front. Endocrinol. (Lausanne), 11, 102 (2020).
• 2) Laha D, Nilubol N, Boufraqech M. New therapies for advanced thyroid cancer. Front. Endocrinol. (Lausanne), 11, 82 (2020).
• 3) Li M, Zheng R, Dal Maso L, Zhang S, Wei W, Vaccarella S. Mapping overdiagnosis of thyroid cancer in China. Lancet Diabetes Endocrinol., 9, 330–332 (2021).
• 4) Tuttle RM. Controversial issues in thyroid cancer management. J. Nucl. Med., 59, 1187–1194 (2018).
• 5) Bauer AJ. Pediatric thyroid cancer: genetics, therapeutics and outcome. Endocrinol. Metab. Clin. North Am., 49, 589–611 (2020).
• 6) Grani G, Ramundo V, Verrienti A, Sponziello M, Durante C. Thyroid hormone therapy in differentiated thyroid cancer. Endocrine, 66, 43–50 (2019).
• 7) Schmidbauer B, Menhart K, Hellwig D, Grosse J. Differentiated thyroid cancer-treatment: state of the art. Int. J. Mol. Sci., 18, 1292 (2017).
• 8) Zhu G, Musumeci F, Byrne P. Induction of thyroid neoplasm following plant medicine marine algae (sargassum): a rare case and review of the literature. Curr. Pharm. Biotechnol., 14, 859–863 (2013).
• 9) Sharifi-Rad J, Rajabi S, Martorell M, López MD, Toro MT, Barollo S, Armanini D, Fokou PVT, Zagotto G, Ribaudo G, Pezzani R. Plant natural products with anti-thyroid cancer activity. Fitoterapia, 146, 104640 (2020).
• 10) Yu Y, Li Z, Guo R, Qian J, Zhang H, Zhang J, Zhao X, Wang S, Wang Y. Ononin, sec-O-β-d-glucosylhamaudol and astragaloside I: antiviral lead compounds identified via high throughput screening and biological validation from traditional Chinese medicine Zhongjing formulary. Pharmacol. Res., 145, 104248 (2019).
• 11) Pan R, Zhuang Q, Wang J. Ononin alleviates H2O2-induced cardiomyocyte apoptosis and improves cardiac function by activating the AMPK/mTOR/autophagy pathway. Exp. Ther. Med., 22, 1307 (2021).
• 12) Dong L, Yin L, Zhang Y, Fu X, Lu J. Anti-inflammatory effects of ononin on lipopolysaccharide-stimulated RAW 264.7 cells. Mol. Immunol., 83, 46–51 (2017).
• 13) Gong G, Zheng Y, Kong X, Wen Z. Anti-angiogenesis function of ononin via suppressing the MEK/Erk signaling pathway. J. Nat. Prod., 84, 1755–1762 (2021).
• 14) Meng Y, Ji J, Xiao X, Li M, Niu S, He Y, Tong G, Pan C. Ononin induces cell apoptosis and reduces inflammation in rheumatoid arthritis fibroblast-like synoviocytes by alleviating MAPK and NF-kappaB signaling pathways. Acta Biochim. Pol., 68, 239–245 (2021).
• 15) Yang B, Yang N, Chen Y, Zhu M, Lian Y, Xiong Z, Wang B, Feng L, Jia X. An integrated strategy for effective-component discovery of Astragali Radix in the treatment of lung cancer. Front. Pharmacol., 11, 580978 (2021).
• 16) Ciarallo A, Rivera J. Radioactive iodine therapy in differentiated thyroid cancer: 2020 update. AJR Am. J. Roentgenol., 215, 285–291 (2020).
• 17) Shin HJ, Hwang KA, Choi KC. Antitumor effect of various phytochemicals on diverse types of thyroid cancers. Nutrients, 11, 125 (2019).
• 18) Zhang Y, Liu X, Ruan J, Zhuang X, Zhang X, Li Z. Phytochemicals of garlic: promising candidates for cancer therapy. Biomed. Pharmacother., 123, 109730 (2020).
• 19) Al-Ishaq RK, Overy AJ, Büsselberg D. Phytochemicals and Gastrointestinal Cancer: Cellular Mechanisms and Effects to Change Cancer Progression. Biomolecules, 10, 105 (2020).
• 20) Yu XM, Jaskula-Sztul R, Ahmed K, Harrison AD, Kunnimalaiyaan M, Chen H. Resveratrol induces differentiation markers expression in anaplastic thyroid carcinoma via activation of Notch1 signaling and suppresses cell growth. Mol. Cancer Ther., 12, 1276–1287 (2013).
• 21) Truong M, Cook MR, Pinchot SN, Kunnimalaiyaan M, Chen H. Resveratrol induces Notch2-mediated apoptosis and suppression of neuroendocrine markers in medullary thyroid cancer. Ann. Surg. Oncol., 18, 1506–1511 (2011).
• 22) Attoub S, Sperandio O, Raza H, Arafat K, Al-Salam S, Al Sultan MA, Al Safi M, Takahashi T, Adem A. Thymoquinone as an anticancer agent: evidence from inhibition of cancer cells viability and invasion in vitro and tumor growth in vivo. Fundam. Clin. Pharmacol., 27, 557–569 (2013).
• 23) Xu F, Zhao LJ, Liao T, Li ZC, Wang LL, Lin PY, Jiang R, Wei QJ. Ononin ameliorates inflammation and cartilage degradation in rat chondrocytes with IL-1beta-induced osteoarthritis by downregulating the MAPK and NF-kappaB pathways. BMC Complement. Med. Ther., 22, 25 (2022).
• 24) Zhou R, Chen H, Chen J, Chen X, Wen Y, Xu L. Extract from Astragalus membranaceus inhibit breast cancer cells proliferation via PI3K/AKT/mTOR signaling pathway. BMC Complement. Altern. Med., 18, 83 (2018).
• 25) Beroske L, Van den Wyngaert T, Stroobants S, Van der Veken P, Elvas F. Molecular imaging of apoptosis: the case of caspase-3 radiotracers. Int. J. Mol. Sci., 22, 3948 (2021).
• 26) Lossi L, Castagna C, Merighi A. Caspase-3 mediated cell death in the normal development of the mammalian cerebellum. Int. J. Mol. Sci., 19, 3999 (2018).
• 27) Van Opdenbosch N, Lamkanfi M. Caspases in cell death, inflammation, and disease. Immunity, 50, 1352–1364 (2019).
• 28) Wang Y, Sun H, Zhang J, Xia Z, Chen W. Streptozotocin-induced diabetic cardiomyopathy in rats: ameliorative effect of PIPERINE via Bcl2, Bax/Bcl2, and caspase-3 pathways. Biosci. Biotechnol. Biochem., 84, 2533–2544 (2020).
• 29) Zheng Z, Bian Y, Zhang Y, Ren G, Li G. Metfo + rmin activates AMPK/SIRT1/NF-kappaB pathway and induces mitochondrial dysfunction to drive caspase3/GSDME-mediated cancer cell pyroptosis. Cell Cycle, 19, 1089–1104 (2020).
• 30) Zhou M, Liu X, Li Z, Huang Q, Li F, Li CY. Caspase-3 regulates the migration, invasion and metastasis of colon cancer cells. Int. J. Cancer, 143, 921–930 (2018).
• 31) Wang W, Zhu M, Xu Z, Li W, Dong X, Chen Y, Lin B, Li M. Ropivacaine promotes apoptosis of hepatocellular carcinoma cells through damaging mitochondria and activating caspase-3 activity. Biol. Res., 52, 36 (2019).
• 32) Ye B, Ma J, Li Z, Li Y, Han X. Ononin shows anticancer activity against laryngeal cancer via the inhibition of ERK/JNK/p38 signaling pathway. Front. Oncol., 12, 939646 (2022).
• 33) Huang JZ, Li LL, Tan XY, Wu ZY, Chen DW, Luo X. The effect of calycosin-7-O-β-D-glucoside and its synergistic augmentation of cisplatin-induced apoptosis in SK-OV-3 cells. Curr. Pharm. Des., 28, 2161–2166 (2022).
• 34) Mahoney KM, Rennert PD, Freeman GJ. Combination cancer immunotherapy and new immunomodulatory targets. Nat. Rev. Drug Discov., 14, 561–584 (2015).
• 35) Ohaegbulam KC, Assal A, Lazar-Molnar E, Yao Y, Zang X. Human cancer immunotherapy with antibodies to the PD-1 and PD-L1 pathway. Trends Mol. Med., 21, 24–33 (2015).
• 36) Zhang GQ, Jiao Q, Shen CT, Song HJ, Zhang HZ, Qiu ZL, Luo QY. Interleukin 6 regulates the expression of programmed cell death ligand 1 in thyroid cancer. Cancer Sci., 112, 997–1010 (2021).