Hippocampal Inflammation and Gene Expression Changes in Peripheral Lipopolysaccharide Challenged Mice Showing Sickness and Anxiety-Like Behaviors

Abstract

Neuroinflammation is often associated with the development of depressive and anxiety disorders. The hippocampus is one of the brain regions affected by inflammation that is associated with these symptoms. However, the mechanism of hippocampal inflammation-induced emotional behavior remains unknown. The aim of this study was to clarify temporal changes in the neuroinflammatory responses in the hippocampus and the response of dentate gyrus (DG) neurons using peripheral lipopolysaccharide (LPS)-challenged mice. LPS administration induced anxiety-like activity in the elevated plus maze test and social interaction test after 24 h, at which time the mice had recovered from sickness behavior. We examined the hippocampal inflammation-related gene expression changes over time. The expression of interleukin-1β (Il1b) and tumor necrosis factor α (Tnfa) was rapidly enhanced and sustained until 24 h after LPS administration, whereas the expression of Il6 was transiently induced at approx. 6 h. IL-6-dependent downstream signaling of transducer and activator of transcription 3 (STAT3) was also activated approx. 3–6 h after LPS treatment. The expression of innate immune genes including interferon-induced transmembrane proteins such as interferon-induced transmembrane protein 1 (Ifitm1) and Ifitm3 and complement factors such as C1qa and C1qb started to increase approx. 6 h and showed sustained or further increase at 24 h. We also examined changes in the expression of several maturation markers in the DG and found that LPS enhanced the expression of calbindin 1 (Calb1), tryptophan-2,3-dioxigenase 2 (Tdo2), Il1rl, and neurotrophin-3 (Ntf3) at 24 h after LPS treatment. Collectively, these results demonstrate temporal changes of inflammation and gene expression in the hippocampus in LPS-induced sickness and anxiety-like behaviors.

INTRODUCTION

Neuroinflammation is often associated with the development of behaviors correlated to sickness and psychiatric conditions, including major depressive and anxiety disorders.^1,2) Peripheral activation of the immune system acutely activates innate immune cells at the site of infection and stimulates microglia within the brain via multiple pathways.²⁾ Activated microglia rapidly produce proinflammatory cytokines such as interleukin (IL)-1β, IL-6, and tumor necrosis factor α (TNFα), which induce sickness behaviors such as fever, hypomotility, and loss of appetite.^3,4) In endotoxin lipopolysaccharide (LPS)-induced inflammatory models, depressive and anxiety-like behaviors have been observed even after sickness behaviors were normalized.^5–7) These observations suggest that sickness and depression-related behaviors are induced temporally and spatially by different inflammatory responses. Reportedly, different brain regions are activated in sickness and depressive-like behaviors after LPS administration.⁸⁾ The hippocampus is one of the regions affected by LPS and is implicated in the pathophysiology and treatment of depressive and anxiety disorders.⁹⁾ In the hippocampus, peripheral or central administration of LPS activates microglia and stimulates the production of proinflammatory cytokines.^10,11) These cytokines have been shown to act on microglia, astrocytes, and endothelial cells to promote and amplify neuroinflammation and modulate neuronal function.¹²⁾ However, it remains unclear what kind of inflammatory reaction proceeds temporally in the hippocampus before depressive/anxiety behavioral changes occur. In addition, the neuronal response to LPS in the hippocampus is largely unknown.

We have previously reported that antidepressant treatment, including electroconvulsive seizure (ECS), causes profound changes in the maturation-related phenotypes of neurons in the hippocampal dentate gyrus (DG) of mice.¹³⁾ ECS acutely reduced the expression of mature neuronal markers such as calbindin (Calb), a Ca²⁺-binding protein, and tryptophan-2,3-dioxigenase 2 (Tdo2) in the DG, which occurred in association with increased somatic excitation, indicating that antidepressant stimulation results in changes to neuronal function in the DG. In contrast, social defeat stress increases calbindin protein expression in the DG,¹⁴⁾ and corticosterone increases Tdo2 expression in hippocampal slices,¹⁵⁾ indicating that the maturation-related phenotypes of DG neurons can change in response to several types of stress. Therefore, we hypothesized that neuroinflammation may alter neuronal function in the DG, which induces depression/anxiety-like behaviors by LPS.

The purpose of this study was to clarify changes in the neuroinflammatory responses in the hippocampus and the response of DG neurons to LPS stimuli that induce emotion-related behaviors. To address this, we investigated sickness and depression/anxiety-like behaviors after peripheral LPS administration and examined changes in inflammatory responses in the hippocampus over time using gene and protein expression, and microglial morphological analysis. Furthermore, to detect LPS-induced neuronal changes in the hippocampus, expression changes in maturation markers and immediate early genes in the DG were examined when emotion-related behaviors were observed.

MATERIALS AND METHODS

Experimental Animals

Seven to eight-week-old male C57BL/6N mice (23–25 g) were purchased from Japan SLC (RRID:5295404; Hamamatsu, Japan). Mice were housed in groups of 4–6 per cage. All mice were housed under standard conditions (24 ± 2 °C, 55 ± 5% humidity) with a 12 h light/dark cycle and ad libitum access to water and food. The weight gain of each mouse was recorded during experiments to monitor the physical condition of the animals. All mice were habituated for longer than one week before the experimental procedures were performed. Animal use and procedures were performed as per the guidelines prescribed by the National Institute of Health and approved by the Animal Care and Use Committee of Tokyo University of Science (Approval Numbers: K19010, K20009, K21007).

Drug Administration

Mice (8–9 weeks old) were randomly assigned to each experimental group. Mice were intraperitoneally administered LPS (0.8 mg/kg, O127:B8, Sigma-Aldrich, St. Louis, MI, U.S.A.). The dose of LPS was based on previous studies.^5,7) Control mice received vehicle (saline) in lieu of LPS administration.

Locomotor Activity

A spontaneous activity test was performed 3 d before and 1 and 22 h after LPS treatment in a transparent cage without bedding (20 cm length × 12.5 cm width) over 30 min. The total distance of movement was tracked using SMART 3.0 video tracking software (Panlab, Barcelona, Spain, RRID: SCR_002852).

Forced Swim Test (FST)

The FST was performed in a cylindrical container (13 cm diameter, 25.5 cm height) filled with water to a height of 18 cm. Water (23–25 °C) was replaced between the trials. Five days before LPS administration, each mouse was placed in the cylinder for a 10 min pre-swim period. FST was performed for 10 min, 24 h after LPS administration. Immobility times were measured the last 5 min during 10 min test period using a digital video camera. The duration of immobility was quantified autonomously using Smart 3.0.

Elevated Plus Maze Teat (EPM)

The EPM apparatus consisted of two open arms (30 × 6 cm) and two closed arms (30 × 6 × 15 cm) extending from a central platform (6 × 6 cm). The maze was elevated 40 cm above the floor. Twenty-four hours after LPS administration, each mouse was placed at the center of the maze facing the open arm and allowed to explore freely for 5 min. During the test, the movements of each mouse were recorded using a digital video camera. The number of entrances and the time spent in the open arms were quantified autonomously using Smart 3.0. The apparatus was thoroughly cleaned with 70% ethanol after the removal of each mouse.

Social Interaction Test

Five hours before LPS administration, each mouse was habituated to the open field arena (50 × 50 × 20 cm) for 10 min. An unfamiliar 5–6 weeks old younger male C57BL/6N mouse was put into a 7 × 7 × 12 cm metal wire enclosure, placed on one side of the open field arena (340–350 lx). The experimental mouse was placed into the arena, and its activity was recorded for 15 min at 24 h after LPS administration. A plastic cup was placed on top of the enclosure to prevent the test mouse from climbing on it. During the test, the movements of each mouse were recorded using a digital video camera. The total distance of movement and the number of contacts to the caged mouse were quantified autonomously using Smart 3.0. The apparatus was thoroughly cleaned with 70% ethanol after the removal of each mouse.

RNA Extraction and Real-Time PCR

Mice were decapitated at the time indicated in the figure legends. The whole hippocampus or DG of the hippocampus was dissected under a stereoscopic microscope. Total RNA was extracted using the Reliaprep RNA Cell Miniprep System (Promega, Madison, WI, U.S.A.) and used for reverse transcription with ReverTra Ace (Toyobo, Osaka, Japan), followed by real-time PCR using the StepOne system (Applied Biosystems, Foster City, CA, U.S.A.) and the Thunderbird SYBR qPCR mix (Toyobo). The expression levels of each gene were quantified using standardized external dilutions. The relative expression levels of the target genes were normalized to that of 18S ribosomal RNA (rRNA). The specificity of each primer set was confirmed by melt-curve analysis and examining the product size using gel electrophoresis. The primer sequences for each gene are listed in Table 1.

Table 1. List of Primers Used for qPCR Analysis

Gene	Forward (5′ to 3′)	Reverse (5′ to 3′)
18S rRNA	GAGGCCCTGTAATTGGAATGAG	GCAGCAACTTTAATATACGCTATTGG
Il1b	GCAACTGTTCCTGAACTCAACT	ATCTTTTGGGGTCCGTCAACT
Tnfa	GATCTCAAAGACAACCAACTAGTG	CTCCAGCTGGAAGACTCCTCCCAG
Il6	CATAGCTACCTGGAGTACATGA	CATTCATATTGTCAGTTCTTCG
Ifitm1	GACAGCCACCACAATCAACAT	CCCAGGCAGCAGAAGTTCAT
Ifitm3	CCCCCAAACTACGAAAGAATCA	ACCATCTTCCGATCCCTAGAC
C1qa	AAAGGCAATCCAGGCAATATCA	TGGTTCTGGTATGGACTCTCC
C1qb	CGTCGGCCCTAAGGGTACT	GGGGCTGTTGATGGTCCTC
Il1r1	GTGCTACTGGGGCTCATTTGT	GGAGTAAGAGGACACTTGCGAAT
Calb1	TCTGGCTTCATTTCGACGCTG	ACAAAGGATTTCATTTCCGGTGA
Tdo2	ATGAGTGGGTGCCCGTTTG	GGCTCTGTTTACACCAGTTTGAG
Ntf3	AGTTTGCCGGAAGACTCTCTC	GGGTGCTCTGGTAATTTTCCTTA
Fos	CAGAGCGGGAATGGTGAAGA	TCGGTGGGCTGCCAAAATAA
Arc	AGCGGGACCTGTACCAGAC	AGCTGCTCCAGGGTCTTG

Sample Isolation and Immunohistochemistry

For immunohistochemical analysis, mice that had been subjected to the social interaction test were used. Mice were deeply anesthetized with isoflurane and transcardially perfused with cold saline 27 h after LPS administration. The brains were dissected and fixed with 4% paraformaldehyde in 0.1 M phosphate buffer (pH 7.4) at 4 °C for 72 h, cryoprotected in 20% sucrose for 72 h, and stored at −80 °C until further use. Serial sections (30 µm thick) were cut through the entire hippocampus using a cryostat (Leica 1510, Leica Microsystems, Tokyo, Japan) and stored in 30% Glycerol, 30% Ethylene glycol in 0.02 M phosphate buffer (pH 7.4) at −20 °C until staining.

For Iba1 staining, the sections were washed with phosphate-buffered saline (PBS) and blocked using 10% equine serum (US Donor Equine Serum; Cytiva) in PBS containing 0.3% Triton X-100 (PBST) at room temperature for 60 min, followed by overnight incubation with rabbit anti-Iba1 (1 : 4000; Wako, Osaka, Japan; 019-19741, RRID: AB_839504) at 4 °C. After washing with PBST, sections were incubated with biotinylated goat anti-rabbit immunoglobulin G (IgG) (1 : 200; Vector Laboratories Inc., Burlingame, CA, U.S.A., BA1000, RRID: AB_2313606) for 60 min. The sections were washed with PBST and incubated with the ABC Vectastain Kit (Vector), and antigen detection was performed with 0.06% 3,3′-diaminobenzidine (Wako) staining. After washing, the sections were mounted on slides with Entellan New (Merck Millipore, Burlington, MA, U.S.A.).

Quantification of Iba1-Positive Cells

For Iba1-positive (+) cell quantification, two to four sections of the DG were photographed using a light microscope (Nikon Eclipse E200; Nikon, Tokyo, Japan). The molecular layer of the DG was set as a region of interest (ROI), each ROI was measured, and the number of Iba1 (+) cells was identified using computer-assisted image analysis (ImageJ, NIH, Bethesda, MD, U.S.A.). To measure the Iba1 (+) area, the grayscale image was converted into a binary image, and the Iba1 (+) area was measured within the ROI.

Immunoblot

The mouse brains were decapitated at the time indicated in the figure legend, and the hippocampus was dissected. The hippocampus was homogenized using protein lysis buffer containing 62.5 mM Tris–HCl pH 7.4, 1% sodium dodecyl sulfate (SDS), 1% protease inhibitor (Nacalai Tesque, Kyoto, Japan), and 4% phosphatase inhibitors (Abcam, Cambridge, U.K.) on ice, and the samples were centrifuged at 16000 × g for 20 min at 4 °C. Supernatants containing 10 µg of proteins were separated on an 8% SDS-polyacrylamide gel by electrophoresis and transferred onto a polyvinyl difluoride membrane (ATTO Corporation, Tokyo, Japan). The membrane was first blocked with Tris-buffered saline (TBS) containing 5% skim milk for 1 h at room temperature and incubated with rabbit anti-phospho-signaling of transducer and activator of transcription 3 (STAT3) IgG (1 : 2000, Cell Signaling Technology, 9145, RRID: AB_2491009) or mouse anti-β-actin IgG (1 : 3000, Thermo Fisher Scientific, MA5-15739, RRID: AB_10979409) at 4 °C overnight. After washing, the membrane was incubated with horseradish peroxidase-conjugated secondary antibodies (1 : 5000, Vector, PI-2000-1; Jackson ImmunoResearch Labs, 111-035-144, AB_2307391) for 1 h at room temperature, and the resulting bands were visualized using the EzWestLumi One kit (Atto). Immunoreactive bands were detected using Image Quant LAS4000 (GE Healthcare, Chicago, IL, U.S.A.), and the signal intensity was analyzed using Image J.

Statistical Analyses

All data are presented as mean ± standard error of the mean (S.E.M.). Statistical analysis was performed using the unpaired Student’s t-test or Mann–Whitney test and one-way or two-way ANOVA followed by Bonferroni’s post-hoc test. Statistical significance was set at p < 0.05. Detailed statistical data are presented in Supplementary Table 1 (Table S1). All analyses were performed using the PRISM 9 software (GraphPad, San Diego, CA, U.S.A.).

RESULTS

LPS-Induced Sickness, Anxiety-Like, and Social Withdrawal Behaviors

We first examined the effect of LPS (0.8 mg/kg) on sickness and emotional behaviors (Fig. 1A). Peripheral administration of LPS to C57Bl/6N mice significantly decreased locomotor activity at 1 h, showing sickness behavior. However, this reduction disappeared 22 h post-injection (Fig. 1B; LPS 1 vs. 22 h, p < 0.0001), indicating that LPS-induced sickness behavior was transient in our experimental setting. We then evaluated the immobility time in the FST to assess depressive-like behavior. Mice exposed to LPS showed a tendency for longer immobility in the FST, but the effect was not significant (Fig. 1C; p = 0.0918). Next, we performed the EPM and social interaction tests to assess anxiety-like and social behaviors 24 h after LPS administration. LPS reduced the open arm time and entries in the EPM (Fig. 1D; p = 0.0146, and E; p = 0.0039), and the interaction numbers to an unfamiliar mouse of younger age in the social interaction test (Fig. 1F; p = 0.014). In addition, LPS-treated mice showed a reduction in distance traveled in the social interaction test (Fig. 1G; p = 0.0138), indicating increased anxiety in unfamiliar situations. These results suggest that LPS administration in our experimental setting induced anxiety-like and social withdrawal behaviors after transient sickness behavior.

Fig. 1. The Effect of Peripheral LPS Administration on Sickness and Emotional Behaviors in Mice

(A) Experimental scheme. LPS (0.8 mg/kg) was administered intraperitoneally. In experimental group 1 (Exp.1), locomotor activity (LMA) was measured 3 d before (pre), and 1 and 22 h after LPS administration. The forced swim test (FST), elevated plus maze test (EPM), or social interaction test (SIT) were performed at 24 h after LPS administration in Exp.1, Exp. 2, or Exp.3, respectively. (B) Spontaneous LMA in a new cage for 30 min. The total distance of movement was tracked before (Pre) and after LPS administration (n = 5; Pre vs. LPS 1 h, t₍₈₎ = 8.442, p < 0.0001; LPS 1 h vs. 22 h, t₍₈₎ = 8.058, p < 0.0001 using the Bonferroni’s test after repeated one-way ANOVA). (C) The effect of LPS on the immobility duration in the FST (t₍₈₎ = 1.915, p = 0.0918). The immobility duration was measured for the last 5 min during 10 min test period (n = 5 each). (D, E) The effect of LPS on the duration (D; t₍₁₂₎ = 2.851, p = 0.0146) and entries (E; t₍₁₂₎ = 3.565, p = 0.0039) in open arms in the EPM test (n = 7 each). (F, G) The effect of LPS on the number of contacts (F; t₍₅₎ = 3.872, p = 0.014) and traveled distance (G; t₍₅₎ = 3.849, p = 0.0138) in the SIT (n = 5 for saline group and n = 6 for the LPS group). Data are expressed using dot plots and means ± standard error of the mean (S.E.M.) *, p < 0.05; **, p < 0.01.

LPS-Induced Inflammatory Gene Expression Changes over Time in the Hippocampus

To explore inflammatory responses in the hippocampus of LPS-exposed mice, we focused on changes in inflammation-related gene expression over time. First, we examined the mRNA expression of inflammatory cytokines interleukin-1β (Il1b), tumor necrosis factor α (Tnfa), and interleukin-6 (Il6). LPS administration rapidly increased the expression of Il1b, which was sustained for at least 24 h after injection (Fig. 2A; p = 0.041 at 1 h, and p < 0.0001 at 24 h). The expression of Tnfa started to increase at 1 h and significantly increased at 6 and 24 h after LPS administration (Fig. 2B; p = 0.0117 at 6 h, and p = 0.0032 at 24 h). In contrast, the expression of Il6 was transiently induced around 6 h after LPS treatment (Fig. 2C; p = 0.0034 at 6 h).

Fig. 2. The Effect of LPS Administration on Inflammation-Related Gene Expression in the Hippocampus

The relative expression levels of target genes at 1, 6, and 24 h after saline or LPS administration. Relative expression levels were normalized to that of 18S rRNA. Bonferroni’s test was performed after two-way ANOVA. (A) Expression of Il1b (p = 0.041 at 1 h, p = 0.1852 at 6 h, and p < 0.001 at 24 h). (B) Tnfa expression (p = 0.138 at 1 h, p = 0.0117 at 6 h, and p = 0.0032 at 24 h). (C) Expression of Il6 (p = 0.9612 at 1 h, p = 0.0034 at 6 h, and p = 0.9957 at 24 h). (D) Expression of Ifitm1 (p = 0.9822 at 1 h, p = 0.0073 at 6 h, and p = 0.2097 at 24 h). (E) Expression of Ifitm3 (p = 0.9982 at 1 h, p < 0.0001 at 6 h, and p < 0.001 at 24 h). (F) Expression of C1qa (p = 0.0409 at 6 h and p < 0.001 at 24 h). (G) Expression of C1qb (p = 0.0049 at 24 h). Data are shown using dot plots and the mean values are shown (n = 3–4). *, p < 0.05; **, p < 0.01. ***, p < 0.001.

Next, we examined other types of inflammation-related genes, including interferon-induced transmembrane protein (IFITM) and complement factors. Ifitm1 and Ifitm3 expression was increased significantly at 6 h after LPS treatment (Fig. 2D; p = 0.0034, Fig. 2E; p < 0.0001 at 6 h), and the expression of Ifitm3 persisted until 24 h (Fig. 2E; p < 0.0001 at 24 h). The induction of complement factor C1qa was initiated 6 h after LPS treatment (Fig. 2F; p = 0.0409), and the expression of C1qa and C1qb were further increased 24 h later (Fig. 2F; p < 0.0001, Fig. 2G; p = 0.0049 at 24 h). These results show that various inflammatory responses occur over time after LPS administration in the hippocampus and were sustained at 24 h when anxiety-like and social withdrawal behaviors were observed.

LPS-Induced Cellular Change in the Hippocampus

We further explored the inflammatory cellular changes in the hippocampus. Because gene expression of Il6 was transient, we examined the IL-6-dependent downstream STAT3. LPS enhanced the phosphorylation of STAT3 at approx. 3–6 h after administration (Figs. 3A, B), consistent with the induction of IL-6. However, contrary to previous findings,^16,17) we did not find a clear increase in phosphorylation of the c-Jun N-terminal kinase (JNK) by LPS compared to the saline control, indicating relatively weak stimulation in our experimental system.

Fig. 3. LPS-Induced Cellular Change in the Hippocampus

(A, B) Phosphorylation of STAT3 and JNK at 3, 6, and 24 h after LPS administration (n = 2, each). (C) Representative images for anti-Iba1 immunostaining in the DG at 1 and 27 h after saline or LPS administration. Scale bars: 100 µm. (D) Quantification of the numbers (left) and positive area (right) in Iba1(+) cells in the molecular layer of the DG. Bonferroni’s test was performed after two-way ANOVA (Iba1 area, p = 0.0002 at 27 h, n = 3–4). Data are expressed using dot plots and the mean values are shown. ***, p < 0.001.

Next, we investigated the activation of microglia when LPS administration increased sickness behavior (1 h) or anxiety-like behaviors (27 h). Although the number of microglial marker Iba-1 positive cells within the molecular layer of the hippocampus did not change (Figs. 3C, D, left), the Iba-1 positive area increased 27 h after LPS administration (Figs. 3C, D, right, p = 0.0002). These results indicated that LPS stimulation morphologically activates the hippocampal microglia.

LPS-Induced Maturation Marker Expression Changes in the DG of the Hippocampus

Recent studies, including ours, have shown that multiple types of antidepressants change the phenotypes of mature neurons to immature ones in the DG of the hippocampus.^13,18) Conversely, neuronal maturation in the DG could be modulated in LPS-mediated stress response. To explore the influence of LPS-induced inflammatory signaling on DG neurons, we examined changes in the expression of neuronal markers in the DG, including calbindin (Calb1), tryptophan 2,3-dioxygenase (Tdo2), interleukin-1 receptor type 1 (Il1r1), and neurotrophin-3 (Ntf3), which are mature markers of DG neurons.¹⁸⁾ To detect DG-specific gene expression changes, we isolated the DG from the hippocampus 24 h after LPS administration. We found that the expression of Calb1 and Ntf3 was significantly induced by LPS administration (Fig. 4A, p = 0.0162 and 4D, p = 0.0317). Similarly, the expression of Tdo2 and Il1r1 was increased in the LPS-treated group (Fig. 4B, p = 0.0599 and 4C, p = 0.0522). To further confirm whether administration of LPS alters neuronal activity on DG neurons, we measured the expression of immediate early genes Fos and Arc, which are used as markers of neuronal activity.^19,20) However, LPS administration did not change the expression of Fos and Arc (Figs. 4E, F). These findings demonstrated that neuronal maturation-related gene expression can be altered in DG neurons when LPS-mediated inflammation response and anxiety-like behavior occur.

Fig. 4. The Effect of LPS Administration on Mature Neuronal Markers in the DG

Relative expression levels of mature neuronal markers 24 h after saline or LPS administration in the DG. Relative expression levels were normalized to that of 18S rRNA. (A) Calb1 expression (t₍₁₄₎ = 2.732, p = 0.0162). (B) Expression of Tdo2 (t₍₁₄₎ = 2.047, p = 0.0599). (C) Expression of Il1r1 (t₍₁₄₎ = 2.123, p = 0.0522). (D) Expression of Ntf3 (Mann–Whitney test, U = 2, p = 0.0317). (E, F) Expression of Fos and Arc. Data are plotted using dot plots and the mean values are shown (n = 5–8). *, p < 0.05.

DISCUSSION

In this study, we found that neuroinflammatory responses were differentially changed in the hippocampus over time until the onset of anxiety-like and social withdrawal behaviors after LPS administration. Furthermore, LPS increased the expression of mature neuronal markers in the hippocampal DG. These results demonstrate that temporal changes in inflammation and gene expression in the hippocampus are correlated with sickness and anxiety-like behaviors.

In our experimental conditions, peripheral LPS challenge acutely decreased motor activity in mice, but these showed complete recovery 22 h after administration (Fig. 1B). Anxiety-like and social withdraw behaviors were observed after the onset of sickness behavior (Figs. 2D–G). Consistent with our results, several studies have reported that the increased anxiety-like behaviors in the open field test, light-dark box test, EPM test, and reduced social behavior were induced by LPS administration.^6,21,22) In contrast, we observed a tendency for increased immobility in the FST in this model. Several studies have shown that similar doses of LPS induce depression-like behaviors in FST or tail suspension tests.^2,5,7) The complete recovery from sickness behavior may have made it difficult to detect depressive-like behavior in the FST (Fig. 2C).

The hippocampus has been implicated in the development and treatment of anxiety-like behaviors. Reportedly, increased anxiety behaviors due to chronic mild stress are mediated by nuclear factor kappa B signaling in the hippocampus²³⁾ and social withdrawal with a juvenile is driven by IL-1 signaling in the hippocampus.²⁴⁾ Furthermore, 5-hydroxytryptamine (5-HT)1A receptors on DG neurons are critical for anti-anxiety-like responses to antidepressants.²⁵⁾ Thus, increased anxiety due to LPS may be mediated by changes in hippocampal function. Therefore, this model seems to be suitable for exploring the mechanism of LPS-induced anxiety in the hippocampus.

By examining the expression of inflammation-related factors in the hippocampus over time, we found that different inflammatory responses were induced at 1, 6, and 24 h after LPS administration (Figs. 2, 3). The expression of inflammatory cytokines IL-1β and TNF-α increased after 1 h and their expression was induced until after 24 h (Figs. 2A, B), indicating that these cytokines are associated with sickness and anxiety-like behaviors. In sickness behaviors, overlapping roles of IL-1β and TNF-α have been demonstrated in a study using IL-1 receptor type I deficient mice.²⁶⁾ As the expression pattern of IL-1β, but not TNF-α, induced by LPS is consistent in rats,¹⁰⁾ IL-1 signaling may play a greater role in the inflammatory response in the hippocampus. In contrast, the inflammatory cytokine IL-6 and downstream STAT3 activation induced by LPS was transiently increased after 3–6 h (Figs. 2C, 3A, B). This result is consistent with previous findings showing nuclear localization of STAT3 in hippocampal astrocytes 4 h after LPS stimulation.²⁷⁾ Recently reports have shown that STAT3 in hippocampal astrocytes is a key regulator of gene expression changes following chronic alcohol exposure²⁸⁾ and STAT3 inhibition decreases LPS-induced microglial activation in the hippocampus.²⁹⁾ Therefore, IL-6 at 3–6 h after LPS administration may be an amplifier of inflammation, which controls microglial morphological changes and anxiety-like behaviors observed in the later phase. Furthermore, sustained elevation of central IL-6 is a key contributor of depressive-like phenotypes.³⁰⁾ Sustained IL-6 signaling in the hippocampus may induce a significant depressive-like behavior.

Gene expression of the innate immunity proteins IFITM and those from the C1q families increased at a later phase (6–24 h) after LPS administration (Figs. 2D–G). IFITM proteins are known to be involved in the antiviral response to interferons. A recent study has shown that chronic social stress increases the expression of Ifitm1, Ifitm2, and Ifitm3 in the hippocampus.²⁴⁾ In the brain, IFITM3 is expressed in both astrocytes and neurons, and the neuronal expression of IFITM3 in vitro is enhanced by interferon-γ, IL-1β, and IL-6 stimulation.^31,32) Several studies have indicated a role for IFITM3 in the brain. IFITM3 expression in astrocytes mediates neuronal impairment after neonatal immune challenge.³¹⁾ Neuronal IFITM3 modulates γ-secretase activity and increases amyloid production.³²⁾ However, additional studies are required to characterize the role of the IFITM family in the hippocampus and its involvement in emotional behaviors.

The expression of complement C1q is enhanced by long-term LPS treatment or chronic stress in the hippocampus,^24,33) and serum C1q levels are increased in depressed patients,³⁴⁾ suggesting a link between the complement system and stress-related disorders. In the mouse brain, microglia are a dominant source of C1q.³⁵⁾ C1q from microglia mediates radiation-induced microglial activation and synaptic loss in the hippocampus, causing cognitive deficits.³⁶⁾ C1q is colocalized with presynaptic puncta after 7 d of LPS administration when synaptic loss was observed in the hippocampus.³³⁾ Therefore, the complement cascade starting from C1q may affect hippocampal-related behaviors via microglial activation and synaptic defects in the hippocampus.

To detect LPS-induced neuronal responses in the DG of the hippocampus, we examined changes in the expression of several maturation markers. We found that LPS induced the expression of Calb1, Tdo2, Il1rl (IL-1R1), and Ntf3 (NT-3) in the DG at 24 h after stimulation (Figs. 4A–D). Interestingly, these changes were in contrast to those observed with antidepressant stimulation.¹³⁾ This result suggests that LPS-induced inflammation signals from microglia and astrocytes affect neuronal characteristics or phenotypes in the DG differently from antidepressant stimulation. In addition, we did not observe significant changes in Fos and Arc expression in the DG of mice with LPS 24 h after administration (Figs. 4E, F). This finding suggests that LPS-induced inflammation signals would rather modulate neuronal maturation in the DG than neuronal activity. However, further assessment needs to investigate and characterize the role of LPS-induced inflammation signals on neuronal maturation in the DG.

Results from studies indicate that these maturation markers regulate hippocampal function due to stress. TDO2 and indoleamine 2,3-dioxygenase (IDO) are the initial rate-limiting enzymes associated with the kynurenine pathway during tryptophan metabolism. Previous studies have shown that LPS increases the expression of Ido and the amount of kynurenine in the hippocampus; additionally, kynurenine administration induces depressive/anxiety-like behaviors.^8,37) The IL-1 receptor is expressed robustly in DG neurons, and hippocampal IL-1 signaling drives social withdrawal after chronic social stress.²⁴⁾ LPS-induced enhancement of these signals may contribute to the development of anxiety/depressive-like behaviors. Consistent with our results for increased expression of Ntf3 by LPS, chronic stress or corticosterone administration also increased Ntf3 expression in the DG.³⁸⁾ Although NT-3 is generally known as a neurotrophic factor, NT-3 has been shown to suppress the proliferation of neural stem cells in the mouse subependymal niche.³⁹⁾ Increased NT3 expression may be involved in stress-induced suppression of hippocampal neurogenesis.

In this study, we investigated the changes of gene expression related to hippocampal inflammatory responses and neuronal changes in LPS-induced mice exhibited sickness and anxiety-like behaviors. However, it is still unclear how inflammatory responses alter neuronal function and the types of functional changes that occur in the hippocampus. In the future, it is important to investigate the effects of the expression of inflammation-related genes reported in this study on hippocampal neurons and their contribution to anxiety/depression-like behaviors.

Acknowledgments

This work was supported in part by MEXT KAKENHI Grant Number 20K07090 (ESN).

Author Contributions

SM, YN, AE, and HS designed the study, conducted the experiments, analyzed the data, and drafted the manuscript. KS designed the study and drafted the manuscript. ESN designed the study, analyzed the data, and drafted the manuscript. All authors read and approved the final manuscript.

Conflict of Interest

The authors declare no conflict of interest.

Supplementary Materials

This article contains supplementary materials.

REFERENCES

• 1) Dunn AJ, Swiergiel AH, de Beaurepaire R. Cytokines as mediators of depression: what can we learn from animal studies? Neurosci. Biobehav. Rev., 29, 891–909 (2005).
• 2) Dantzer R, O’Connor JC, Freund GG, Johnson RW, Kelley KW. From inflammation to sickness and depression. when the immune system subjugates the brain. Nat. Rev. Neurosci., 9, 46–56 (2008).
• 3) Palin K, Bluthe RM, McCusker RH, Moos F, Dantzer R, Kelley KW. TNFalpha-induced sickness behavior in mice with functional 55 kD TNF receptors is blocked by central IGF-I. J. Neuroimmunol., 187, 55–60 (2007).
• 4) Harden LM, du Plessis I, Poole S, Laburn HP. Interleukin (IL)-6 and IL-1 beta act synergistically within the brain to induce sickness behavior and fever in rats. Brain Behav. Immun., 22, 838–849 (2008).
• 5) Frenois F, Moreau M, O’Connor J, Lawson M, Micon C, Lestage J, Kelley KW, Dantzer R, Castanon N. Lipopolysaccharide induces delayed FosB/DeltaFosB immunostaining within the mouse extended amygdala, hippocampus and hypothalamus, that parallel the expression of depressive-like behavior. Psychoneuroendocrinology, 32, 516–531 (2007).
• 6) Haba R, Shintani N, Onaka Y, Wang H, Takenaga R, Hayata A, Baba A, Hashimoto H. Lipopolysaccharide affects exploratory behaviors toward novel objects by impairing cognition and/or motivation in mice: possible role of activation of the central amygdala. Behav. Brain Res., 228, 423–431 (2012).
• 7) Deyama S, Ishikawa Y, Yoshikawa K, Shimoda K, Ide S, Satoh M, Minami M. Resolvin D1 and D2 reverse lipopolysaccharide-induced depression-like behaviors through the mTORC1 signaling pathway. Int. J. Neuropsychopharmacol., 20, 575–584 (2017).
• 8) O’Connor JC, Lawson MA, Andre C, Moreau M, Lestage J, Castanon N, Kelley KW, Dantzer R. Lipopolysaccharide-induced depressive-like behavior is mediated by indoleamine 2,3-dioxygenase activation in mice. Mol. Psychiatry, 14, 511–522 (2009).
• 9) Warner-Schmidt JL, Duman RS. Hippocampal neurogenesis: opposing effects of stress and antidepressant treatment. Hippocampus, 16, 239–249 (2006).
• 10) Bay-Richter C, Janelidze S, Hallberg L, Brundin L. Changes in behaviour and cytokine expression upon a peripheral immune challenge. Behav. Brain Res., 222, 193–199 (2011).
• 11) Guan XT, Lin WJ, Tang MM. Comparison of stress-induced and LPS-induced depressive-like behaviors and the alterations of central proinflammatory cytokines mRNA in rats. Psych J., 4, 113–122 (2015).
• 12) Liu X, Nemeth DP, McKim DB, Zhu L, DiSabato DJ, Berdysz O, Gorantla G, Oliver B, Witcher KG, Wang Y, Negray CE, Vegesna RS, Sheridan JF, Godbout JP, Robson MJ, Blakely RD, Popovich PG, Bilbo SD, Quan N. Cell-type-specific interleukin 1 receptor 1 signaling in the brain regulates distinct neuroimmune activities. Immunity, 50, 764–766 (2019).
• 13) Imoto Y, Segi-Nishida E, Suzuki H, Kobayashi K. Rapid and stable changes in maturation-related phenotypes of the adult hippocampal neurons by electroconvulsive treatment. Mol. Brain, 10, 8 (2017).
• 14) LaGamma CT, Tang WW, Morgan AA, McGowan JC, Brachman RA, Denny CA. Antidepressant but not prophylactic ketamine administration alters calretinin and calbindin expression in the ventral hippocampus. Front. Mol. Neurosci., 11, 404 (2018).
• 15) Brooks AK, Lawson MA, Smith RA, Janda TM, Kelley KW, McCusker RH. Interactions between inflammatory mediators and corticosteroids regulate transcription of genes within the Kynurenine Pathway in the mouse hippocampus. J. Neuroinflammation, 13, 98 (2016).
• 16) Yu H, Zou Z, Zhang X, Peng W, Chen C, Ye Y, Xu J, Wang H. Inhibition of phosphodiesterase 4 by FCPR03 alleviates lipopolysaccharide-induced depressive-like behaviors in mice: involvement of p38 and JNK signaling pathways. Int. J. Mol. Sci., 19, 513 (2018).
• 17) Cai B, Seong KJ, Bae SW, Kook MS, Chun C, Lee JH, Choi WS, Jung JY, Kim WJ. Water-soluble arginyl-diosgenin analog attenuates hippocampal neurogenesis impairment through blocking microglial activation underlying NF-kappaB and JNK MAPK signaling in adult mice challenged by LPS. Mol. Neurobiol., 56, 6218–6238 (2019).
• 18) Kobayashi K, Ikeda Y, Sakai A, Yamasaki N, Haneda E, Miyakawa T, Suzuki H. Reversal of hippocampal neuronal maturation by serotonergic antidepressants. Proc. Natl. Acad. Sci. U.S.A., 107, 8434–8439 (2010).
• 19) Sheng M, Greenberg ME. The regulation and function of c-fos and other immediate early genes in the nervous system. Neuron, 4, 477–485 (1990).
• 20) Kawashima T, Okuno H, Bito H. A new era for functional labeling of neurons: activity-dependent promoters have come of age. Front. Neural Circuits, 8, 37 (2014).
• 21) Salazar A, Gonzalez-Rivera BL, Redus L, Parrott JM, O’Connor JC. Indoleamine 2,3-dioxygenase mediates anhedonia and anxiety-like behaviors caused by peripheral lipopolysaccharide immune challenge. Horm. Behav., 62, 202–209 (2012).
• 22) Alzarea S, Rahman S. Alpha-7 nicotinic receptor allosteric modulator PNU120596 prevents lipopolysaccharide-induced anxiety, cognitive deficit and depression-like behaviors in mice. Behav. Brain Res., 366, 19–28 (2019).
• 23) Zhu LJ, Ni HY, Chen R, Chang L, Shi HJ, Qiu D, Zhang Z, Wu DL, Jiang ZC, Xin HL, Zhou QG, Zhu DY. Hippocampal nuclear factor kappa B accounts for stress-induced anxiety behaviors via enhancing neuronal nitric oxide synthase (nNOS)-carboxy-terminal PDZ ligand of nNOS-Dexras1 coupling. J. Neurochem., 146, 598–612 (2018).
• 24) DiSabato DJ, Nemeth DP, Liu X, Witcher KG, O’Neil SM, Oliver B, Bray CE, Sheridan JF, Godbout JP, Quan N. Interleukin-1 receptor on hippocampal neurons drives social withdrawal and cognitive deficits after chronic social stress. Mol. Psychiatry, 26, 4770–4782 (2021).
• 25) Samuels BA, Anacker C, Hu A, Levinstein MR, Pickenhagen A, Tsetsenis T, Madronal N, Donaldson ZR, Drew LJ, Dranovsky A, Gross CT, Tanaka KF, Hen R. 5-HT1A receptors on mature dentate gyrus granule cells are critical for the antidepressant response. Nat. Neurosci., 18, 1606–1616 (2015).
• 26) Bluthé RM, Laye S, Michaud B, Combe C, Dantzer R, Parnet P. Role of interleukin-1beta and tumour necrosis factor-alpha in lipopolysaccharide-induced sickness behaviour: a study with interleukin-1 type I receptor-deficient mice. Eur. J. Neurosci., 12, 4447–4456 (2000).
• 27) Gautron L, Lafon P, Chaigniau M, Tramu G, Laye S. Spatiotemporal analysis of signal transducer and activator of transcription 3 activation in rat brain astrocytes and pituitary following peripheral immune challenge. Neuroscience, 112, 717–729 (2002).
• 28) Chen WY, Chen H, Hamada K, Gatta E, Chen Y, Zhang H, Drnevich J, Krishnan HR, Maienschein-Cline M, Grayson DR, Pandey SC, Lasek AW. Transcriptomics identifies STAT3 as a key regulator of hippocampal gene expression and anhedonia during withdrawal from chronic alcohol exposure. Transl. Psychiatry, 11, 298 (2021).
• 29) Millot P, San C, Bennana E, Porte B, Vignal N, Hugon J, Paquet C, Hosten B, Mouton-Liger F. STAT3 inhibition protects against neuroinflammation and BACE1 upregulation induced by systemic inflammation. Immunol. Lett., 228, 129–134 (2020).
• 30) Sukoff Rizzo SJ, Neal SJ, Hughes ZA, Beyna M, Rosenzweig-Lipson S, Moss SJ, Brandon NJ. Evidence for sustained elevation of IL-6 in the CNS as a key contributor of depressive-like phenotypes. Transl. Psychiatry, 2, e199 (2012).
• 31) Ibi D, Nagai T, Nakajima A, Mizoguchi H, Kawase T, Tsuboi D, Kano S, Sato Y, Hayakawa M, Lange UC, Adams DJ, Surani MA, Satoh T, Sawa A, Kaibuchi K, Nabeshima T, Yamada K. Astroglial IFITM3 mediates neuronal impairments following neonatal immune challenge in mice. Glia, 61, 679–693 (2013).
• 32) Hur JY, Frost GR, Wu X, et al. The innate immunity protein IFITM3 modulates gamma-secretase in Alzheimer’s disease. Nature, 586, 735–740 (2020).
• 33) Xin YR, Jiang JX, Hu Y, Pan JP, Mi XN, Gao Q, Xiao F, Zhang W, Luo HM. The Immune System Drives Synapse Loss During Lipopolysaccharide-Induced Learning and Memory Impairment in Mice. Front. Aging Neurosci., 11, 279 (2019).
• 34) Yao Q, Li Y. Increased serum levels of complement C1q in major depressive disorder. J. Psychosom. Res., 133, 110105 (2020).
• 35) Fonseca MI, Chu SH, Hernandez MX, Fang MJ, Modarresi L, Selvan P, MacGregor GR, Tenner AJ. Cell-specific deletion of C1qa identifies microglia as the dominant source of C1q in mouse brain. J. Neuroinflammation, 14, 48 (2017).
• 36) Markarian M, Krattli RP Jr, Baddour JD, Alikhani L, Giedzinski E, Usmani MT, Agrawal A, Baulch JE, Tenner AJ, Acharya MM. Glia-selective deletion of complement C1q prevents radiation-induced cognitive deficits and neuroinflammation. Cancer Res., 81, 1732–1744 (2021).
• 37) Parrott JM, Redus L, Santana-Coelho D, Morales J, Gao X, O’Connor JC. Neurotoxic kynurenine metabolism is increased in the dorsal hippocampus and drives distinct depressive behaviors during inflammation. Transl. Psychiatry, 6, e918 (2016).
• 38) Smith MA, Makino S, Kvetnansky R, Post RM. Stress and glucocorticoids affect the expression of brain-derived neurotrophic factor and neurotrophin-3 mRNAs in the hippocampus. J. Neurosci., 15, 1768–1777 (1995).
• 39) Delgado AC, Ferron SR, Vicente D, Porlan E, Perez-Villalba A, Trujillo CM, D’Ocon P, Farinas I. Endothelial NT-3 delivered by vasculature and CSF promotes quiescence of subependymal neural stem cells through nitric oxide induction. Neuron, 83, 572–585 (2014).