Tanshinone IIA Alleviates Early Brain Injury after Subarachnoid Hemorrhage in Rats by Inhibiting the Activation of NF-κB/NLRP3 Inflammasome

Abstract

The abnormal activation of the nuclear factor-kappa B (NF-κB)/nod-like receptor family-pyrin domain-containing 3 (NLRP3) signaling pathway is closely related to early brain injury after subarachnoid hemorrhage (SAH). Targeting the NLRP3-inflammasome has been considered an efficient therapy for the local inflammatory response after SAH. Tanshinone IIA (Tan IIA), a major component extracted from Salvia miltiorrhiza, has been reported to have anti-inflammatory effects. The aim of this study was to investigate the effect and mechanism of Tan IIA on early brain injury after SAH. In vivo SAH injury was established by endovascular perforation technique in Sprague–Dawley rats. Limb-placement test and corner turning test were used to measure the behavior. Terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate nick-end labeling (TUNEL) staining, hematoxylin–eosin (H&E) staining, and immunofluorescence were used to evaluate the nerve damage. Real-time RT quantitative PCR (RT-qPCR) was used to quantify the levels of inflammatory factors. Western blot was performed for the activation of the NF-κB/NLRP3 pathway. An in vitro SAH model was used to validate the conclusion. We found that the neurobehavioral impairment and cerebral edema in SAH model rats given Tan IIA were alleviated. Further study demonstrated that Tan IIA could inhibit SAH-secondary neuronal apoptosis around hematoma and alleviate brain injury. Tan IIA down-regulated the expression of interleukin-6 (IL)-6, monocyte chemoattractant protein-1 (MCP-1), and tumor necrosis factor (TNF)-α, and inhibited the activation of NF-κB. And the overexpression of pro-inflammatory factors NLRP3, IL-1β, and IL-18 induced after SAH was also reversed by Tan IIA. In conclusions, Tan IIA could inhibit the NF-κB/NLRP3 inflammasome activation to protect and ameliorate SAH-followed early brain injury, and may be a preventive and therapeutic strategy against SAH.

INTRODUCTION

Subarachnoid hemorrhage (SAH), a disastrous neurovascular disease, accounts for 5–10% of all strokes worldwide, and has an increased morbidity and fatality rate.¹⁾ The pathophysiological mechanisms of SAH include acute elevation of intracranial pressure, reduced cerebral blood flow, cell death, disruption of the blood–brain barrier (BBB), and direct generalized ischemic brain injury caused by cerebral edema.^2,3) Furthermore, these pathophysiological characteristics cause consequences that are strongly associated with poor prognosis, which further increases the burden.⁴⁾ According to recent expert viewpoints, early brain injury (EBI), which occurs within 72 h of cerebral artery rupture, plays a critical role in the etiology and prognosis of SAH.⁵⁾ Some studies suggested that cerebral edema, BBB disruption, oxidative stress, and apoptosis are conceivable mechanisms of EBI.^6,7) Furthermore, reducing EBI may have neuroprotective benefits on the SAH model.⁸⁾

Neuroinflammatory response and neuronal death are the two main injury mechanisms of EBI.⁹⁾ Although adequate immune cell activation is required for phagocytosis to eliminate hazardous material, overactivated immunity exacerbates brain injury by generating inflammatory cytokines, chemokines, and cytotoxic chemicals.¹⁰⁾ Furthermore, through the disrupted BBB, these blood-derived immune cells penetrate the brain parenchyma, increasing inflammation and neuronal injury.¹¹⁾ Therefore, pharmacological intervention targeting CNS inflammation may provide a novel treatment option for SAH patients.

The activation of the nod-like receptor family-pyrin domain-containing 3 (NLRP3) inflammasome has been shown to be implicated in cell death via caspase-1-mediated cell pyroptosis, leading to the development of neuroinflammatory after SAH.¹²⁾ The toll-like receptor (TLR)/nuclear factor-kappa B (NF-κB) pathway causes the initial signal in NLRP3-inflammasome activation. Toll-like receptors or cytokines such as tumor necrosis factor (TNF)-α can activate NF-κB, which causes the production of NLRP3, pro-interleukin (IL)-1, and pro-IL-18 to increase.¹³⁾ The NLR is activated to initiate caspase-1 self-cleavage, followed by chain-level activation of IL-1β, IL-18, and gasdermin-D (GSDMD).^14,15) According to reports, inhibiting of NLRP3 inflammasome activation could reduce EBI and inflammation in SAH, maintain BBB integrity and permeability, reduce cerebral edema and neurological functions loss.^16,17) Thus, targeting the NLRP3 inflammasome has been proposed as an effective therapeutic for the treatment of cerebrovascular disorders.

Salvia miltiorrhiza, a member of the Lamiaceae family, is a medicinal herb that has been extensively used in traditional Chinese medicine for treating cardiovascular and cerebrovascular diseases. The health-promoting properties of this plant are attributed to the presence of phenolic acids and liposoluble tanshinones, whose composition and concentration play a crucial role in its therapeutic efficacy.¹⁸⁾ Tanshinone IIA (Tan IIA) is a significant constituent extracted from Salvia miltiorrhiza,¹⁸⁾ has anti-tumor, anti-inflammatory, neuroprotective effect, and immunomodulatory effects.¹⁹⁾ Robertson et al.²⁰⁾ reported that Tan IIA reduces inflammation by causing neutrophils to die at the wound site and moving them away from the wound, as a novel approach to treating inflammation. In addition, evidence has emerged that Tan IIA could inhibit NF-κB activation induced by TNF-α,²¹⁾ and also specifically block the NLRP3 inflammasome activation.²²⁾ This efficacy appears to determine the potential targeting of Tan IIA for NF-κB/NLRP3-mediated inflammatory diseases, including early brain injury in SAH.

Therefore, we speculate that Tan IIA may act on the NF-κB/NLRP3 inflammasome to reduce EBI after SAH. In this study, we established a SAH model in rat and gave Tan IIA treatment. We also explored the potential mechanism of Tan IIA against SAH/EBI by detecting neurobehavioral changes, brain tissue pathological changes, and related signal pathways in rats, providing a molecular basis for its clinical application and potential new therapeutic drugs in the treatment of SAH.

MATERIALS AND METHODS

Animal

Male Sprague–Dawley (SD) rats (8 weeks old, weighing 200–220 g) were acquired from Chengdu Dashuo Laboratory Animal Co., Ltd. (Chengdu, China). Experimental production license number is SYXK (Sichuan) 2019-031, and License number is SYXK (Sichuan) 2021-246. To ensure a suitable environment, the animals were subjected to a 12-h light/dark cycle at 25 °C in a specific pathogen-free (SPF) environment. Throughout the experiment, the animals were provided with free access to food and water. The Experimental Animal Ethics Committee of West China Hospital, Sichuan University (Record No. 20220811006) approved all experimental procedures and animal care. The experiment was conducted in accordance with the National Institutes of Health guidelines for the care and use of animals.

Ethics Approval

All experimental procedures and animal care were approved by the Experimental Animal Ethics Committee of West China Hospital, Sichuan University (Record No. 20220811006), and conducted in accordance with the guidelines of the National Institutes of Health on the care and use of animals.

Grouping and SAH Model Preparation

Rats were divided into the Sham group, SAH group, SAH + Tan IIA 10 mg/kg group, SAH + Tan IIA 20 mg/kg group, and SAH + Tan IIA 40 mg/kg group (n = 6 each), randomly and equally. To begin with, we employed a rat model of typical SAH, representing an experimental rupture of the vessel.²³⁾ The endovascular perforation approach was used to create the SAH model.^23,24) This model causes a complicated brain injury characterized by neurodegeneration and neurobehavioral dysfunction, which finally leads to nerve cell death.²⁴⁾ Rats were anesthetized with intraperitoneal injection of 3% pentobarbital sodium (30 mg/kg; Sigma-Aldrich, U.S.A.; Merck KGaA, Germany). The left carotid artery and its branches were briefly exposed. The common carotid artery bifurcation is around 10–11 mm from where a 5-0 monofilament nylon suture was inserted in the external carotid artery and progressed through the internal carotid artery until resistance was felt. The internal carotid artery was punctured by the suture after it was pushed to the bifurcation. Fifteen seconds later, swiftly remove the nylon thread, tightly secure the upper spare thread of the ECA, and close the incision. Except for the perforation, sham animals received similar treatments.

Drug Administration

As indicated in the previous study, Tan IIA (#S31459; Shanghai Yuanye Biotech, Shanghai, China) was dissolved in 0.5% carboxymethylcellulose sodium (CMC-Na) solution and subsequently diluted to different concentration in normal saline.²⁵⁾ The rats in the Tan IIA-L, Tan IIA-M, and Tan IIA-H groups were intragastric administration of 10, 20, and 40 mg/kg Tan IIA, respectively. Furthermore, the treatment was administered three times, 12 h before the operation for modeling, immediately after the operation and 12 h after the operation. At the appropriate time points, the model and sham groups were gavaged with the equal amount of normal saline. Neurological defects were evaluated 12 h after modeling. Twenty four hours after SAH, the rats were sacrificed, and rats were then quickly decapitated, and the brains were immediately collected and fixed in 4% paraformaldehyde for 24 h. The brain tissues were coronally sectioned with the optic chiasm as the central reference. The presence of obvious hematomas in the coronal slices was considered as successful establishment of the SAH model. The brain tissues were cut into five equally spaced (2 mm) coronal blocks, which were then used for histologic staining, terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate nick-end labeling (TUNEL) staining, immunofluorescence assays, Western blot analysis, and RT real-time quantitative PCR (RT-qPCR). The administration schedule for the drug in this study is revealed in Fig. 1A.

Fig. 1. Representative Macrographs and the Effects of Tan IIA Treatment on SAH Induced Brain Impairments

(A). The drug administration-table for the investigation were revealed. (B). Phenotypic neurobehavioral assessment of rats by limb-placement test score scale. (C). Corner Turning test (CT) was used for long-term assessment of sensorimotor impairment in SAH model rats. (D). BWC measured by the dry/wet weight method after SAH. Data are represented as the mean ± S.D. ** p < 0.01, **** p < 0.0001, vs. Sham group; ^# p < 0.05, vs. SAH group.

Behavioral Assessment

We used the neurological impairment rating system to score behavioral deficits in rats after subarachnoid hemorrhage induction, including the Elicited Forelimb Placing (limb-placement test) and the Corner Turning Test. When the stroke lesion is located in a discrete somatomotor region, the limb-placement test reflects the tactile-proprioceptive function of the rats.²⁶⁾ To make sure that the sensorimotor task did not account for the tactile-proprioception test component, the test was conducted in the absence of visual and facial contact signals. Thus, it is a test of movement initiation and control that engages a variety of brain regions, including higher-order sensorimotor cortices like the posterior parietal and secondary motor cortices.²⁶⁾ Rats were hand-held during testing and maintained motionless in a horizontal position. When the paw lost touch with the table surface (passive limb movement) and then made light contact with the edge of the table, tactile and proprioceptive feedback was given. The unsuccessful attempts to place paws on the table’s edge were noticed. Each paw received the following placement scores: 0, immediate, complete placing; 1, response delay within 2 s; 2, response delay more than 2 s; 3, no placing.

The corner test was conducted in the manner outlined earlier.²⁷⁾ Briefly, a rat was left in the test apparatus, which was made of two vertical boards angled at a 30° angle. The rat was observed moving toward the board with the vibrissae as it turned the corner, and this movement was noted. The non-hemorrhagic rat turned equally often to the left and to the right. Six trials were used to calculate the total number of turns in each direction. The right-biased turning percentage (CT score) was calculated using the following formula: (R/R + L) 100%, where R stands for a right turn and L for a left turn.

Measurement of Brain Water Content (BWC)

Wet/dry weight analysis was used to analyze BWC, as previously mentioned.²⁸⁾ Each brain was placed on a piece of aluminum foil that had already been weighed, and the moist weight was measured using an electric analytic balance. The dry weight (with an accuracy of 0.1 g) of the brains was then determined by drying them at 100 °C for 24 h in an electric oven. The formula [(wet weight − dry weight)/(wet weight)] 100% was used to calculate BWC.

TUNEL Staining

In Situ Cell Death Detection Kit, Fluorescein (57895100, Roche Group, Switzerland) was used to examine apoptosis in rat brain tissue (three samples in each group) according to the manufacturer’s instructions. The enzyme TdT (DNA terminal transferase) attaches fluorescently-labeled deoxyuridine triphosphate (dUTP) to the exposed 3-OH ends of the broken DNA, and apoptotic cells were labeled by specifically binding to fluorescein antibodies, allowing detection by fluorescence microscopy. In brief, after being permeabilized, the sample was incubated with the TUNEL detection solution. The nucleus was labeled with 4′-6-diamidino-2-phenylindole (DAPI; DA0001, Regen Biological, Beijing, China). Finally, the samples were analyzed by a digital slide scanner (Pannoramic 250, 3DHISTECH, Hungary). Green colour represents apoptotic signals. The percentage of apoptotic cells was determined by manual counting TUNEL-positive cells.

Histologic Staining

The rat brain tissues (three samples in each group) were recovered for histological examination, fixed in 4% formaldehyde, and embedded in paraffin. To assess the degree of brain lesions, serial 5 µm paraffin slices were cut and placed on slides for hematoxylin–eosin (H&E) staining. The coronal sections of brain tissue showed the location of the soft meningeal structures, cortical areas, hippocampal areas, and necrotic marginal areas. A Pannoramic 250 digital slice scanner (3DHISTECH) was used for image acquisition of slices to observe specific lesions.

Immunofluorescence Assays

All sections embedded in paraffin were treated with xylene. Following dewaxing, the sections underwent dehydration using a graded series of ethanol solutions. After washing the sections with phosphate-buffered saline (PBS) for 5 min, they were incubated for 20 min with nonimmune goat serum (SP9001, Beijing Zhongshan Jinqiao Biotechnology Co., Ltd., Beijing, China). Subsequently, the sections were probed with mouse anti-neuronal nuclei (NeuN) polyclonal antibody (#94403, 1 : 100, Cell Singnaling Technology, MA, U.S.A.), anti-IL-1β (#BS-0812R, 1 : 100, Beijing Bioss Biotechnology Co., Ltd., China), and anti-IL-18 (#DF6252, 1 : 100, Affinity Biosciences, China), overnight at 4 °C, and then with the secondary antibodies CY3-labeled goat anti-mouse immunoglobulin G (IgG) (#GB21301, 1 : 100, Wuhan Servicebio, Wuhan, China) and fluorescein isothiocyanate (FITC)-labeled goat anti-rabbit IgG (#GB22303, 1 : 100, Servicebio) at room temperature for 30 min. The nucleus was labeled with DAPI. Finally, the microscopic camera system (OlyVIA, OLYMPUS, Japan) and halo data analysis system (Halo 101-WL-HALO-1, Indica labs, U.S.A.) were used for image acquisition and counting.

Isolation and Quantification of RNA

Total RNA content was extracted from cells or tissues using RNA Trizol Reagent (BM1144, Bomei Biotechnology, China). Briefly, the cDNA was synthesized using PrimeScript RT reagent Kit (RR047A, TaKaRa Bio, Japan). Thereafter, RT-qPCR was performed using TB GreenTM Premix Ex TaqTM II (RR820A, TaKaRa Bio, JPN). The specific primers were provided by Sangon Biological Co., Ltd. (Shanghai, China), and the following PCR primers were used: interleukin-6 (IL-6) (forward: 5′-ACTTCCAGCCAGTTGCCTTCTTG-3′; reverse: 5′-TGGTCTGTTGTGGGTGGTATCCTC-3′), monocyte chemoattractant protein-1 (MCP-1) (forward: 5′-CTCACCTGCTGTACTCATTCACTG-3′; reverse: 5′-CTTCTTTGGGACACCTGCTGCTG-3′), TNF-α (forward: 5′-AAGCATGATCCGAGATGTGGAACTG-3′; reverse: 5′-CGCCACGAGCAGGAATGAGAAG-3′), and β-actin (forward: 5′-GGGAAATCGTGCGTGACATT-3′; reverse: 5′-GCGGCAGTGGCCATCTC-3′). The PCR primers were shown in Table 1. Data analysis was performed using the 2^−ΔΔCt method, β-actin worked as the internal reference control for other genes.

Table 1. The Primers Used in This Study for RT-qPCR

Gene	Primer sequence (5′-3′)
β-Actin F	GGGAAATCGTGCGTGACATT
β-Actin R	GCGGCAGTGGCCATCTC
IL-6 F	ACTTCCAGCCAGTTGCCTTCTTG
IL-6 R	TGGTCTGTTGTGGGTGGTATCCTC
MCP-1 F	CTCACCTGCTGTACTCATTCACTG
MCP-1 R	CTTCTTTGGGACACCTGCTGCTG
TNF-α F	AAGCATGATCCGAGATGTGGAACTG
TNF-α R	CGCCACGAGCAGGAATGAGAAG

Western Blot Analysis

Lysates were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) before being transferred to a polyvinylidene difluoride (PVDF) membrane (ISEQ00010, Sigma-Aldrich), which was then blocked for 1 h at room temperature using blocking solution (5% skim milk and 0.05% Tween 20 in TBST). The membrane was incubated overnight at 4 °C with primary antibodies to caspase-1 (A0964, ABclonal, China), IL-1β (A11370, ABclonal), IL-18 (A1115, ABclonal), NLRP3 (A14223, ABclonal), NF-κB P65 (AF5006, Affinity Biosciences, China), p-NF-κB p65 (AP0124, ABclonal) at dilutions of 1 : 2000 and rabbit anti-β-actin (AP0124, ABclonal) monoclonal antibodies at dilution of 1 : 50000, respectively. The membrane was then incubated for 1 h with the secondary antibody (goat anti-rabbit IgG) (H + L; s0001, acquired from Affinity Biosciences) at a dilution of 1 : 5000. After three washes with TBST, the signals were developed using the Hypersensitive ECL Western HRP Substrate kit (17046, Zen-Bio, U.S.A.).

Cell Isolation and Culture

Our previous methods were used to cultivate primary neurons.²⁹⁾ Cortical brain tissues from SD rats were taken, washed three times, deposited in Neurobasal-A Medium/B27 Supplement with 100 g/mL streptomycin and 100 U/mL penicillin, cut using ophthalmic scissors, and digested with 0.125% trypsin at 37 °C for 30 min. After termination with 10% fetal bovine serum (FBS; FS301-02, Tran)/Dulbecco’s modified Eagle’s medium (DMEM), the mixture was filtered with a 70 µm cell sieve. The cells were resuspended in 10% FBS/DMEM, seeded on poly-Llysine-coated plates, and cultured at 37 °C and 5% CO₂. The culture media was replaced after 2 h with a neurobasal medium containing 2% B27 and 1% glutamax and was refreshed every 3 d.

Grouping and in Vitro Model

Oxyhemoglobin (OxyHb) was synthesized using mouse hemoglobin (Sigma-Aldrich) as directed by the manufacturer. To replicate experimental SAH in vitro, primary cultured neurons from rats were grown in Petri plates until cell density reached 80–90%, after which the media was changed with serum-free medium. According to a prior publication, the cells were stimulated for 24 h with OxyHb (Sangon Biotech) at a concentration of 10 µM.³⁰⁾ Cells are divided into four groups: Mock, SAH, SAH+ Tan IIA (8 µM) , and SAH+ Tan IIA + lipopolysaccharide (LPS) groups. For the in vitro Tan IIA treatment assay, neuronal cells were then treated with Tan IIA and LPS; 0000126449, Sigma-Aldrich). After 24 h of incubation at 37 °C, a fresh medium was added, and cells were used in various assays.

Cell Counting Kit-8 (CCK-8) Assay

The cell viability of rat cortical neurons was detected with CCK-8 (B3350A, Biosharp, Hefei, Anhui, China). The primary cells were planted at a density of 5000 cells per well on a 96-well culture plate, and cultured at 37 °C, 5% CO₂. After treatment with drugs for 24 h, 1 : 9 ratios of CCK-8 reagent and Neurobasal-A Medium/B27 Supplement were injected into each well. The OD value was determined using a microplate reader (Spectra Max PLUS 384, Molecular Devices, U.S.A.) at 450 nm absorbance after 2 h of incubation.

Flow Cytometry

Cell apoptosis was measured with an Annexin V-APC/PI apoptosis detection kit (KGA1030, Kaiji Biotechnology Co., Ltd., Jiangsu, China). Cells were harvested by trypsinization without ethylenediaminetetraacetic acid (EDTA) and suspended in 1 × Binding Bufer at a density of 5.0 × 10⁶ cells/mL. Five microliter Annexin V-APC/PI and 5 µL PI were added to each 100 µL cell suspension, and incubated at room temperature in the dark for 15 min. Then the samples were analyzed by flow cytometry (Cytoflex, Beckman-Coulter, China).

Statistical Analysis

Statistical analysis was performed using GraphPad Prism 8 (GraphPad Software, San Diego, CA, United States) and SPSS 22.0 software (IBM, Armonk, NY, U.S.A.). All data were expressed as the mean ± standard deviation (S.D.). One-way ANOVA test was used for comparison between multiple groups, followed by the LSD-test for homogeneity of variance and Tamhane’s T2-test for heterogeneity of variance. Statistical analysis for limb-placement test was performed using nonparametric Kruskal–Wallis test. Statistical significance was indicated as p < 0.05.

RESULTS

Tanshinone IIA Ameliorates Behavioral Deficits and Cerebral Edema after SAH by Oral Administration

We researched the neurobehavioral characteristics of laboratory rats graded by a limb-placement test score scale and the corner turning test. The anterior and lateral limb placement, abduction, and adduction of the rats in the Sham group were unobstructed, while the limb-placement function of the experimental SAH model rats was severely damaged (p < 0.0001) (shown in Fig. 1B). This defect appears to be partially restored after feeding with Tan IIA 40 mg/kg but did not show a statistically significant difference (shown in Fig. 1B). Next, we further assessed the animal's sensorimotor function by Corner turning test (CT) and came to similar conclusions as above (Fig. 1C). Judging from the symptoms of animals, Tan IIA does have a certain therapeutic effect on SAH-induced neurological deficits. Similarly, wet/dry weight analysis of BWC revealed that Tan IIA therapy at a dose of 40 mg/kg did have an effective effect on reducing brain edema (p < 0.05). Although this pushing effect did not manifest itself well at low doses (Fig. 1D).

Tanshinone IIA Treatment Ameliorates Neurological Deficits in SAH Rats

SAH/EBI is a very complex pathophysiological process with complex molecular mechanisms, among which neuroinflammatory response and neuronal death are the two main injury mechanisms of EBI.³¹⁾ Thus, it's a key means to inhibit SAH/EBI from blocking the pathological death of neurons. According to the results obtained from TUNEL staining and fluorescence microscopy, a significantly higher number of apoptotic cells were observed in the SAH group compared to the control group. Moreover, in the groups treated with varying doses of Tan IIA, there was a noticeable reduction in the number of positively stained cells, indicating a dose-dependent decrease in apoptosis (p < 0.01) (Figs. 2A, B). These findings strongly suggest that Tan IIA exhibited a protective effect by suppressing apoptosis in neuronal cells that were damaged due to SAH. Histologic examination demonstrated patchy necrosis of nerve fibers, localized vacuolar degeneration and edema, and increased glial cells in cortical areas of the SAH brain (Fig. 2C). Compared with the SAH group, the degree of brain tissues damage in SAH rats treated with Tan IIA was reduced, and the soothing effect was dose-dependent (Fig. 2C). NeuN protein is specifically expressed in mature neuronal cells. And we further explored the expression of NeuN in brain tissues by immunofluorescence staining. Subsequently, it was found that the expression of NeuN decreased in SAH group, while Tan IIA could reverse this downward trend (p < 0.01) (Figs. 2D, E). Altogether, these findings indicated that Tan IIA could inhibit SAH-followed neuronal apoptosis and reduce brain damage.

Fig. 2. Effects of Tan IIA on Brain Tissue Morphology and Neuronal Apoptosis in Rats after SAH

(A). Cell apoptosis was measured by TUNEL assays. Green fuorescence represents apoptotic cells, and blue fuorescence represents the nuclei of all cells. Scale bar = 50 µm. (B). Quantitative analysis of the TUNEL assay results. (C). Histologic fndings of rat brain tissue. Hematoxylin–eosin (H&E), 100× (scale bar = 100 µm) and 400× (scale bar = 50 µm) final magnification. Red arrow: normal neuron cells; green arrow: necrotic cells; yellow arrow: neurofibrinolysis; blue arrow: microglia; black arrows: shaped glial cells. (D). Expression of neuron-specific nucleoprotein (NueN) in brain tissue by immunofluorescence assays. Red fuorescence represents Neun protein, and blue fuorescence represents the nuclei of all cells. Scale bar = 50 µm. (E). Quantitative analysis of the immunofluorescence results. Data are represented as the mean ± S.D. * p < 0.05, ** p < 0.01, vs. Sham group; ^# p < 0.05, ^## p < 0.01, vs. SAH group.

Tanshinone IIA Alleviates Neuroinflammation in Rats with SAH

Neuroinflammation has a certain protective effect on the damaged brain tissue to some extent, but in general, an overreaction of neuroinflammation will reduce the regeneration and repair ability of neural stem cells in the hippocampus, aggravate the occurrence of vasospasm and brain edema, and lead to a worse recovery of nerve function.³¹⁾ In order to explore the occurrence of neuroinflammation after SAH, we detected IL-6, MCP-1, and TNF-α in the brain. The transcriptional regulators mRNA expression levels were significantly upregulated in the perihematomal damaged brain tissue of rats following SAH compared with the sham group (p < 0.05, p < 0.01, p < 0.01) (Figs. 3A–C). Compared with the SAH model group, the transcription of IL-6, MCP-1, and TNF-α in the brains of Tan IIA-treated rats decreased (p < 0.05, p < 0.01, p < 0.01) (Figs. 3A–C). The higher the dose of Tan IIA administered, the more pronounced this regulatory effect was, which was similar to the previous experimental findings.

Fig. 3. Pro-inflammatory Factors IL-6, MCP-1 and TNF-α Expression Levels in the Brain

(A) Transcript level of IL-6 in brain tissue by RT-qPCR analysis. (B) Transcript level of MCP-1 in brain tissue by RT-qPCR analysis. (C) Transcript level of TNF-α in brain tissue by RT-qPCR analysis. Data are represented as the mean ± S.D. * p < 0.05, ** p < 0.01, vs. Sham group; ^#p < 0.05, ^##p < 0.01, vs. SAH group.

Tanshinone IIA Treatment Blocks NF-κB/NLRP3 Inflammasome Activation after SAH

Activation of NLRP3 inflammasome and induction of its components aggravated the early brain injury following SAH,³²⁾ and Tan IIA has been reported to inhibit the activity of NF-κB and NLRP3 inflammasome.^33,34) To this end, we tested whether Tan IIA blocks NLRP3 inflammasome. As depicted in Figs. 4A and B, protein levels of NLRP3, IL-18, and IL-1β were considerably elevated after SAH (p < 0.01), and the increase was dramatically mitigated by treatment with Tan IIA. However, the levels of caspase-1 was not substantially different. The activation of the NLRP3 inflammasome requires NF-κB signaling.¹³⁾ The effect of Tan IIA on NF-κB signaling in SAH conditions is then investigated. Our results demonstrated that enhanced phosphorylation of NF-κB P65 was detected in SAH rats, which was abolished by treatment with Tan IIA (p < 0.01). The results indicated that NF-κB signaling pathway was activated in SAH, and Tan IIA inhibited the NF-κB/NLRP3 signaling pathway activated by SAH in a dose-dependent way (Figs. 4C, D).

Fig. 4. Tan IIA Regulates NF-κB/NLRP3 Signaling Pathway to Relieve Symptoms after SAH

(A, B) Protein levels and quantitative analysis of NLRP3, caspase-1, IL-1β, and IL-18 measured with Western blotting. (C, D) Protein levels and quantitative analysis of NF-κB phosphorylated P65 (p-P65), and total P65 measured with Western blotting. The β-actin was identical in (A) and (C), both of which were the same samples and detected at the same time. Data are represented as the mean ± S.D. * p < 0.05, ** p < 0.01, vs. Sham group; ^# p < 0.05, ^## p < 0.01, vs. SAH group.

Tanshinone IIA Protects Neurons from Injury by Inhibiting NF-κB/NLRP3 Signaling Pathway in Vitro

Since, in SAH-neurons, the NF-κB/NLRP3 signaling pathway was hindered with Tan IIA, we reasoned that the regulation may be implicated in the protection of neuronal injury. Here, we isolated and cultured rat cortical neurons in vitro, according to a previous report.²⁹⁾ Then CCK-8 was used to detect the effect of Tan IIA on cell proliferation, and Tan IIA significantly reduced the inhibition of neurons proliferation caused by SAH (p < 0.01) (shown in Fig. 5A). Furthermore, flow cytometry results showed that the apoptosis of primary neurons in brain tissue increased significantly after SAH in rats, while Tan IIA significantly reduced SAH-induced apoptosis (p < 0.01). LPS, an activator of the NLRP3 inflammasome, appears to act in the opposite direction of Tan IIA (p < 0.01) (shown in Figs. 5B, C). These results suggested that Tan IIA can repair cortical neuron damage caused by SAH in rats.

Fig. 5. Tan IIA Inhibits SAH-Induced Neuronal Apoptosis

(A) Proliferation trend of neurons co-cultured with Tan IIA by CCK-8 assay. (B). The apoptosis rates of neurons following co-culture with Tan IIA by Flow cytometry. (C) Quantitative analysis of the Flow cytometry assay results. Data represent results from 3 individual studies, represented as the mean ± S.D. ** p < 0.01, *** p < 0.001, vs. Mock group; ^# p < 0.05, ^## p < 0.01, vs. SAH group; ns, p ≥ 0.05, ^{^} p < 0.05, vs. SAH + Tan IIA group.

Subsequently, isolated nerve cells were cultured to mimic experimental SAH in vitro, followed by the determination of the inflammatory factors expression patterns. Compared with the SAH group, Tan IIA significantly weakened IL-6, MCP-1, and TNF-α expression levels in cells (p < 0.05) (Fig. 6A). As before, we again examined the NF-κB/NLRP3 pathway in cells. Western blotting revealed that phosphorylated P65 (p-P65/P65) were increased in the SAH group, which was reversed by Tan IIA treatment (p < 0.01) (Figs. 6B, C). Interestingly, this reversal effect could also be destroyed by LPS (p < 0.05). The NLRP3 inflammasome, including the regulators NLRP3, IL-1β, and IL-18, also showed the same trend (Figs. 6D, E), which is consistent with the results in Fig. 4. To demonstrate that IL-1β and IL-18 are widely expressed on neuronal cells, we co-stained IL-1β and IL-18 with the neuronal marker NeuN using immunofluorescence staining (Fig. 7). Notably, the fluorescence intensity of NeuN + IL-1β (Figs. 7A, B) and NeuN + IL-18 (Figs. 7C, D) in the primary cortical neurons of rats in the SAH group significantly increased compared with the control group (p < 0.001). Conversely, the fluorescence intensity of NeuN + IL-1β and NeuN + IL-18 in the Tan IIA group significantly decreased compared with the model group (p < 0.001). These results suggest that SAH can induce the expression of IL-1β and IL-18 in primary neurons, which may indicate the activation of the NLRP3 inflammasome in neurons. In a word, Tan IIA protects neurons from damage by preventing activation of the NF-κB/NLRP3 signaling pathway.

Fig. 6. Tan IIA Inhibits NF-κB/NLRP3 Signaling Pathway in Cells

(A) Inflammatory factors IL-6, MCP-1 and TNF-α expression levels by RT-qPCR analysis. (B) Protein levels of phosphorylated P65 (p-P65), and total P65 measured with Western blotting. (C) Quantitative analysis of Western blotting. (D) Protein levels of NLRP3, caspase-1, IL-1β, and IL-18 measured with Western blotting. The β-actin was identical in (B) and (D), both of which was the same samples and detected at the same time. (E) Quantitative analysis of (D). Data are represented as the mean ± S.D. * p < 0.05, ** p < 0.01, vs. Mock group; ^# p < 0.05, ^## p < 0.01, vs. SAH group.

Fig. 7. Representative Immunofluorescence Microphotographs of IL-1β (A, B) and IL-18 (C, D) Co-expressed with NeuN Respectively in the Mock, SAH, SAH + Tan IIA, and SAH + Tan IIA + LPS Groups

The nuclei are stained in blue by DAPI, NeuN is stained in red, IL-1β and IL-18 are stained in green. Scale bar = 50 µm. Data are represented as the mean ± S.D. *** p < 0.001, vs. Mock group; ^### p < 0.001, vs. SAH group.

DISCUSSION

In this study, we evaluated the response of NF-κB/NLRP3 inflammasome activation to SAH brain injury, as well as the neuroprotective effect of Tan IIA in SAH models in vitro and in vivo. The results indicate that SAH promotes inflammation and neuronal apoptosis in brain tissue, with promotion of NF-κB/NLRP3 inflammasome activation and upregulation of the expression of inflammatory factors. Both in vitro and in vivo studies provide evidence that Tan IIA significantly alleviates SAH-induced neuroinflammation and neurological dysfunction. Furthermore, we confirmed that Tan IIA inhibits NF-κB/NLRP3 inflammasome activation and expression of inflammatory factors, thereby alleviating early brain injury after SAH.

NLRP3-mediated neuroinflammation is involved in numerous central nervous system diseases, with inflammation playing a crucial role in the pathological processes of early brain injury following SAH.³⁵⁾ Upon activation, abnormal NLRP3 inflammasome (composed of NLRP3, ASC, and pro-caspase-1) leads to the excessive release of IL-1β and IL-18, dependent on the activation of NF-κB by pattern recognition receptors.³⁶⁾ Studies have also shown that NLRP3 inflammasome, inflammatory cytokines, IL-1β, and IL-18 expression levels are elevated within 24 h after SAH, contributing to neuroinflammatory cascades and inducing EBI following SAH. Caspase-1 can convert pro-IL-1β and pro-IL-18 into IL-1β and IL-18 respectively, further promoting inflammatory cascades and worsening EBI after SAH.³⁷⁾ IL-1β and IL-18 participate in the inflammatory pathological processes of cerebral hemorrhage, promoting vascular constriction, activation of microglia cells, and infiltration of peripheral leukocytes into the nervous system. In addition, neuroinflammation appears to have a crucial role in the clinical deterioration of SAH, according to increasing evidence.³⁸⁾ Over-expression of pro-inflammatory cytokines IL-1β, TNF-α and IL-6 are linked to neuronal death.³⁹⁾ Thus, it has been demonstrated that targeting these proteins efficiently protects the brain from subsequent inflammatory harm following SAH.⁴⁰⁾ The NLRP3 inflammasome contributes to post-SAH inflammation, and inhibiting or knockdown its activation lowers brain damage.⁴¹⁾ It is worth noting that NF-κB is a critical transcriptional factor in the regulation of the inflammatory response.⁴²⁾ A multitude of scientific research has consistently suggested that the genes NLRP3, IL-1β, and IL-6 are specifically regulated by NF-κB.⁴³⁾ Therefore, targeting inflammatory hyper-response is a breakthrough in the treatment of various diseases.

Natural products, due to their diversity in structure and bioactivities, are still regarded as essential resources for drug discovery and formulation.⁴⁴⁾ In the past nearly 40 years, approximately 50% of all drugs approved by the U.S. Food and Drug Administration (FDA) have been developed from compounds found in nature, especially anti-cancer and anti-inflammatory drugs.^45,46) In the genomics age, this still appears to be a promising strategy to find efficient and innovative natural compounds against inflammatory damage.⁴⁷⁾ Salvia L. species have been used in traditional medicine to treat colds, bronchitis, tuberculosis, cardiovascular and cerebrovascular diseases, menstrual and digestive disorders in traditional medicine since ancient time.^13,48,49) As mentioned earlier, tanshinones are a diverse group of naturally occurring abietane diterpenes that found in the rhizome of Salvia miltiorrhiza,¹⁸⁾ where Tan IIA has been reported to have neuroprotective effects on cerebral ischemia-induced brain damage by reducing oxidative products, scavenging oxygen free radicals, and suppressing the expression of NF-κB in the cerebral cortex.^50,51) In our study, neurological deficits were assessed using the forelimb placement test and corner turn test. Although tanshinone IIA displayed a slight improvement in neurological deficits, the effect was not significant. This might be because the behavioral observation was a rather subjective evaluation. In addition, we observed that Tan IIA could effectively inhibit early brain injury after SAH in a dose-dependent manner, and ameliorate pathological symptoms including ataxia, brain tissue structural disorder, nerve cell apoptosis, and brain edema. Further studies found that Tan IIA inhibited NF-κB/NLRP3 inflammasome activation and the expression of downstream factors, providing evidence that Tan IIA inhibits neuroinflammation after SAH.

The production of reactive oxygen species (ROS), especially those of mitochondrial origin, was one of the first factors thought to trigger inflammasome activation.⁵²⁾ Tan IIA significantly reduced ROS production while also protecting mitochondrial and endoplasmic reticulum structures.⁵³⁾ Thus, ROS/inflammasome is also a way for Tan IIA to counteract neuroinflammation. Multiple studies have shown that activated microglia promote excess ROS production, leading to neurodegeneration and neuronal death with oxidative stress.⁵⁴⁾ Consistent with reports, we detected increased microglia in the brains of rats with SAH, and speculated that NF-κB activation and ROS production synergistically initiate and activate the NLRP3 inflammasome.

Moreover, our data also detected that hydrocephalus content is elevated after SAH, and Tan IIA can reduce this hazardous edema (Fig. 1C). Past evidence revealed focal inflammation contributes significantly to BBB disruption and brain edema. As a complex cellular system, BBB plays a crucial role in maintaining the balance and stability of the brain microenvironment.⁵⁵⁾ Research shows that the formation of cerebral edema is closely related to the breakdown of BBB.^56,57) And Salvia miltiorrhiza has been extensively used in the treatment of Alzheimer’s disease, and its permeability through the BBB determines its efficacy.⁴⁷⁾

This study suggested that Tan IIA could inhibit neuroinflammation and thus alleviate early brain injury after SAH by inhibiting NF-κB/NLRP3 inflammasome signaling. In addition, research has reported that phosphatidylinositol 3-kinase (PI3K)/protein kinase B (Akt)/NF-κB signaling pathway, TLRs/NF-κB signaling pathway and other pathways are involved in the regulation of early brain injury after SAH.^6,58) However, whether Tan IIA directly inhibits NF-κB or through some unknown indirect mechanisms remains unknown. Furthermore, it is unknown whether Tan IIA impacts the permeability of the blood–brain barrier.

In  summary, this study demonstrated the potential anti-SAH effects of Tan IIA, and demonstrated in detail that Tan IIA may ameliorate SAH-related BWC neurological deficits, providing a new therapeutic strategy. Moreover, it was demonstrated that these effects of Tan IIA were, at least in part, due to the inhibition of NF-κB/NLRP3 inflammasome signaling. The findings of this study will offer a solid pharmacological foundation for the use of Tan IIA as a new phytotherapeutic agent in the treatment of SAH. Currently, research on the efficacy of natural medicines such as Chinese herbal medicine is on the rise, and we look forward to seeing more functions and applications of Tan IIA.

Funding

This research was funded by Science and Technology Department of Sichuan Province of China (Grant No. 2021YJ0515), and Sichuan Medical Association Program (Grant No. Q22046).

Author Contributions

FHY, NSM, SPL, FC, and XHH carried out the experiments. LZC conceived and supervised the study. FHY and NSM provided ideas contributing to the conception of this article. SPL, FC and LZ helped to draw the pictures. FHY and LZC modified the article. All authors reviewed the manuscript.

Conflict of Interest

The authors declare no conflict of interest.

REFERENCES

• 1) Macdonald RL, Schweizer TA. Spontaneous subarachnoid haemorrhage. Lancet, 389, 655–666 (2017).
• 2) Cahill WJ, Calvert JH, Zhang JH. Mechanism of early brain injury after subarachnoid hemorrhage. J. Cereb. Blood Flow Metab., 26, 1341–1353 (2006).
• 3) Kusaka G, Ishikawa M, Nanda A, Granger DN, Zhang JH. Signaling pathways for early brain injury after subarachnoid hemorrhage. J. Cereb. Blood Flow Metab., 24, 916–925 (2004).
• 4) Park SW, Lee JY, Heo NH, Han JJ, Lee EC, Hong DY, Lee DH, Lee MR, Oh JS. Short- and long-term mortality of subarachnoid hemorrhage according to hospital volume and severity using a nationwide multicenter registry study. Front. Neurol., 13, 952794 (2022).
• 5) Fujii M, Yan J, Rolland WB, Soejima Y, Caner B, Zhang JH. Early brain injury, an evolving frontier in subarachnoid hemorrhage research. Transl. Stroke Res., 4, 432–446 (2013).
• 6) Yin D, Zhou S, Xu X, Gao W, Li F, Ma Y, Sun D, Wu Y, Guo Q, Liu H, Han L, Wang Z, Wang Y, Zhang J. Dexmedetomidine attenuated early brain injury in rats with subarachnoid haemorrhage by suppressing the inflammatory response: the TLR4/NF-κB pathway and the NLRP3 inflammasome may be involved in the mechanism. Brain Res., 1698, 1–10 (2018).
• 7) Michinaga S, Koyama Y. Protection of the blood–brain barrier as a therapeutic strategy for brain damage. Biol. Pharm. Bull., 40, 569–575 (2017).
• 8) Fan R, Enkhjargal B, Camara R, Yan F, Gong L, ShengtaoYao, Tang J, Chen Y, Zhang JH. Critical role of EphA4 in early brain injury after subarachnoid hemorrhage in rat. Exp. Neurol., 296, 41–48 (2017).
• 9) Zhou Y, Tao T, Liu G, Gao X, Gao Y, Zhuang Z, Lu Y, Wang H, Li W, Wu L, Zhang D, Hang C. TRAF3 mediates neuronal apoptosis in early brain injury following subarachnoid hemorrhage via targeting TAK1-dependent MAPKs and NF-κB pathways. Cell Death Dis., 12, 10 (2021).
• 10) Zheng VZ, Wong GKC. Neuroinflammation responses after subarachnoid hemorrhage: a review. J. Clin. Neurosci., 42, 7–11 (2017).
• 11) Xu X, Gao W, Cheng S, Yin D, Li F, Wu Y, Sun D, Zhou S, Wang D, Zhang Y, Jiang R, Zhang J. Anti-inflammatory and immunomodulatory mechanisms of atorvastatin in a murine model of traumatic brain injury. J. Neuroinflammation, 14, 167 (2017).
• 12) Shao A, Wu H, Hong Y, Tu S, Sun X, Wu Q, Zhao Q, Zhang J, Sheng J. Hydrogen-rich saline attenuated subarachnoid hemorrhage-induced early brain injury in rats by suppressing inflammatory response: possible involvement of NF-κB pathway and NLRP3 inflammasome. Mol. Neurobiol., 53, 3462–3476 (2016).
• 13) Saha S, Buttari B, Panieri E, Profumo E, Saso L. An overview of Nrf2 signaling pathway and its role in inflammation. Molecules, 25, 5474 (2020).
• 14) Song N, Li T. Regulation of NLRP3 inflammasome by phosphorylation. Front. Immunol., 9, 2305 (2018).
• 15) Zangiabadi S, Abdul-Sater AA. Regulation of the NLRP3 inflammasome by posttranslational modifications. J. Immunol., 208, 286–292 (2022).
• 16) Dodd WS, Noda I, Martinez M, Hosaka K, Hoh BL. NLRP3 inhibition attenuates early brain injury and delayed cerebral vasospasm after subarachnoid hemorrhage. J. Neuroinflammation, 18, 163 (2021).
• 17) Díaz-García E, Nanwani-Nanwani K, García-Tovar S, Alfaro E, López-Collazo E, Quintana-Díaz M, García-Rio F, Cubillos-Zapata C. NLRP3 inflammasome overactivation in patients with aneurysmal subarachnoid hemorrhage. Transl. Stroke Res., 14, 334–346 (2023).
• 18) Liu S, Wang Y, Shi M, Maoz I, Gao X, Sun M, Yuan T, Li K, Zhou W, Guo X, Kai G. SmbHLH60 and SmMYC2 antagonistically regulate phenolic acids and anthocyanins biosynthesis in Salvia miltiorrhiza. J. Adv. Res., 42, 205–219 (2022).
• 19) Chen Y, Wu X, Yu S, Fauzee NJ, Wu J, Li L, Zhao J, Zhao Y. Neuroprotective capabilities of Tanshinone IIA against cerebral ischemia/reperfusion injury via anti-apoptotic pathway in rats. Biol. Pharm. Bull., 35, 164–170 (2012).
• 20) Robertson AL, Holmes GR, Bojarczuk AN, et al. A zebrafish compound screen reveals modulation of neutrophil reverse migration as an anti-inflammatory mechanism. Sci. Transl. Med., 6, 225ra29 (2014).
• 21) Tang Z, Yang G, Liao Z, Chen F, Chen S, Wang W, Huo G, Sun X, Wang X. Tanshinone IIA reduces AQP4 expression and astrocyte swelling after OGD/R by inhibiting the HMGB1/RAGE/NF-κB/IL-6 pro-inflammatory axis. Sci. Rep., 12, 14110 (2022).
• 22) Wen J, Chang Y, Huo S, Li W, Huang H, Gao Y, Lin H, Zhang J, Zhang Y, Zuo Y, Cao X, Zhong F. Tanshinone IIA attenuates atherosclerosis via inhibiting NLRP3 inflammasome activation. Aging, 13, 910–932 (2020).
• 23) Wu X, Guo Y, Zeng H, Chen G. DNase-1 treatment exerts protective effects in neurogenic pulmonary edema via regulating the neutrophil extracellular traps after subarachnoid hemorrhage in mice. J. Clin. Med., 11, 4349 (2022).
• 24) Zeng H, Shao B, Zhuang J, Peng Y, Chen G, Yu Q, Xu C, Fu X, Zhou H, Cao Y, Yu X, Li J, Cao S, Tan X, Gu C, Yan F, Chen G. Naringenin reduces early brain injury in subarachnoid hemorrhage (SAH) mice: the role of the AMPK/SIRT3 signaling pathway. J. Funct. Foods, 72, 104043 (2020).
• 25) Jia C, Zhang R, Wei L, Xie J, Zhou S, Yin W, Hua X, Xiao N, Ma M, Jiao H. Investigation of the mechanism of tanshinone IIA to improve cognitive function via synaptic plasticity in epileptic rats. Pharm. Biol., 61, 100–110 (2023).
• 26) Hakon J, Quattromani MJ, Sjölund C, Tomasevic G, Carey L, Lee J, Ruscher K, Wieloch T, Bauer AQ. Multisensory stimulation improves functional recovery and resting-state functional connectivity in the mouse brain after stroke. Neuroimage Clin., 17, 717–730 (2018).
• 27) Lu Y, Zhou M, Li Y, Li Y, Hua Y, Fan Y. Minocycline promotes functional recovery in ischemic stroke by modulating microglia polarization through STAT1/STAT6 pathways. Biochem. Pharmacol., 186, 114464 (2021).
• 28) Yang F, Wang Z, Zhang JH, Tang J, Liu X, Tan L, Huang Q, Feng H. Receptor for advanced glycation end-product antagonist reduces blood–brain barrier damage after intracerebral hemorrhage. Stroke, 46, 1328–1336 (2015).
• 29) Xu P, Tao C, Zhu Y, Wang G, Kong L, Li W, Li R, Li J, Zhang C, Wang L, Liu X, Sun W, Hu W. TAK1 mediates neuronal pyroptosis in early brain injury after subarachnoid hemorrhage. J. Neuroinflammation, 18, 188 (2021).
• 30) Li Y, Wang J, Li Z, Cheng H, Zhang Z, Luo T, Zhang X, Gao G, Lu H, Li L. Propoxyphene mediates oxyhemoglobin-induced injury in rat cortical neurons through up-regulation of active-β-catenin. Front. Pharmacol., 10, 1616 (2020).
• 31) Zhou Y, Tao T, Liu G, Gao X, Gao Y, Zhuang Z, Lu Y, Wang H, Li W, Wu L, Zhang D, Hang C. TRAF3 mediates neuronal apoptosis in early brain injury following subarachnoid hemorrhage via targeting TAK1-dependent MAPKs and NF-κB pathways. Cell Death Dis., 12, 10 (2021).
• 32) Chen S, Ding Y, Shi S, Tu X. Schisandrin B inhibits NLRP3 inflammasome pathway and attenuates early brain injury in rats of subarachnoid hemorrhage. Chin. J. Integr. Med., 28, 594–602 (2022).
• 33) Yang L, Zhou G, Liu J, Song J, Zhang Z, Huang Q, Wei F. Tanshinone I and Tanshinone IIA/B attenuate LPS-induced mastitis via regulating the NF-κB. Biomed. Pharmacother., 137, 111353 (2021).
• 34) Islam MT, Bardaweel SK, Mubarak MS, Koch W, Gaweł-Beben K, Antosiewicz B, Sharifi-Rad J. Immunomodulatory effects of diterpenes and their derivatives through NLRP3 inflammasome pathway: a review. Front. Immunol., 11, 572136 (2020).
• 35) Zhang X, Wu Q, Zhang Q, Lu Y, Liu J, Li W, Lv S, Zhou M, Zhang X, Hang C. Resveratrol attenuates early brain injury after experimental subarachnoid hemorrhage via inhibition of NLRP3 inflammasome activation. Front. Neurosci, 11, 611 (2017).
• 36) Evavold CL, Kagan JC. How inflammasomes inform adaptive immunity. J. Mol. Biol., 430, 217–237 (2018).
• 37) Wang Z, Guo S, Wang J, Shen Y, Zhang J, Wu Q. Nrf2/HO-1 mediates the neuroprotective effect of mangiferin on early brain injury after subarachnoid hemorrhage by attenuating mitochondria-related apoptosis and neuroinflammation. Sci. Rep., 7, 11883 (2017).
• 38) Dienel A, Veettil RA, Matsumura K, Savarraj JPJ, Choi HA, Kumar T P, Aronowski J, Dash P, Blackburn SL, McBride DW. α7-acetylcholine receptor signaling reduces neuroinflammation after subarachnoid hemorrhage in mice. Neurotherapeutics, 18, 1891–1904 (2021).
• 39) Ye L, Gao L, Cheng H. Inflammatory Profiles of the Interleukin Family and Network in Cerebral Hemorrhage. Cell. Mol. Neurobiol., 38, 1321–1333 (2018).
• 40) Cao Y, Li Y, He C, Yan F, Li J, Xu H, Zhuang J, Zhou H, Peng Y, Fu X, Lu X, Yao Y, Wei Y, Tong Y, Zhou Y, Wang L. Selective ferroptosis inhibitor liproxstatin-1 attenuates neurological deficits and neuroinflammation after subarachnoid hemorrhage. Neurosci. Bull., 37, 535–549 (2021).
• 41) Dong Y, Fan C, Hu W, Jiang S, Ma Z, Yan X, Deng C, Di S, Xin Z, Wu G, Yang Y, Reiter RJ, Liang G. Melatonin attenuated early brain injury induced by subarachnoid hemorrhage via regulating NLRP3 inflammasome and apoptosis signaling. J. Pineal Res., 60, 253–262 (2016).
• 42) Tak PP, Firestein GS. NF-κB: a key role in inflammatory diseases. J. Clin. Invest., 107, 7–11 (2001).
• 43) Liu H, Zhao L, Yue L, Wang B, Li X, Guo H, Ma Y, Yao C, Gao L, Deng J, Li L, Feng D, Qu Y. Pterostilbene attenuates early brain injury following subarachnoid hemorrhage via inhibition of the NLRP3 inflammasome and Nox2-related oxidative stress. Mol. Neurobiol., 54, 5928–5940 (2017).
• 44) Newman DJ, Cragg GM. Natural products as sources of new drugs over the last 25 years. J. Nat. Prod., 70, 461–477 (2007).
• 45) Newman DJ, Cragg GM. Natural products as sources of new drugs over the 30 years from 1981 to 2010. J. Nat. Prod., 75, 311–335 (2012).
• 46) Newman DJ, Cragg GM. Natural products as sources of new drugs over the nearly four decades from 01/1981 to 09/2019. J. Nat. Prod., 83, 770–803 (2020).
• 47) Wang H, Zhang M, Fang J, He Y, Liu M, Hong Z, Chai Y. Simultaneous determination of seven lipophilic and hydrophilic components in Salvia miltiorrhiza Bunge by LC-MS/MS Method and its application to a transport study in a blood–brain-barrier cell model. Molecules, 27, 657 (2022).
• 48) Irtegun Kandemir S, Fidan HS, Yener I, Mete N, Ertas A, Topcu G, Kolak U. Investigation of cytotoxic and apoptotic effects of 63 compounds obtained from Salvia species: promising anticancer agents. J. Food Biochem., 46, e14226 (2022).
• 49) Zhao H, Han B, Li X, Sun C, Zhai Y, Li M, Jiang M, Zhang W, Liang Y, Kai G. Salvia miltiorrhiza in breast cancer treatment: a review of its phytochemistry, derivatives, nanoparticles, and potential mechanisms. Front. Pharmacol., 13, 872085 (2022).
• 50) Liu L, Zhang X, Wang L, Yang R, Cui L, Li M, Du W, Wang S. The neuroprotective effects of Tanshinone IIA are associated with induced nuclear translocation of TORC1 and upregulated expression of TORC1, pCREB and BDNF in the acute stage of ischemic stroke. Brain Res. Bull., 82, 228–233 (2010).
• 51) Dong K, Xu W, Yang J, Qiao H, Wu L. Neuroprotective effects of Tanshinone IIA on permanent focal cerebral ischemia in mice. Phytother. Res., 23, 608–613 (2009).
• 52) Yang B, Wang Y, Fang C, Song E, Song Y. Polybrominated diphenyl ether quinone exposure leads to ROS-driven lysosomal damage, mitochondrial dysfunction and NLRP3 inflammasome activation. Environ. Pollut., 311, 119846 (2022).
• 53) Chen W, Yuan C, Lu Y, Zhu Q, Ma X, Xiao W, Gong W, Huang W, Xia Q, Lu G, Li W. Tanshinone IIA protects against acute pancreatitis in mice by inhibiting oxidative stress via the Nrf2/ROS pathway. Oxid. Med. Cell. Longev., 2020, 5390482 (2020).
• 54) Xia DY, Yuan JL, Jiang XC, Qi M, Lai NS, Wu LY, Zhang XS. SIRT1 promotes M2 microglia polarization via reducing ROS-mediated NLRP3 inflammasome signaling after subarachnoid hemorrhage. Front. Immunol., 12, 770744 (2021).
• 55) Bagchi S, Chhibber T, Lahooti B, Verma A, Borse V, Jayant RD. In-vitro blood–brain barrier models for drug screening and permeation studies: an overview. Drug Des. Devel. Ther., 13, 3591–3605 (2019).
• 56) Platten M, Wick W. Blood–brain barrier and brain edema. Handb. Clin. Neurol., 104, 53–62 (2012).
• 57) Liu ZH, Chen NY, Tu PH, Wu CT, Chiu SC, Huang YC, Lim SN, Yip PK. DHA attenuates cerebral edema following traumatic brain injury via the reduction in blood–brain barrier permeability. Int. J. Mol. Sci., 21, 6291 (2020).
• 58) Tian Y, Liu B, Li Y, Zhang Y, Shao J, Wu P, Xu C, Chen G, Shi H. Activation of RARα receptor attenuates neuroinflammation after SAH via promoting M1-to-M2 phenotypic polarization of microglia and regulating Mafb/Msr1/PI3K-Akt/NF-κB pathway. Front. Immunol., 13, 839796 (2022).