ACY1215 Exerts Anti-inflammatory Effects by Inhibition of NF-κB and STAT3 Signaling Pathway to Repair Spinal Cord Injury

Abstract

Spinal cord injury (SCI), a public health problem caused by mechanical injury, leads to secondary excessive inflammatory reactions and long-term damage to neurological function. ACY1215 is a highly selective histone deacetylase 6 (HDAC6) inhibitor and reportedly has anti-inflammatory effects; however, its regulatory role in SCI has not been studied. The purpose of this study was to explore the role of ACY1215 in preventing inflammation, inhibiting astrogliosis, enhancing remyelination and preserving axons after spinal cord injury and further exploring the possible cellular signaling pathways involved. First, lipopolysaccharide (LPS) was utilized to stimulate rat astrocytes in vitro. Quantitative RT (qRT)-PCR and Western blotting showed that ACY1215 inhibited the expression of glial fibrillary acidic protein (GFAP), interleukin-1β (IL-1β), interleukin-6 (IL-6), and tumor necrosis factor-α (TNFα) in LPS-activated astrocytes. In addition, Western blotting results showed that ACY1215 could inhibit the signal transduction pathway of nuclear factor-κB (NF-κB) and signal transducer and activator of transcription 3 (STAT3). In vivo, ACY1215 could exert anti-inflammatory effects by inhibiting the expression of inflammatory cytokines, including IL-1β, IL-6, and TNF-α. Moreover, ACY1215 repaired spinal cord injury by reducing the formation of glial scars and promoting remyelination and nerve recovery. In summary, ACY1215 can inhibit the NF-κB and STAT3 signaling pathways in astrocytes, reduce inflammation and ameliorate SCI. Our results provide a novel strategy for the treatment of SCI.

INTRODUCTION

Spinal cord injury (SCI) is a global public health problem with devastating consequences for the physical and psychosocial health of patients. Intervention in the early postinjury stage will have a substantial impact on long-term functional recovery.¹⁾ The pathological process of spinal cord injury can be divided into two consecutive stages: primary injury and secondary injury.²⁾ Primary injury is predominantly attributed to a fall or direct mechanical impact on the spinal cord and commonly occurs in traffic accidents.³⁾ In the secondary injury stage, excessive local inflammation is the most prominent feature. The accumulation of a large number of inflammatory cytokines, such as tumor necrosis factor-α (TNF-α), interleukin1β (IL-1β), and IL-6, leads to a series of adverse consequences. An imbalance in the intracellular electrolyte concentration caused by excessive inflammatory reactions further triggers the release of other cytotoxic substances that eventually result in cellular dysfunction and death.⁴⁾ In turn, oligodendrocytes initiate apoptosis, ultimately resulting in chronic demyelination and consequent antegrade neurodegeneration.⁵⁾ Moreover, astrocytes proliferate to establish a glial barrier following spinal cord injury. While this action does serve to limit the inflammatory response to some extent, it also significantly impedes nerve connectivity.⁶⁾ Secondary injury, triggered by a series of molecular, biochemical and immune response cascades, exacerbates local tissue damage, expands the scope of injury and causes far greater harm than the initial insult. However, primary injury remains unalterable. Effectively controlling inflammatory outbreaks in light of secondary injury is currently a focal point in spinal cord injury treatment. Based on the current understanding of the pathophysiology of spinal cord injury, interventions aimed at reducing inflammation, promoting axonal recovery and remyelination, and minimizing glial scar formation appear to have significant impacts on mitigating secondary injury cascades and improving long-term neurological function.^5,7)

According to recent reports, histone deacetylase 6 (HDAC6) plays a crucial role in the pathogenesis of inflammatory diseases affecting the nervous system.^8–14) Moreover, the HDAC inhibitor tubastatin A can enhance functional recovery after spinal cord injury by inhibiting HDAC6.¹⁵⁾ Previous experimental studies have shown that ACY1215 plays an anti-inflammatory role in osteoarthritis, macrophage inflammation and acute liver failure by inhibiting the nuclear factor-κB (NF-κB) and signal transducer and activator of transcription 3 (STAT3) signaling pathways.^16–18) However, the anti-inflammatory and therapeutic effects of ACY1215 in spinal cord injury have not been explored.

In this study, we investigated the therapeutic potential of ACY1215 for treating spinal cord injury by conducting in vitro astrocyte culture and in vivo spinal cord injury experiments. The results showed that ACY1215 could exert anti-inflammatory and neuroprotective effects, reduce glial scar formation and promote remyelination by inhibiting the NF-κB and STAT3 signaling pathways.

MATERIALS AND METHODS

Primary Astrocyte Extraction and Treatment

Six-week-old Sprague–Dawley (SD) rats were anesthetized by intraperitoneal injection of 10% chloral hydrate (0.3 mL/100 g) and sterilized by soaking in 75% alcohol for 5 min. The rat spinal cord tissue was removed under aseptic conditions and cut into pieces with microsurgical scissors after the surface membrane and blood vessels were carefully removed. The cell suspension was filtered through a 200-mesh cell sieve to obtain a cell mixture and then cultured in 5% CO² at 37 °C for 2 h to remove fibroblasts by differential adhesion treatment. The cell suspension was then transferred to a culture flask coated with poly-D-lysine for further cultivation. After 4 d, the culture medium (Dulbecco’s modified Eagle’s medium (DMEM)/F12 (Invitrogen, Carlsbad, CA, U.S.A.) +10% fetal bovine serum (FBS) (Biological Industries, Kibbutz Beit Haemek, Israel)) was replaced with fresh medium, after which the medium was further changed every 3 d.¹⁹⁾ After 13 d, the cells were shaken in a horizontal shaker (260 rpm, 16 h, 37 °C) to remove the microglia when the cells filled 80–90% of the bottle wall. The adherent cells were primary astrocytes. After digestion with trypsin, the astrocytes were cultured in medium containing 10% fetal bovine serum. After trypsinization, lipopolysaccharides (LPS) (PeproTech, Rocky Hill, NJ, U.S.A.) were used to stimulate astrocytes to establish an in vitro spinal cord injury model. Astrocytes were cultured in medium containing 10% FBS supplemented with or without LPS (1 µg/mL), ACY1215 (5 µM) or ACY1215 (10 µM). The treatment agent was added to the astrocyte culture medium, and the cells were fixed after 24 h for further experiments. All procedures were approved by the Animal Ethics Committee of Anhui Medical University. All procedures were approved by the Animal Ethics Committee of Anhui Medical University (No. LLSC20200237).

Immunofluorescence (IF) Staining

The astrocytes were grown on a 12-well culture plate and fixed twice with 4% paraformaldehyde. Then, the astrocyte membrane was permeabilized with 0.5% Triton X-100 and blocked with goat serum (ZSGB-BIO, Beijing, China). After the cells were incubated with an anti-glial fibrillary acidic protein (GFAP) rabbit polyclonal antibody (pAb) (#WL0836; Wanleibio, Shenyang, China) overnight in a 4 °C humidified chamber, they were incubated with a fluorescein isothiocyanate (FITC)-labeled secondary antibody (ZSGB-BIO) for 2 h at room temperature. Then, the slides were washed 3 times in PBST for 5 min each. After counterstaining with 4′,6-diamino-2-phenylindole (DAPI; Beyotime, Shanghai, China) at 37 °C in the dark for 5 min, the slides were photographed under a light fluorescence microscope (DM6B, Leica, Germany).

Rat SCI Model and Treatment

Adult female SD rats (180–220 g) were obtained from the Animal Laboratory of Anhui Medical University (Hefei, China). Under standard temperature conditions, these rats were reared with 12 h of light/dark cycle. The animals were strengthened with nutritional support 3 d before the operation (the animals were given sufficient protein by eating eggs). A rat model of spinal cord injury was established by Allen’s method.²⁰⁾ After the rats were weighed, the abdominal injection site was disinfected with 2% iodine. Rats were anesthetized by intraperitoneal injection of 4% chloral hydrate (0.3 mL/100 g). The lamina was carefully opened to expose the spinal cord at the T9-T10 segment. Then, the sterilized metal impactor (impinger: 10 g, diameter: 2 mm) was dropped from a height of 50 mm onto the spinal cord, and the needle was immediately removed without compromising the integrity of the dura mater. We also included a group of age-matched normal female rats as a baseline control. We administered the first dose immediately after the modeling was completed. The rats were randomly divided into 4 groups according to the treatment methods used: (1) Sham operation group: Age-matched normal female rats in which only the lamina was removed as a baseline control; (2) Spinal cord injury group: after spinal cord injury, treatment with vehicle, representing baseline spinal cord injury; (3) Spinal cord injury + low-dose ACY1215 group: given 25 mg/kg ACY1215 via intraperitoneal injection once a week; and (4) Spinal cord injury + high-dose ACY1215 group: given 50 mg/kg ACY1215 via intraperitoneal injection once a week. All animal experimental procedures in this study were approved by the Animal Experiment Ethics Committee of Anhui Medical University (No. LLSC20200237).

Tissue Processing

At the end of each experimental time point, samples were taken, and the rats were anesthetized via intraperitoneal injection of 10% chloral hydrate (0.3 mL/100 g). Five millimeters of damaged spinal cord tissue above and below the injury center was carefully removed for the next step of Western blotting and quantitative RT (qRT)–PCR analysis. For the rats to be stained with Luxol fast blue (LFB) in the following step, the rats were deeply anesthetized with an excess of 10% chloral hydrate and injected with 0.9% saline and then with 4% paraformaldehyde through the heart. After the limbs became stiff, the 1 cm of damaged spinal cord tissue above and below the injury center was dissected. The spinal cord was dehydrated with a series of alcohol, removed with xylene, embedded in paraffin and sectioned.

LFB Staining

We collected spinal cord tissue from rats 28 d after spinal cord injury for further experiments. After washing with distilled water, 0.1% LFB solution was added to the slices, which were then sealed and immersed at 60 °C for 4 h. The slices were subsequently washed with distilled water and soaked in 0.05% Li₂CO₃ for 2 s for color separation. After the slices were washed again, they were observed and stained under a microscope. After 0.05% Li₂CO₃ was used for color separation and washing, the sections were removed from nonspecific staining until the myelin sheath was blue under the microscope and the background was colorless. The excess liquid in the slices was dried with filter paper and then rinsed and dehydrated twice with n-butanol. Finally, the slices were clarified with xylene and sealed with neutral resin. The images were observed and collected under a microscope.

Basso-Beattie-Bresnahan (BBB) Score

Two independent reviewers assessed the rats’ motor recovery using the BBB scoring system, and the data were averaged. The procedure was performed by blind observation. Mice were also divided into the sham operation group, SCI group, SCI + ACY1215 (25 mg/kg) group, and SCI (50 mg/kg) group. The exercise ability of the rats was evaluated on Days 0, 1, 7, 14, 21, 28, 35, and 42 after surgery; the scores ranged from 0 to 21 points.

qRT-PCR

We collected spinal cord tissue from rats 28 d after spinal cord injury for further experiments. TRIzol reagent (Invitrogen) was used to extract total RNA from processed astrocytes and rat spinal cord tissue. With respect to the PTC-100 programmable thermal controller, 5×HiScript II qRT SuperMix II (Vazyme, Nanjing, China) was used to synthesize cDNA from the same amount of RNA. The amplification program for real-time qPCR was established according to the instructions of the TB Green^® PreMix Ex Taq™ II Kit (Novoprotein, Shanghai, China). Gene expression was assessed on a Roche LightCycler 96. The list of qRT-PCR primers used is shown in Table 1. The 2^−ΔΔCt method was used to estimate relative gene expression, which was subsequently normalized to the expression of glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The data were normalized to those of an unstimulated control group.

Table 1. Sequences of the Primers Used for qRT-PCR

Primers	Forward primer (5′→3′)	Reverse primer (5′→3′)
IL-1β	CGTGGAGCTTCCAGGATGAG	CACACACTAGCAGGTCGTCA
IL-6	TACCACTTCACAAGTCGGAGG	GTGCATCATCGCTGTTCATACAA
TNF-α	GCTTGGTGGTTTGCTACGAC	ATGGGCTCCCTCTCATCAGT
NF-H	CAGGACCTGCTCAACGTCAA	GGACTGGGTCCAAAGCCAAT
MBP	ATTGTGACACCTCGTACACCC	CCTCCGTAGCCAAATCCTGG
GFAP	TTGACCTGCGACCTTGAGTC	GAGTGCCTCCTGGTAACTCG
GAPDH	ACCCAGAAGACTGTGGATGG	TTCAGCTCAGGGATGACCTT

Western Blotting (WB)

We collected spinal cord tissue from rats 28 d after spinal cord injury for further experiments. The 5 mm long spinal cord injury tissue and processed astrocytes around the injury center were subjected to Western blotting analysis. Total proteins were extracted from tissues and cells using RIPA buffer containing a mixture of phosphate/protease inhibitors. Nuclear proteins were extracted from cells by using a Nuclear and Cytoplasmic Protein Extraction Kit (Wanlei Biotech, Shenyang, China). A 10% acrylamide gradient was used to separate 30 µg of protein, which was subsequently transferred to a polyvinylidene fluoride membrane. The membrane was blocked in 5% nonfat milk for 2 h, after which the milk was removed with TBST buffer. The membrane was incubated with Anti-GAPDH Mouse monoclonal antibody (mAb) (#AC002, ABclonal Technology, Wuhan, China); anti-IL-6 Mouse mAb (#sc-57315), anti-inhibitor of κBα (IκBα) Mouse mAb (#sc-1643) (all from Santa Cruz Biotechnology, U.S.A.); anti-Phospho-NF-kB p65 (Ser536) rabbit pAb (#AF2006), anti-STAT3 rabbit pAb (#AF6294), anti-Phospho-STAT3 (Tyr705) rabbit pAb (#AF3293), anti-Phospho-IKK alpha/beta (Ser180/Ser181) rabbit pAb (#AF3013), and anti-Phospho-IκB alpha (Ser32/Ser36) rabbit pAb (#AF2002) all from (Affinity Biosciences, Cincinnati, OH, U.S.A.); anti-HDAC6 rabbit pAb (#12834-1-AP), anti-NF-H rabbit pAb (#18934-1-AP) (all from Proteintech, Wuhan, China) and anti-mature-IL1β rabbit pAb (#WL00891), anti-TNFα rabbit pAb (#WL01581), anti-MBP rabbit pAb (#WL03919), anti-IKKα/β rabbit pAb (#WL01900), anti-GFAP rabbit pAb (#WL0836), anti-lamin B rabbit pAb (#WL01775) all from (Wanlei Biotech) overnight at 4 °C. The strips were heated to room temperature, after which the membranes were incubated with horseradish peroxidase-labeled goat anti-mouse or anti-rabbit secondary antibodies at room temperature for 2 h and finally washed with TBST buffer 4 times for 5 min each. The signal was detected using WesternBright Sirius HRP substrate (Advansta, San Diego, CA, U.S.A.).

Drug Preparation and Cell Viability Assay

ACY1215 (TargetMol, Boston, MA, U.S.A.) was made into powder and dissolved in dimethyl sulfoxide (DMSO) to prepare different concentrations for intraperitoneal injection into rats. For cell experiments, the drug/DMSO mixture was diluted with DMEM/F12 containing fetal bovine serum to reach the therapeutic concentration. LPS (1 µg/mL) was applied to primary rat astrocytes cultured in vitro to simulate astrocytes after spinal cord injury. A cell counting kit-8 (CCK-8) (TargetMol) was used to detect the potential cytotoxic effect of ACY1215 on primary rat astrocytes. Astrocytes were inoculated into 96-well plates for 24 h and then treated with different concentrations of ACY1215 for 24 h. Then, 10 µM of CCK-8 solution was added to each well, and the plates were incubated at 37 °C for 2 h. The absorbance was subsequently analyzed at 450 nm.

Statistical Analysis

All the data are expressed as the average ± standard deviation. Data from 3 or 6 independent experiments were used for statistical analysis. The Shapiro–Wilk test for a normal distribution was used to test for a normal distribution. One-way or two-way ANOVA with Holm–Sidak’s multiple comparisons test (for parametric data) and the Kruskal–Wallis test (for nonparametric data) were used to analyze differences between groups. p < 0.05 indicated statistical significance. GraphPad Prism 8 (San Diego, CA, U.S.A.) was used for all the statistical analyses.

RESULTS

The Expression of HDAC6 Increased in Rat Spinal Cord Tissue and Astrocytes after Injury

We used Western blotting to conduct a semiquantitative analysis of the injured spinal cords of the rats and found that the expression level of HDAC6 increased significantly after injury (Figs. 1a, b). These findings are consistent with previous reports,¹⁵⁾ and lay the foundation for further exploration of the therapeutic effects of the highly selective HDAC6 inhibitor ACY1215 in spinal cord injury. Moreover, Western blotting was used to analyze the expression levels of HDAC6 in astrocytes in the different treatment groups. The results showed that the expression level of HDAC6 increased significantly after injury and decreased after treatment with ACY1215 (Figs. 1c, d). GFAP is an intermediate filamentous protein, that is a marker of astrocyte activation.^21,22) GFAP immunofluorescence staining was used to identify primary astrocytes. Almost all the flat, star-shaped, and multiportion cells in the microscopic field of view were stained green, which confirmed that the previously isolated rat spinal cord cells were astrocytes (Fig. 1e). The purity of the cells we measured was 98%. To explore the effect of ACY1215 on the viability of astrocytes, we used the CCK8 method to detect the effect of ACY1215 on the viability of astrocytes.¹⁶⁾ As shown in Fig. 1f, 1–20 µM ACY1215 had no obvious cytotoxic effect on rat astrocytes after 24 h of treatment, but the cell survival rate decreased only when the concentration of ACY1215 was high (40 µM). Therefore, we studied the effect of ACY1215 at concentrations of 5 and 10 µM on rat astrocytes.

Fig. 1. The Expression of HDAC6 Increased in Rat Spinal Cord Tissue after Injury

(a, b) Representative Western blotting images and semiquantitative analysis of the changes in HDAC6 expression after spinal cord injury (1, 3, 7, and 14 d) in rats. n = 6 (the “n” in the whole text refers to the number of samples (rat or cell) in each group); ** p < 0.01 and *** p < 0.001 vs. the Sham group. (c) Representative Western blotting images of HDAC6 in rat astrocytes. (d) Western blotting was used to detect the protein expression level of HDAC6 in astrocytes after 24 h of treatment with or without ACY1215 (0, 5, or 10 µM) (n = 3). Statistically significant differences are indicated by * where * p < 0.05 or *** p < 0.001 between the indicated groups. (e) Astrocytes (n = 3). The nuclei were stained with DAPI (blue). Astrocytes stained with GFAP are green. Scale bar = 100 µm. (f) The CCK-8 method was used to evaluate the effect of ACY1215 on the viability of rat astrocytes. Rat astrocytes were placed in a 96-well plate and then treated with different concentrations of ACY1215 (0, 1, 5, 10, 20, and 40 µM) for 24 h. All the data are presented as the mean ± standard deviation (n = 3). **** p < 0.0001 vs. the ACY1215 (0 µM) group.

ACY1215 Inhibits the Production of Inflammatory Cytokines and GFAP in Astrocytes Stimulated with LPS

Astrocytes are widely distributed in spinal cord tissue. Moreover, they are involved in the inflammatory reaction during spinal cord injury. We measured the effect of ACY1215 on the expression and production of the inflammatory cytokines IL-1β, IL-6, TNF-α and GFAP in astrocytes stimulated with LPS. Through qRT-PCR, we found that, compared with those in the control group, the gene expression of GFAP and the inflammatory cytokines IL-1β, IL-6 and TNF-α in the LPS group was significantly greater (Figs. 2a–d). An increase in GFAP expression represents the massive formation of glial scars after spinal cord injury. Notably, compared with those in the LPS group, the expression of inflammatory cytokines and the GFAP gene in the ACY1215 group was significantly lower. By using Western blotting analysis, we found that LPS induced a significant increase in the protein production of IL-1β, IL-6, TNF-α and GFAP in astrocytes compared with that in the control group. Compared with those in the LPS group, the protein production of inflammatory cytokines and GFAP in the ACY1215 group was significantly lower (Figs. 2e–i).

Fig. 2. ACY1215 Inhibits the Production of Inflammatory Cytokines and GFAP in Astrocytes Stimulated with Lipopolysaccharide (LPS)

(a–d) qRT-PCR was used to detect the gene expression levels of the proinflammatory cytokines GFAP (a), IL-1β (b), IL-6 (c), and TNF-α (d) in astrocytes treated with or without ACY1215 (0, 5, 10 µM) for 24 h. (e) Representative Western blotting images of GFAP, IL-1β, IL-6, and TNF-α in rat astrocytes. (f–i) Western blotting was used to detect the protein expression levels of the proinflammatory cytokines GFAP (f), IL-1β (g), IL-6 (h), and TNF-α (i) in astrocytes after 24 h of treatment with or without ACY1215 (0, 5, or 10 µM). The data are expressed as the mean ± standard error of the mean (S.E.M.) (n = 3). Statistically significant differences are indicated by *, where p < 0.05 or ** where p < 0.01 or *** p < 0.001 between the indicated groups.

ACY1215 Inhibits NF-κB and STAT3 Signaling Pathway Activation in Rat Astrocytes Induced by LPS

Next, we investigated the mechanism by which ACY1215 has an anti-inflammatory effect after spinal cord injury. A recent report showed that excessive activation of the inflammatory response during the pathogenesis of SCI-related secondary injury is related to the activation of NF-κB and STAT3.^23,24) Therefore, we investigated whether ACY1215 inhibits the NF-κB and STAT3 signaling pathways in rat astrocytes activated by LPS. The results showed that the protein bands corresponding to p-NF-κB p65, p-IκBα, IκBα, p-IKK, IKK, p-STAT3, and STAT3 were comparable to those of the control group, LPS group, LPS + 5 µM ACY1215 group, and LPS + 10 µM ACY1215 group (Fig. 3a). Compared with those in the control group, the protein expression of p-NF-κB p65, p-STAT3, p-IKK, and p-IκBα in the LPS group increased significantly (Figs. 3b–e). However, the total IκBα protein concentration in the LPS group was significantly lower than that in the control group (Fig. 3f). LPS activated the NF-κB and STAT3 signaling pathways in astrocytes. Surprisingly, the protein expression levels of p-NF-κB p65, p-STAT3, p-IKK, and p-IκBα in LPS-activated astrocytes treated with 10 µM ACY1215 were significantly lower than those in the LPS group (Figs. 3b–e). These results indicated that ACY1215 could inhibit the activation of the NF-κB and STAT3 signaling pathways. In addition, ACY1215 treatment significantly inhibited the degradation of total IκBα protein in LPS-stimulated astrocytes (Fig. 3f). In brief, ACY1215 may exert anti-inflammatory effects by attenuating the NF-κB and STAT3 signaling pathways.

Fig. 3. The Effect of ACY1215 on the LPS-Induced NF-κB and STAT3 Signaling Pathways

(a) Representative Western blotting images of p-NF-κB p65, p-STAT3, total STAT3, p-IKK, total IKK, p-IκBα and total IκBα. (b–f) Western blotting was used to semi quantitatively analyze the protein expression levels of p-STAT3 (b), p-IKK (c), p-NF-κB p65 (d), p-IκBα (e) and total IκBα (f) in rat astrocytes. The data are expressed as the mean ± S.E.M. of three independent experiments (n = 3). Statistically significant differences are indicated by * where p < 0.05 or ** where p < 0.01 or *** p < 0.001 between the indicated groups.

ACY1215 Reduces the Expression of Inflammatory Cytokines after SCI

Excessive inflammation is an important pathological process in spinal cord injury. In vivo, we collected the spinal cord tissue of rats 28 d after spinal cord injury for qRT-PCR and Western blotting analysis to explore the anti-inflammatory effect of ACY1215. The qRT-PCR results showed that the gene expression of inflammatory cytokines in the SCI group was significantly greater than that in the sham group. After ACY1215 treatment, the gene expression of inflammatory cytokines was significantly lower than that in the SCI group (Figs. 4a–c). Western blotting revealed that the protein expression of inflammatory cytokines in the SCI group was significantly greater than that in the sham group. After treatment with ACY1215, the protein expression of inflammatory cytokines was significantly lower than that in the SCI group (Figs. 4d–g). Among them, ACY1215 inhibited the expression of the TNFα gene and protein in a dose-dependent manner in injured spinal cord tissue (Figs. 4a, e).

Fig. 4. ACY1215 Reduces the Expression of Inflammatory Cytokines after Spinal Cord Injury

(a–c) qRT-PCR was used to detect the gene expression of TNF-α (a), IL-1β (b), and IL-6 (c) in the spinal cord tissues of the different groups. (d–g) Representative Western blotting images (d) and semiquantitative analysis of the protein expression of TNF-α (e), IL-1β (f), and IL-6 (g) in spinal cord tissues from the different groups. The data are expressed as the mean ± S.E.M. of six independent experiments (n = 6). Statistically significant differences are indicated by * where p < 0.05 or ** where p < 0.01 or *** p < 0.001 or **** p < 0.0001 between the indicated groups.

ACY1215 Can Reduce the Formation of Glial Scars, Reduce the Degree of Tissue Demyelination and Promote Nerve Repair after SCI

Excessive inflammation, axonal destruction, demyelination, and astrocyte hyperplasia are the main pathological processes of spinal cord injury. GFAP is mainly distributed in the astrocytes of the central nervous system; it participates in the formation of the cytoskeleton and maintains its tensile strength. GFAP is a marker of astrocyte activation.²²⁾ Neurofilament-H (NF-H) is a member of the intermediate filament family that plays a role in the radial growth of axons and determining the diameter of axons.²⁵⁾ Myelin basic protein (MBP) is the main protein of myelin in the central nervous system. It is located on the serosal surface of myelin and maintains the stability of the structure and function of myelin in the central nervous system. It is specific to nervous tissue.²⁶⁾ GFAP, MBP and NF-H are marker proteins of astrocytes, myelin and axons, respectively.²⁷⁾ To verify whether ACY1215 plays a role in neuroprotection and scar suppression only in the case of SCI, we compared the differences in the gene and protein expression of NF-H, GFAP and MBP between the SCI group and the SCI + ACY1215 (50 mg/kg) group. To evaluate the ability of ACY1215 to promote myelination and nerve recovery and reduce glial scar formation after spinal cord injury, we performed qRT-PCR and Western blot analysis on rat spinal cord tissue 28 d after spinal cord injury. The results shown that, comparison to those in the sham group, the gene and protein expression of GFAP increased significantly in the SCI group, and the gene and protein expression of MBP and NF-H decreased significantly (Figs. 5a–g). After treatment with ACY1215, the gene and protein expression of GFAP was significantly lower than that in the SCI group, and the gene and protein expression of MBP and NF-H increased significantly (Figs. 5a–g). Surprisingly, Western blotting revealed that ACY1215 promoted the expression of the NF-H and MBP proteins in a dose-dependent manner in injured spinal cord tissues (Figs. 5d, f, g). Moreover, we performed LFB myelin staining on the paraffin sections. After 28 d of treatment, compared with that in the sham group, LFB staining in the SCI group showed extensive demyelination. However, the degree of demyelination in the ACY1215 treatment group was lower than that in the injury group (Fig. 5h). To evaluate ACY1215 treatment after SCI, motor recovery in rats was assessed via the BBB rating scale for 42 d (Fig. 5i). The rats in the sham operation group showed no obvious motor dysfunction. Due to the strong natural reflex recovery ability of the rats, the scores of the rats in the SCI group increased slightly. We found that starting from the 14th day, the BBB scores of the rats in the high-dose treatment group began to show statistical differences compared with the injury group, while the BBB scores of the rats in the low-dose treatment group started to show statistical differences from the 21st day. In summary, ACY1215 reduces the degree of tissue demyelination after spinal cord injury and exerts a certain degree of neuroprotection.

Fig. 5. ACY1215 Can Reduce Glial Scar Formation, Reduce the Degree of Tissue Demyelination and Promote Nerve Repair after Spinal Cord Injury

(a–c) qRT-PCR was used to detect the gene expression of NF-H (a), GFAP (b), and MBP (c) in spinal cord tissues from the different groups. (d–f) Western blotting was used to detect the protein expression of NF-H (d), GFAP (e), and MBP (f). (g) Representative Western blotting images of NF-H, GFAP, and MBP. The data are expressed as the mean ± S.E.M. (n = 6). Statistically significant differences are indicated by * where p < 0.05 or ** where p < 0.01 or *** p < 0.001 or **** p < 0.0001 between the indicated groups. (h) Representative photomicrographs of Luxol Fast Blue (LFB) myelin staining in each group (n = 6), scale bar = 400 µm. (i) BBB scores of each group from 0 to 42 d. The data are presented as the mean ± standard deviation (n = 6 in each group). Significance was set at *** p < 0.001 or **** p < 0.0001 or ^## p < 0.01 or ^### p < 0.001 versus the SCI group.

DISCUSSION

This study showed that the expression of HDAC6 in the spinal cord tissue of rats increased after injury. ACY1215, a highly selective inhibitor of HDAC6, inhibits the activation of the NF-κB and STAT3 signaling pathways in astrocytes stimulated by LPS and reduces the production of inflammatory cytokines and GFAP. Moreover, ACY1215 reduces the expression of inflammatory cytokines, the formation of glial scars, and the degree of tissue demyelination and promotes nerve repair in injured spinal cord tissue.

As mentioned before, after spinal cord injury occurs, neuronal dysfunction is the fundamental factor causing disability in patients with SCI. These primary and secondary injury events activate glial cells, including astrocytes, fibroblasts, pericytes, Schwann cells, and microglia. The neuroinflammatory response produced by activated glial cells and their interaction with neurons are the basis of pathological changes and repair processes in the injured spinal cord.⁷⁾ However, previous studies have shown that microglia and macrophages are involved mainly in the inflammatory response process.^28,29) Microglia are resident immune cells of the central nervous system that first respond to injury signals as well as autocrine and paracrine signals from astrocytes and neurons after injury by initiating an extensive inflammatory cascade. Activated microglia initiate an inflammatory response by releasing inflammatory cytokines.³⁰⁾ Macrophages are recruited to the injury center after spinal cord injury and participate in the inflammatory response by releasing proinflammatory factors.³¹⁾ Astrocytes are the most widespread glial cells in the nervous system. Research has shown that in addition to exerting a proinflammatory effect, astrocyte hyperplasia and the formation of glial scars strongly hinder the process of axon regeneration.^29,31,32) Moreover, under conditions of inflammation and injury, astrocytes become reactive astrocytes, which have stem cell properties, multiple differentiation potentials and can even be directly transformed into functional neurons.^33,34) Therefore, to study the role of ACY1215 in inhibiting inflammation and reducing scar formation, this study used astrocytes as the research object for in vitro experiments.

As the only cytoplasmic protein in the HDAC family, HDAC6 has a unique nuclear-cytoplasmic shuttling ability and participates in a variety of cellular processes, including cell migration and intracellular transport.³⁵⁾ According to previous reports, HDAC6 plays an important regulatory role in acute lung injury, macrophage inflammation, intestinal inflammation and other inflammatory diseases.^36–38) Moreover, many studies have shown that HDAC6 plays an important regulatory role in nervous system inflammation and is used to improve central nervous system damage characterized by oxidative stress-induced neurodegeneration and insufficient axon regeneration.^10–14)

Broad-spectrum HDAC inhibitors have potential adverse reactions and their safety in many non-tumor aspects cannot be guaranteed, so selective HDAC inhibitors have received more attention.³⁹⁾ At present, there are very few studies on inhibiting HDAC6 as a target for treating spinal cord injury. In the published literature, we only found Tubastatin-A as an HDAC6 inhibitor, which regulates the autophagy-lysosome pathway mediated by HDAC6, promotes microvascular endothelial cells to phagocytize myelin fragments, accelerates the repair of SCI.^15,40,41) ACY1215 is an orally bioavailable selective HDAC6 inhibitor with an effective IC₅₀ value of 4.7 nM (more than 10 times higher selectivity than HDAC1/2/3), which has a wider range of applications than other HDAC6 selective inhibitors.⁴²⁾ The discovery and application of ACY1215 has a history of more than 10 years. At present, there are more than 10 phase I/II clinical trials related to ACY1215.⁴³⁾ Therefore, ACY1215 may be less toxic to normal cells than other broad-spectrum inhibitors.^42,44) ACY1215 has been proven to be involved in a variety of inflammatory reactions and nerve injury diseases. Previous studies have shown that ACY1215 has anti-inflammatory effects on osteoarthritis by inhibiting inflammatory cytokines.¹⁶⁾ In the treatment of acute liver failure, ACY1215 has been shown to have anti-inflammatory and cytoprotective effects by inhibiting the production of reactive oxygen species and the expression of inflammatory cytokines.^17,45) It has a certain therapeutic effect in the research of repairing rat cardiac ischemia-reperfusion injury,⁴⁶⁾ inhibiting the malignant proliferation of glioma,⁴⁷⁾ and repairing the nerve function of various nerve injuries.^14,48–51) At present, there are few reports on the anti-inflammatory and repair effects of selective HDAC6 inhibitors on spinal cord injury. Before this report, the repair effect of ACY1215 on spinal cord injury was also unknown. In particular, the study of astrocyte inflammatory response after spinal cord injury is also a new research field.

As a key transcriptional regulator of inflammatory factors, NF-κB plays a key role in the secondary injury process of spinal cord injury.^52,53) Studies have shown that proinflammatory factors can activate the NF-κB pathway. Once the NF-κB pathway is activated, p65 is phosphorylated and quickly translocated to the nucleus, where it promotes the expression of related genes, and further aggravating the inflammatory response.⁵⁴⁾ Relevant studies have shown that inhibiting the NF-κB signaling pathway can reduce inflammation and oxidative stress after spinal cord injury.^55–62) Similarly, the STAT3 signaling pathway also plays a key role in nerve cell repair. Current research shows that blocking the STAT3 signaling pathway plays an important regulatory role in inhibiting reactive astrogliosis, reducing glial scar formation, and promoting axonal function recovery.^24,63–68) Therefore, regulating these signaling pathways may be a treatment for spinal cord injury. Our results show that ACY1215 can reduce the inflammatory response after spinal cord injury, which is consistent with previous reports of anti-inflammatory effects in other inflammatory diseases.¹⁶⁾ At the same time, previous literature studies have shown that the inhibition of HDAC6 can downregulate the NF-κB or STAT3 signaling pathway and exert anti-inflammatory effects in osteoarthritis, macrophage inflammation, and high glucose-induced oxidative stress.^18,69,70) Our experimental studies showed that ACY1215 can inhibit the activation of the NF-κB and STAT3 signaling pathways in astrocytes induced by LPS, thereby reducing the expression of inflammatory cytokines and astrocyte markers; this also means that it has the potential to reduce neuroinflammation and scarring. This finding is consistent with previous studies on the regulation of the NF-κB and STAT3 signaling pathways in the treatment of nerve injury.^55,60,71,72)

Our experiments showed that HDAC6 expression increased significantly after SCI in rats and was associated with a series of inflammatory reactions. Excessive inflammation during spinal cord injury releases a large number of inflammatory cytokines, resulting in nerve cell necrosis and axon demyelination.⁷³⁾ Moreover, the hypertrophy of astrocytes caused by inflammation leads to the formation of glial scars, which further hinders the process of self-repair in the nervous system.⁷⁴⁾ These findings may indicate that ACY1215 selectively inhibits HDAC6 and further inhibits the NF-κB and STAT3 signaling pathways to reduce inflammation and neuroprotection after SCI in rats. In summary, our research further revealed that ACY1215 has therapeutic effects on promoting axonal regeneration and remyelination and reducing glial scar formation.

CONCLUSION

In summary, ACY1215 has anti-inflammatory effects, inhibits scar formation and remyelination and promotes nerve recovery after spinal cord injury in rats. In addition, our findings prove for the first time that ACY1215 can repair spinal cord injury by inhibiting the NF-κB and STAT3 signaling pathways. Our research also provides new insight into the mechanism of action of ACY1215 and provides a theoretical basis for the clinical application of ACY1215 in treating SCI.

Acknowledgments

We thank the Center for Scientific Research of Anhui Medical University and Anhui Key Laboratory of Tissue Transplantation for valuable help in our experiment.

Funding

This project was funded by the National Natural Science Foundation of China (No. 81871785) and the Research Foundation of Education Bureau of Anhui Province, China (Grant No. 2023AH051914) and Compilation project of scientific research plan of Anhui Provincial Education Department (Grant No. 2024AH010020).

Author Contributions

Ce Dai: Investigation, Data curation, Writing—original draft. Xiaohe Wang: Investigation. Rui Liu: Investigation. Weilu Gao: Resources, Project administration. Hui Zhang: Resources. Zhenfei Ding: Methodology, Formal analysis. Zongsheng Yin: Writing—review & editing, supervision, funding acquisition. All authors reviewed the manuscript.

Conflict of Interest

The authors declare no conflict of interest.

Data Availability

The data will be made available upon request.

REFERENCES

• 1) Ahuja CS, Nori S, Tetreault L, Wilson J, Kwon B, Harrop J, Choi D, Fehlings MG. Traumatic spinal cord injury-repair and regeneration. Neurosurgery, 80 (3S), S9–S22 (2017).
• 2) Ahuja CS, Wilson JR, Nori S, Kotter MRN, Druschel C, Curt A, Fehlings MG. Traumatic spinal cord injury. Nat. Rev. Dis. Primers, 3, 17018 (2017).
• 3) Singh A, Tetreault L, Kalsi-Ryan S, Nouri A, Fehlings MG. Global prevalence and incidence of traumatic spinal cord injury. Clin. Epidemiol., 6, 309–331 (2014).
• 4) McDonald JW, Sadowsky C. Spinal-cord injury. Lancet, 359, 417–425 (2002).
• 5) Venkatesh K, Ghosh SK, Mullick M, Manivasagam G, Sen D. Spinal cord injury: pathophysiology, treatment strategies, associated challenges, and future implications. Cell Tissue Res., 377, 125–151 (2019).
• 6) Gesteira TF, Coulson-Thomas YM, Coulson-Thomas VJ. Anti-inflammatory properties of the glial scar. Neural Regen. Res., 11, 1742–1743 (2016).
• 7) Orr MB, Gensel JC. Spinal cord injury scarring and inflammation: therapies targeting glial and inflammatory responses. Neurotherapeutics, 15, 541–553 (2018).
• 8) Youn GS, Cho H, Kim D, Choi SY, Park J. Crosstalk between HDAC6 and Nox2-based NADPH oxidase mediates HIV-1 Tat-induced pro-inflammatory responses in astrocytes. Redox Biol., 12, 978–986 (2017).
• 9) Tseng JH, Xie L, Song S, Xie Y, Allen L, Ajit D, Hong JS, Chen X, Meeker RB, Cohen TJ. The deacetylase HDAC6 mediates endogenous neuritic tau pathology. Cell Rep., 20, 2169–2183 (2017).
• 10) Youn GS, Ju SM, Choi SY, Park J. HDAC6 mediates HIV-1 tat-induced proinflammatory responses by regulating MAPK-NF-kappaB/AP-1 pathways in astrocytes. Glia, 63, 1953–1965 (2015).
• 11) Song Y, Qin L, Yang R, Yang F, Kenechukwu NA, Zhao X, Zhou X, Wen X, Li L. Inhibition of HDAC6 alleviating lipopolysaccharide-induced p38MAPK phosphorylation and neuroinflammation in mice. Pharm. Biol., 57, 263–268 (2019).
• 12) Rivieccio MA, Brochier C, Willis DE, Walker BA, D’Annibale MA, McLaughlin K, Siddiq A, Kozikowski AP, Jaffrey SR, Twiss JL, Ratan RR, Langley B. HDAC6 is a target for protection and regeneration following injury in the nervous system. Proc. Natl. Acad. Sci. U.S.A., 106, 19599–19604 (2009).
• 13) Pulya S, Amin SA, Adhikari N, Biswas S, Jha T, Ghosh B. HDAC6 as privileged target in drug discovery: a perspective. Pharmacol. Res., 163, 105274 (2021).
• 14) Chen C, Liu A, Lu Q, Luo L, Li J, Ke J, Liu Y, Feng X. HDAC6 inhibitor ACY-1215 improves neuropathic pain and its comorbidities in rats of peripheral nerve injury by regulating neuroinflammation. Chem. Biol. Interact., 353, 109803 (2022).
• 15) Zheng Z, Zhou Y, Ye L, Lu Q, Zhang K, Zhang J, Xie L, Wu Y, Xu K, Zhang H, Xiao J. Histone deacetylase 6 inhibition restores autophagic flux to promote functional recovery after spinal cord injury. Exp. Neurol., 324, 113138 (2020).
• 16) Cheng C, Shan W, Huang W, Ding Z, Cui G, Liu F, Lu W, Xu J, He W, Yin Z. ACY-1215 exhibits anti-inflammatory and chondroprotective effects in human osteoarthritis chondrocytes via inhibition of STAT3 and NF-κB signaling pathways. Biomed. Pharmacother., 109, 2464–2471 (2019).
• 17) Zhang W, Zhang H-y, Jiao F, Wang L, Zhang H, Gong Z. Histone deacetylase 6 inhibitor ACY-1215 protects against experimental acute liver failure by regulating the TLR4-MAPK/NF-κB pathway. Biomed. Pharmacother., 97, 818–824 (2018).
• 18) Zhang WB, Yang F, Wang Y, Jiao FZ, Zhang HY, Wang LW, Gong ZJ. Inhibition of HDAC6 attenuates LPS-induced inflammation in macrophages by regulating oxidative stress and suppressing the TLR4-MAPK/NF-κB pathways. Biomed. Pharmacother., 117, 109166 (2019).
• 19) Michelucci A, Bithell A, Burney MJ, Johnston CE, Wong KY, Teng SW, Desai J, Gumbleton N, Anderson G, Stanton LW, Williams BP, Buckley NJ. The neurogenic potential of astrocytes is regulated by inflammatory signals. Mol. Neurobiol., 53, 3724–3739 (2016).
• 20) Li S, Zhou J, Zhang J, Wang D, Ma J. Construction of rat spinal cord injury model based on Allen’s animal model. Saudi J. Biol. Sci., 26, 2122–2126 (2019).
• 21) Middeldorp J, Hol EM. GFAP in health and disease. Prog. Neurobiol., 93, 421–443 (2011).
• 22) Yang Z, Wang KK. Glial fibrillary acidic protein: from intermediate filament assembly and gliosis to neurobiomarker. Trends Neurosci., 38, 364–374 (2015).
• 23) Lu Y, Yang YY, Zhou MW, Liu N, Xing HY, Liu XX, Li F. Ketogenic diet attenuates oxidative stress and inflammation after spinal cord injury by activating Nrf2 and suppressing the NF-κB signaling pathways. Neurosci. Lett., 683, 13–18 (2018).
• 24) Herrmann JE, Imura T, Song B, Qi J, Ao Y, Nguyen TK, Korsak RA, Takeda K, Akira S, Sofroniew MV. STAT3 is a critical regulator of astrogliosis and scar formation after spinal cord injury. J. Neurosci., 28, 7231–7243 (2008).
• 25) Babaloo H, Ebrahimi-Barough S, Derakhshan MA, Yazdankhah M, Lotfibakhshaiesh N, Soleimani M, Joghataei MT, Ai J. PCL/gelatin nanofibrous scaffolds with human endometrial stem cells/Schwann cells facilitate axon regeneration in spinal cord injury. J. Cell. Physiol., 234, 11060–11069 (2019).
• 26) Hesp ZC, Goldstein EZ, Miranda CJ, Kaspar BK, McTigue DM. Chronic oligodendrogenesis and remyelination after spinal cord injury in mice and rats. J. Neurosci., 35, 1274–1290 (2015).
• 27) Ding Z, Dai C, Zhong L, Liu R, Gao W, Zhang H, Yin Z. Neuregulin-1 converts reactive astrocytes toward oligodendrocyte lineage cells via upregulating the PI3K-AKT-mTOR pathway to repair spinal cord injury. Biomed. Pharmacother., 134, 111168 (2021).
• 28) Fan H, Tang HB, Chen Z, Wang HQ, Zhang L, Jiang Y, Li T, Yang CF, Wang XY, Li X, Wu SX, Zhang GL. Inhibiting HMGB1-RAGE axis prevents pro-inflammatory macrophages/microglia polarization and affords neuroprotection after spinal cord injury. J. Neuroinflammation, 17, 295 (2020).
• 29) Hellenbrand DJ, Quinn CM, Piper ZJ, Morehouse CN, Fixel JA, Hanna AS. Inflammation after spinal cord injury: a review of the critical timeline of signaling cues and cellular infiltration. J. Neuroinflammation, 18, 284 (2021).
• 30) Brockie S, Hong J, Fehlings MG. The role of microglia in modulating neuroinflammation after spinal cord injury. Int. J. Mol. Sci., 22, 9706 (2021).
• 31) Anwar MA, Al Shehabi TS, Eid AH. Inflammogenesis of secondary spinal cord injury. Front. Cell. Neurosci., 10, 98 (2016).
• 32) Sofroniew MV, Vinters HV. Astrocytes: biology and pathology. Acta Neuropathol., 119, 7–35 (2010).
• 33) Buffo A, Rite I, Tripathi P, Lepier A, Colak D, Horn AP, Mori T, Götz M. Origin and progeny of reactive gliosis: a source of multipotent cells in the injured brain. Proc. Natl. Acad. Sci. U.S.A., 105, 3581–3586 (2008).
• 34) Clarke SR, Shetty AK, Bradley JL, Turner DA. Reactive astrocytes express the embryonic intermediate neurofilament nestin. Neuroreport, 5, 1885–1888 (1994).
• 35) Lee JH, Mahendran A, Yao Y, Ngo L, Venta-Perez G, Choy ML, Kim N, Ham WS, Breslow R, Marks PA. Development of a histone deacetylase 6 inhibitor and its biological effects. Proc. Natl. Acad. Sci. U.S.A., 110, 15704–15709 (2013).
• 36) Liu L, Zhou X, Shetty S, Hou G, Wang Q, Fu J. HDAC6 inhibition blocks inflammatory signaling and caspase-1 activation in LPS-induced acute lung injury. Toxicol. Appl. Pharmacol., 370, 178–183 (2019).
• 37) Yan B, Xie S, Liu Y, Liu W, Li D, Liu M, Luo HR, Zhou J. Histone deacetylase 6 modulates macrophage infiltration during inflammation. Theranostics, 8, 2927–2938 (2018).
• 38) Chang P, Bhatti UF, Williams AM, Dennahy IS, Liu B, Li Y, Alam HB. Inhibition of histone deacetylase 6 attenuates intestinal inflammation and apoptosis in a rodent model of hemorrhagic shock. J. Trauma Acute Care Surg., 86, 874–880 (2019).
• 39) Dallavalle S, Pisano C, Zunino F. Development and therapeutic impact of HDAC6-selective inhibitors. Biochem. Pharmacol., 84, 756–765 (2012).
• 40) Liao S, Liu Y, Kong Y, Shi H, Xu B, Tang B, Li C, Chen Y, Chen J, Du J, Zhang Y. A bionic multichannel nanofiber conduit carrying Tubastatin A for repairing injured spinal cord. Mater. Today Bio, 17, 100454 (2022).
• 41) Wu C, Pan Y, Wang L, Liu M, Tu P, Chen S, Shi L, Yan D, Ma Y, Guo Y. Inhibition of HDAC6 promotes microvascular endothelial cells to phagocytize myelin debris and reduces inflammatory response to accelerate the repair of spinal cord injury. CNS Neurosci. Ther., 30, e14439 (2024).
• 42) Zhang XH, Qin M, Wu HP, Khamis MY, Li YH, Ma LY, Liu HM. A review of progress in histone deacetylase 6 inhibitors research: structural specificity and functional diversity. J. Med. Chem., 64, 1362–1391 (2021).
• 43) Li J, Yu M, Fu S, Liu D, Tan Y. Role of selective histone deacetylase 6 inhibitor ACY-1215 in cancer and other human diseases. Front. Pharmacol., 13, 907981 (2022).
• 44) Wang N, Bartlow P, Ouyang Q, Xie XQ. Recent advances in antimultiple myeloma drug development. Pharm. Pat. Anal., 3, 261–277 (2014).
• 45) Chen Q, Wang Y, Jiao F, Shi C, Pei M, Wang L, Gong Z. Histone deacetylase 6 inhibitor ACY1215 ameliorates mitochondrial dynamic and function injury in hepatocytes by activating AMPK signaling pathway in acute liver failure mice. Histol. Histopathol., 35, 1047–1058 (2020).
• 46) Lin CF, Hsu KC, HuangFu WC, Lin TE, Huang HL, Pan SL. Investigating the potential effects of selective histone deacetylase 6 inhibitor ACY1215 on infarct size in rats with cardiac ischemia-reperfusion injury. BMC Pharmacol. Toxicol., 21, 21 (2020).
• 47) Huang ZY, Xia Y, Hu KH, Zeng SL, Wu LQ, Liu SS, Zhi C, Lai ML, Chen DM, Xie LC, Yuan ZM. Histone deacetylase 6 promotes growth of glioblastoma through the MKK7/JNK/c-Jun signaling pathway. J. Neurochem., 152, 221–234 (2019).
• 48) Mao CX, Wen X, Jin S, Zhang YQ. Increased acetylation of microtubules rescues human tau-induced microtubule defects and neuromuscular junction abnormalities in Drosophila. Dis. Model. Mech., 10, 1245–1252 (2017).
• 49) Ma J, Huo X, Jarpe MB, Kavelaars A, Heijnen CJ. Pharmacological inhibition of HDAC6 reverses cognitive impairment and tau pathology as a result of cisplatin treatment. Acta Neuropathol. Commun., 6, 103 (2018).
• 50) Wang DM, Wang B, Liu YM, Dong XH, Su YW, Li SQ. Protective effects of ACY-1215 against chemotherapy-related cognitive impairment and brain damage in mice. Neurochem. Res., 44, 2460–2469 (2019).
• 51) Zhang L, Liu C, Wu J, Tao JJ, Sui XL, Yao ZG, Xu YF, Huang L, Zhu H, Sheng SL, Qin C. Tubastatin A/ACY-1215 improves cognition in Alzheimer’s disease transgenic mice. J. Alzheimers Dis., 41, 1193–1205 (2014).
• 52) Bethea JR, Castro M, Keane RW, Lee TT, Dietrich WD, Yezierski RP. Traumatic spinal cord injury induces nuclear factor-κB activation. J. Neurosci., 18, 3251–3260 (1998).
• 53) Lee HH, Lee SG, Shin JS, Lee HY, Yoon K, Ji YW, Jang DS, Lee KT. p-Coumaroyl anthocyanin mixture isolated from tuber epidermis of Solanum tuberosum attenuates reactive oxygen species and pro-inflammatory mediators by suppressing NF-κB and STAT1/3 signaling in LPS-induced RAW264.7 macrophages. Biol. Pharm. Bull., 40, 1894–1902 (2017).
• 54) Lauder SN, Carty SM, Carpenter CE, Hill RJ, Talamas F, Bondeson J, Brennan P, Williams AS. Interleukin-1β induced activation of nuclear factor-κb can be inhibited by novel pharmacological agents in osteoarthritis. Rheumatology (Oxford), 46, 752–758 (2007).
• 55) Brambilla R, Bracchi-Ricard V, Hu WH, Frydel B, Bramwell A, Karmally S, Green EJ, Bethea JR. Inhibition of astroglial nuclear factor κB reduces inflammation and improves functional recovery after spinal cord injury. J. Exp. Med., 202, 145–156 (2005).
• 56) La Rosa G, Cardali S, Genovese T, Conti A, Di Paola R, La Torre D, Cacciola F, Cuzzocrea S. Inhibition of the nuclear factor-κB activation with pyrrolidine dithiocarbamate attenuating inflammation and oxidative stress after experimental spinal cord trauma in rats. J. Neurosurg. Spine, 1, 311–321 (2004).
• 57) Xu L, Botchway BOA, Zhang S, Zhou J, Liu X. Inhibition of NF-κB signaling pathway by resveratrol improves spinal cord injury. Front. Neurosci., 12, 690 (2018).
• 58) Tang R, Botchway BOA, Meng Y, Zhang Y, Zhou C, Jiang J, Liu X. The inhibition of inflammatory signaling pathway by secretory leukocyte protease inhibitor can improve spinal cord injury. Cell. Mol. Neurobiol., 40, 1067–1073 (2020).
• 59) Karova K, Wainwright JV, Machova-Urdzikova L, Pisal RV, Schmidt M, Jendelova P, Jhanwar-Uniyal M. Transplantation of neural precursors generated from spinal progenitor cells reduces inflammation in spinal cord injury via NF-κB pathway inhibition. J. Neuroinflammation, 16, 12 (2019).
• 60) Ding W, Cai C, Zhu X, Wang J, Jiang Q. Parthenolide ameliorates neurological deficits and neuroinflammation in mice with traumatic brain injury by suppressing STAT3/NF-κB and inflammasome activation. Int. Immunopharmacol., 108, 108913 (2022).
• 61) Zhang D, Jing B, Chen ZN, Li X, Shi HM, Zheng YC, Chang SQ, Gao L, Zhao GP. Ferulic acid alleviates sciatica by inhibiting neuroinflammation and promoting nerve repair via the TLR4/NF-κB pathway. CNS Neurosci. Ther., 29, 1000–1011 (2023).
• 62) Wang B, Lin W. Edaravone protects against pancreatic and intestinal injury after acute pancreatitis via nuclear factor-κB signaling in mice. Biol. Pharm. Bull., 43, 509–515 (2020).
• 63) Sun F, Park KK, Belin S, Wang D, Lu T, Chen G, Zhang K, Yeung C, Feng G, Yankner BA, He Z. Sustained axon regeneration induced by co-deletion of PTEN and SOCS3. Nature, 480, 372–375 (2011).
• 64) Gaojian T, Dingfei Q, Linwei L, Xiaowei W, Zheng Z, Wei L, Tong Z, Benxiang N, Yanning Q, Wei Z, Jian C. Parthenolide promotes the repair of spinal cord injury by modulating M1/M2 polarization via the NF-κB and STAT 1/3 signaling pathway. Cell Death Discov., 6, 97 (2020).
• 65) Zhang Y, Zhao Q, Chen Q, Xu L, Yi S. Transcriptional control of peripheral nerve regeneration. Mol. Neurobiol., 60, 329–341 (2023).
• 66) Ju C, Ma YG, Zuo XS, Wang XK, Song ZW, Zhang ZH, Zhu ZJ, Li X, Liang ZW, Ding T, Wang Z, Hu XY. Potential targets and mechanisms of photobiomodulation for spinal cord injury. Neural Regen. Res., 18, 1782–1788 (2023).
• 67) Xiao S, Zhang Y, Liu Z, Li A, Tong W, Xiong X, Nie J, Zhong N, Zhu G, Liu J, Liu Z. Alpinetin inhibits neuroinflammation and neuronal apoptosis via targeting the JAK2/STAT3 signaling pathway in spinal cord injury. CNS Neurosci. Ther., 29, 1094–1108 (2023).
• 68) Shin MK, Sasaki F, Ki DW, Win NN, Morita H, Hayakawa Y. Identification of Ophiocordyceps gracilioides by its anti-tumor effects through targeting the NFκB-STAT3-IL-6 inflammatory pathway. Biol. Pharm. Bull., 44, 686–690 (2021).
• 69) Yang Q, Li S, Zhou Z, Fu M, Yang X, Hao K, Liu Y. HDAC6 inhibitor Cay10603 inhibits high glucose-induced oxidative stress, inflammation and apoptosis in retinal pigment epithelial cells via regulating NF-κB and NLRP3 inflammasome pathway. Gen. Physiol. Biophys., 39, 169–177 (2020).
• 70) Barter MJ, Butcher A, Wang H, Tsompani D, Galler M, Rumsby EL, Culley KL, Clark IM, Young DA. HDAC6 regulates NF-κB signalling to control chondrocyte IL-1-induced MMP and inflammatory gene expression. Sci. Rep., 12, 6640 (2022).
• 71) Fu X, Wang Y, Fu W, Liu D, Zhang C-y, Wang Q, Tong X. The combination of adipose-derived Schwann-like cells and acellular nerve allografts promotes sciatic nerve regeneration and repair through the JAK2/STAT3 signaling pathway in rats. Neuroscience, 422, 134–145 (2019).
• 72) Tsuda M, Kohro Y, Yano T, Tsujikawa T, Kitano J, Tozaki-Saitoh H, Koyanagi S, Ohdo S, Ji RR, Salter MW, Inoue K. JAK-STAT3 pathway regulates spinal astrocyte proliferation and neuropathic pain maintenance in rats. Brain, 134, 1127–1139 (2011).
• 73) David S, Zarruk JG, Ghasemlou N. Inflammatory pathways in spinal cord injury. Int. Rev. Neurobiol., 106, 127–152 (2012).
• 74) Karimi-Abdolrezaee S, Billakanti R. Reactive astrogliosis after spinal cord injury-beneficial and detrimental effects. Mol. Neurobiol., 46, 251–264 (2012).