Asperuloside Suppresses the Development of Depression through Wnt3α/GSK-3β Signal Pathway in Rats

Abstract

Depressive disorder is the most common mental disorder with significant economic burden and limited treatments. Traditional Chinese medicine monomer has emerged as a promising non-pharmacological treatment for reducing depressive symptoms. The aim of this study was to investigate the antidepressant-like effects of asperuloside (ASP) and its mechanism. The depression-like behaviors of chronic unpredictable mild stress (CUMS)-exposed rats were evaluated by behavioral tests. At the same time, the behaviors of rats treated with different concentrations of ASP (10, 20, 40 mg/kg) were also evaluated. RNA sequencing was performed to screen for dysregulated genes following ASP treatment. The Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis was performed to state the enriched pathways. Protein expression was detected by Western blotting. With the increase of ASP concentration (over 20 mg/kg), the depression-like behaviors of the rats were alleviated, which was manifested as the increase of the number of entries in the central zone, decrease of immobility time, and the increase of swimming time, sucrose preference, and body weight. ASP activated the Wnt3α/glycogen synthase kinase 3β (GSK-3β)/β-catenin signaling pathway in vivo. Knockdown of β-catenin reversed the effects of ASP on regulating depression-like behaviors. ASP alleviates depression-like behaviors by activating the Wnt3α/GSK-3β/β-catenin signaling pathway, indicating that ASP may be a potential therapeutic drug for treatment of depression.

INTRODUCTION

Depression is a widespread mental illness that is the result of a combination of psychological, physiological and social factors.¹⁾ It is reported that genetic factors, external adverse simulation, smoking, alcohol, drug abuse, chronic diseases, and improper diet may induce depression.²⁾ At present, the pathological mechanisms of depression mainly focus on monoamine neurotransmission, alteration of the hypothalamic-pituitary-adrenal axis, and inflammation in the brain.^3,4) However, the pathology of depression is not yet fully understood. At present, antidepressants can induce side effects such as fatigue, drowsiness, weight loss, and sexual dysfunction.⁵⁾ Recently, the regulatory properties of some plant-derived natural compounds and formulations with few side effects have shown efficacy in treating depression.^6–8)

Wnt protein is a secretory glycoprotein that contains 19 family members and controls many functions, such as cell growth, differentiation, and death.^9,10) It has been reported that Wnt signaling plays a key role in the survival, function, and plasticity of neurons.¹¹⁾ Baicalin activates Wnt/β-catenin pathway in chronic and unpredictable mild stress (CUMS) mouse depression model to alleviate depression.¹²⁾ The canonical Wnt pathway is mainly mediated by Wnt1 and Wnt3α, and β-catenin acts as an intermediate signal.

Asperuloside (ASP), isolated from several plants of the Rubiaceae or Eucommiaceae families, whose molecular formula is C₁₈H₂₂O₁₁ (Fig. 1), is an iridoterpene glycoside with good anti-inflammatory and antioxidant properties on various inflammatory diseases.^13,14) ASP inhibits the inflammatory process by inhibiting the activation of the nuclear factor-kappaB (NF-κB) and mitogen-activated protein kinase (MAPK) signaling pathways in macrophages and reducing the levels of pro-inflammatory cytokines in vivo and in vitro.¹⁵⁾

Fig. 1. The Chemical Structures of ASP

Therefore, in this study, we aimed to explore the effects and molecular mechanisms of ASP on depression. First, we showed that ASP ameliorated CUMS-induced depression-like behaviors. Further investigation revealed that ASP was involved in the regulation of the Wnt3α/glycogen synthase kinase 3β (GSK-3β)/β-catenin signaling pathway. These results suggest that ASP is a potential therapeutic drug for depression treatment.

MATERIALS AND METHODS

Animals and Drug Administration

This study was conducted in accordance with the principles of the Declaration of Helsinki. All performances of animal experiments have been approved by the Animal Ethical and Welfare Committee (Protocol Number: MDKN-2022-061). Male Sprague Dawley (SD) rats (n = 70, 180–200 g body weight) were purchased from Shanghai SLAC Laboratory Animal Co., Ltd. (Shanghai, China). The rats were kept under standard environmental conditions (22 ± 2 °C, 55 ± 5% relative humidity, 12 h day/12 h night cycle). All the rats were maintained with free access to an adequate diet and water. To ensure that all rats had the same baseline level, they were acclimated to the new environment for 7 d, and changes in sucrose preference and body weight before and after drug administration were recorded. The rats were randomly divided into five groups: Control group: rats were untreated (n = 6); CUMS group: rats were exposed to CUMS (n = 6); CUMS + L-ASP group: CUMS-exposed rats were injected intraperitoneally with low concentration ASP (L-ASP, 10 mg/kg) once a day for 2 weeks (n = 6); CUMS + M-ASP group: CUMS-exposed rats were injected intraperitoneally with medium concentration ASP (M-ASP, 20 mg/kg) once a day for 2 weeks (n = 6); CUMS + H-ASP group: CUMS-exposed rats were injected intraperitoneally with high concentration ASP (H-ASP, 40 mg/kg) once a day for 2 weeks (n = 6). The dose selection and grouping of ASP refer to previous studies,¹⁴⁾ and the experimental flow chart is shown in Fig. 2. Adeno-associated viruses carrying short hairpin RNA targeting β-catenin (AAV-sh-β-catenin) and the negative control (AAV-sh-NC) were purchased from GenePharma (Shanghai, China). AAV (serotype 9) in a single dose of 5 × 10¹⁰ plaque-forming units (PFU) in 20 µL of phosphate buffered saline (PBS) per rat was administered to the hippocampus tissues of rats via intracerebroventricular injection. Briefly, rats were anesthetized with by inhalation of 2.5% isoflurane and then positioned within the stereotaxic apparatus. Small burr holes were drilled on two sides of the skull (3.24 mm posterior to bregma and 1.8 mm lateral to the midline) to allow access to the hippocampal region for injection of the AAV at the depth of 3.5 mm.

Fig. 2. The Animal Experiment Scheme

Chronic Unpredictable Mild Stress

The rat depression model consisted of the CUMS procedure described previously with slight modifications.¹⁶⁾ Rats in the control group had free access to water and food and were housed in cages. The other four groups of rats were modeled for 6 weeks and fed in a single cage. The stressors included cold water swimming (5 min, 0 °C), level shaking (15 min), noise stimulation (80 dB, 6 h), water or food deprivation (24 h), tail nip (1 min, 1 cm from the end of the tail), cage tilting (24 h, 45 °C), and inversion of the light/dark cycle (24 h).

Behavior Tests

The depression-like behaviors of rats in five groups were evaluated as previously reported.¹⁷⁾

Open Field Test (OFT)

A square arena (100 × 100 cm²) made up of 25 square (20 × 20 cm²) white floors was surrounded by 40 cm high opaque walls and used as an open field for the experiments. At the start of the test, rats were placed at the corner of the open field and allowed 10 min to explore freely. During this 5 min in exploration, the ANY-maze video tracking software recorded the number of entries in the central zone. Meanwhile, the time animals spent in central zone and total distance were also recorded. After each test, the apparatus was cleaned with 5% ethanol to prevent odor cues.

Forced Swimming Test (FST)

The FST was conducted as previously reported after 6 weeks of CUMS exposure.¹⁸⁾ In brief, the rats were forced to swim alone for 15 min in a cylindrical glass container (60 cm high and 40 cm diameter) containing tap water 28 cm deep (25 ± 1 °C). 24 h later, each rat was placed in a cylinder for a 5 min test. The duration of immobility and swimming time were recorded by mounting a video camera on the opposite side of the cylinder.

Sucrose Preference Test (SPT)

The SPT was performed as previously reported.¹⁹⁾ We trained the rats to consume a sucrose solution before the CUMS procedure. During the adaptation phase, the rats were allowed access to two bottles containing 1% sucrose solution for 24 h and then switched to one bottle containing tap water for the next 24 h. During the test phase, after being deprived of food and water for 24 h, the rats were allowed free access to both bottles, one containing 100 mL sucrose solution (1% (w/v)) and the other 100 mL tap water, for 3 h. Sucrose preference was calculated using the formula: sucrose preference (%) = sucrose intake/(sucrose intake + water intake) × 100.

RNA Sequencing

To investigate the regulation of depression-related genes and pathways by ASP, rats were treated according to the experimental protocol (Ion Total RNA-Seq Kit, Thermo Fisher Scientific, Waltham, MA, U.S.A.), and total RNA was extracted from the neuron cells and analyzed by gene sequencing. The Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway was analyzed using the Org.Hs.eg.db (version 3.8.2) and ClusterProfiler (version 3.9) packages in R (version 3.6.2).

Quantitative Real-Time (qRT)-PCR Assay

The rats were euthanized after the behavioral evaluation with injection of pentobarbital sodium (160 mg/kg), the hippocampal tissue of SD rats was collected. Total RNA was isolated from the hippocampal tissue using TRIzol reagent (TaKaRa, Shiga, Japan). Then, synthesized using a PrismScript RT Reagent Kit (TaKaRa, Dalian, China). RNA was quantified with SYBR Premix Ex Taq (TaKaRa) using the CFX96 Real-time PCR Detection System (Bio-Rad, Hercules, CA, U.S.A.). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the internal control for mRNA expression. Relative expression levels were determined using the 2^−ΔΔCt method. Primer sequences are as follows (5′ → 3′): β-catenin: Forward CAGGACTGAGAACCATGTGA, Reverse CTCTGTTCCTCCTGGAGTCA; GAPDH: Forward TGTGTGCGTGTGGTGAAGAT, Reverse GATGGCAGTGGATGGCATTT.

Western Blotting

RIPA lysis buffer (Beyotime, Shanghai, China) was used to extract total protein from hippocampal tissue and determine the protein concentration using the BCA assay (Santa Cruz, CA, U.S.A.). Protein samples were treated with 10% sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) and then electrically transferred to a polyvinylidene fluoride (PVDF) membrane (Solarbio, Beijing, China). After blocking with 5% skim milk for 1 h at room temperature, membranes were incubated at 4 °C overnight with anti-Wnt3α (Wnt3α, 1 : 800, Proteintech, Wuhan, China), anti-GSK-3β (ab183177, 1 : 1000), anti-p-GSK-3β (ab75745, 1 : 1000), anti-β-catenin (ab223075, 1 : 1000), and anti-GAPDH (ab128915, 1 : 1000, Abcam, Cambridge, U.K.). The membranes were then incubated with secondary antibodies (ab6721, 1 : 10000, Abcam). Finally, a chemiluminescence kit (ECL, Solarbio) was used for membrane visualization and quantitation using a ChemiDoc™ System (Bio-Rad, Richmond, CA, U.S.A.).

Statistical Analysis

Data are shown as the mean ± standard deviation (S.D.) and were analyzed using SPSS (version 20.0 (SPSS, Chicago, IL, U.S.A.). The Student’s t-test was used to compare the two groups. One-way ANOVA with Tukey’s test was used to analyze three or more groups. p < 0.05.

RESULTS

ASP Ameliorated CUMS-Induced Depressive-Like Behaviors and Increased Body Weight

To study the therapeutic effect of ASP on depression, we induced depressive-like behaviors in a rat model, and after CUMS, we conducted behavioral tests. In the OFT, the anxiety level of the animals was evaluated by analyzing the differences in behavior between the center and the edge of the open field. At week 6, the number of entries in the central zone, time rats spent in central zone, and total distance of the CUMS group was lower than the control group (p < 0.01). However, the CUMS + L-ASP, CUMS + M-ASP, and CUMS + H-ASP groups showed significantly higher number of entries in the central zone than the CUMS group (p < 0.01; Fig. 3A). Meanwhile, time spent in the central zone and total distance accessed by OFT were also increased by ASP treatment (Figs. 3B, C). Figures 3D and E show that the CUMS group had significantly increased immobility time and decreased swimming time during the FST (p < 0.01) compared with the control group. In contrast, ASP treatment decreased the immobility time and increased the swimming time during the FST. Compared to the control group, there was a significant reduction in body weight and sucrose consumption in the CUMS group. These indices were recovered after ASP treatment (p < 0.01; Figs. 3F, G).

Fig. 3. ASP Ameliorated CUMS-Induced Depressive-Like Behaviors and Increased Body Weight

(A) Total number of entries in the central zone, (B) the time rats spent in central zone, and (C) total distance in 10 min was recorded (one point for each entry) in the open field test. (D, E) Immobility time and swimming time in the forced swimming test were recorded. (F) Sucrose preference in the sucrose preference test of rats before and after ASP treatment. (G) The effects of ASP on the body weight of the CUMS-induced rat model. * p < 0.05, ** p < 0.01. n = 6.

ASP Regulated Gene Expression in CUMS-Induced Depression

RNA-seq analysis of the extracted hippocampus revealed differential regulation of gene expression. The heat map of selected genes is shown in Fig. 4A, the horizontal axis represents different experimental samples, and the vertical axis represents different genes; green represents a low gene expression level, and red represents a high gene expression level. To study the biological functions associated with these hypervariable genes, we performed KEGG pathway analysis. The enriched pathways are summarized in Fig. 4B, which shows that ASP can regulate the p38 MAPK, Wnt, Notch, and NF-κB signaling pathways.

Fig. 4. ASP Regulated Gene Expression in CUMS-Induced Depression

(A) Heat map of differential expression of genes in CUMS and ASP + CUMS group. (B) KEGG pathway enrichment analysis of key targets. p < 0.05.

The Inactivation of Wnt3α/GSK-3β/β-Catenin Pathway Induced by CUMS in Vivo Was Inhibited by ASP

Western blotting was conducted to assess the impact of ASP on CUMS-induced inhibition of Wnt3α/GSK-3β/β-catenin signaling pathway. CUMS exposure led to a significant decrease in the expression of Wnt3α, phospho-GSK-3β and β-catenin. ASP treatment notably and concentration-dependently promoted those expression of Wnt3α, phospho-GSK-3β and β-catenin (Figs. 5A–D).

Fig. 5. The Inactivation of Wnt3α/GSK-3β/β-Catenin Pathway Induced by CUMS in Vivo Was Inhibited by ASP

(A) Representative protein bands and (B–D) quantitative analysis of proteins in Wnt3α/GSK-3β/β-catenin pathway were accessed from the hippocampus tissues of rats under the treatment of ASP. ** p < 0.01. n = 6.

Silencing of β-Catenin Rescued the Repression Impact of ASP on Depressive-Like Behaviors

To verify whether ASP regulates depression-like behavior through Wnt3α/GSK-3β/β-catenin, we first confirmed the silencing of β-catenin expression by infection with AAV-sh-β-catenin in brain of rats (Fig. 6A). AAV-sh-β-catenin injection treatment significantly decreased the number of entries in the central zone, time spent in central zone, and total distance according to the OFT (Supplementary Figs. S1A–C). Increased immobility time and decreased swimming time obtained by FST were also induced by AAV-sh-β-catenin injection (Supplementary Figs. S1D, E). Moreover, AAV-sh-β-catenin injection decreased sucrose preference and gain of body weight of all rats (Supplementary Figs. S1F, G). Rescue experiments were performed to verify whether ASP regulates depressive-like behaviors through β-catenin. Knockdown of β-catenin significantly weakened the improvement effects of ASP on depression-like behaviors induced by CUMS observed as down-regulating the number of entries in the central zone, time spent in central zone, total distance, swimming time during the FST, sucrose consumption, and body weight (Figs. 6B–D, F–H). Meanwhile, the inhibited immobility time induced by ASP also increased by β-catenin inhibition treatment (Fig. 6E).

Fig. 6. Silencing of β-Catenin Reversed the Effects of ASP on Depressive-Like Behaviors

(A) The expression of β-catenin was evaluated by qPCR and Western blot. (B) Total number of entries in the central zone, (C) the time rats spent in central zone, and (D) total distance in 10 min was recorded (one point for each entry) in the open field test. (E, F) Immobility time and swimming time in the forced swimming test were recorded. (G) Sucrose preference in the sucrose preference test of rats before and after AAV-sh-β-catenin injection. (H) The effects of ASP on the body weight of the CUMS-induced rat model. ** p < 0.01. n = 6.

DISCUSSION

In the current study, we found that ASP significantly alleviated depression-like behaviors of rats exposed to CUMS. Moreover, the antidepressant effect of ASP is related to the activation of Wnt3α/GSK-3β/β-catenin pathway.

ASP is an important medicine that regulates inflammation and other related diseases as reported by recent studies.^20,21) As previously reported, ASP at concentration of 20 and 40 mg/kg can significantly reduce the incidence of peri-implant inflammation and alveolar bone loss.²⁾ ASP exerts protective effects on renal interstitial fibrosis of rats in a dose-dependent manner (10, 20, and 40 mg/kg).²²⁾ In current work, ASP at concentration of 10, 20, and 40 mg/kg was used in animal experiments. In our study, we found that ASP over 20 mg/kg ameliorated CUMS-induced depression-like behaviors and increased body weight. Microarray analysis is important for identifying target genes and potential signaling pathways to better understand the pathology of depression. For instance, miR-207 was found to be overexpressed in exosomes derived from unstressed mice according to microarray analysis, and in vivo experiments revealed that exosomes with low miR-207 levels showed decreased antidepressant activity.²³⁾ Qiu et al. suggested that SPATA2, ZNF208, and YTHDC1 may be biomarkers in post-stroke depression.²⁴⁾ Moreover, microarray studies have demonstrated that anti-depressants differentially regulate the expression of Wnt, Fz, Dsh receptors, and downstream transcription partners in the rodent hippocampus.²⁵⁾ The canonical Wnt pathway is mainly mediated by Wnt1 and Wnt3α, and β-catenin acts as an intermediate signal. Chronic antidepressant treatment increases Wnt2 expression in the hippocampus.²⁶⁾ Interestingly, the viral expression of Wnt2 in the hippocampus produces an antidepressant response in learned helplessness and sucrose preference tests. Therefore, we speculated that Wnt pathway may be a potential signaling pathway regulated by APS in the treatment of depression. In this study, our RNA-seq analysis and KEGG analysis data suggested that ASP can regulate several signaling pathways including the hypothetical Wnt signaling pathways.

In the canonical Wnt pathway, GSK-3 phosphorylation results in β-catenin stabilization.²⁷⁾ The translocation of β-catenin to the nucleus and its association with the transcription factor T-cell factor/lymphoid enhancer factor (TCF/LEF) results in the regulation of Wnt target genes.²⁸⁾ Disruption of canonical Wnt/GSK3 signaling has been associated with various neurodevelopmental and neuropsychiatric disorders.²⁹⁾ Mice lacking DIX domain containing-1, an intracellular Wnt/β-catenin signal pathway protein, have abnormal measures depression-like behavior.²⁹⁾ Mechanism of which DKK1 trigers Wnt/GSK3 signaling to regulate Alzheimer's disease has also been reported.³⁰⁾ Our data in this study is in line with previous studies mentioned above, the inactivation of Wnt3α/GSK-3β/β-catenin pathway can be induced by CUMS in vivo, and ASP can alleviate depressive-like behaviors by activating Wnt3α/GSK-3β/β-catenin pathway.

The current study has some limitations. Whether ASP directly interact with Wnt3α or regulate it via another pathway remains unclear. Neuronal apoptosis is involved in the pathological damage resulting in depression,^31,32) and in vitro experiments related to neuronal protection of ASP against apoptosis should be further investigated. Moreover, considering the effect of the sequence of tests in a water maze on animal behavior, decreased and increased immobility time in FST induced by different treatments might be results from affecting the motor activity, but not only the depression-like behavior. Interestingly, anxiety and reduced motor activity are also commonly considered anxiety-like symptoms,³³⁾ and whether and how ASP alleviates anxiety and its mechanisms need to be further studied.

CONCLUSION

Our results provide new evidence that APS alleviates depression-like behaviors of rats. This may be related to the activation of Wnt3α/GSK-3β/β-catenin in signaling pathway induced by APS treatment. Therefore, APS may be a novel drug to alleviate depression, and β-catenin may be the novel target for the clinical treatment of depression.

Funding

This work was supported by the National Natural Science Foundation of China (Grant No. 81960658) and Basic Ability Enhancement Program for Young and Middle-aged Teachers of Guangxi (Grant No. 2021KY0584); The Scientific Research Fund For High-level Talents of Yulin Normal University of China (Grant No. G2024ZK03).

Author Contributions

All authors participated in the design and interpretation of the studies, analysis of the data, and review of the manuscript. LY drafted the manuscript and revised it critically for important intellectual content; CL, SZ, DJ, and GZ were responsible for the acquisition, analysis, and interpretation of data for the work; HW made substantial contributions to the conception or design of the work, and all authors commented on previous versions of the manuscript. All authors have read and approved the final manuscript.

Conflict of Interest

The authors declare no conflict of interest.

Supplementary Materials

This article contains supplementary materials.

REFERENCES

• 1) Zhang Y, Long Y, Yu S, Li D, Yang M, Guan Y, Zhang D, Wan J, Liu S, Shi A, Li N, Peng W. Natural volatile oils derived from herbal medicines: a promising therapy way for treating depressive disorder. Pharmacol. Res., 164, 105376 (2021).
• 2) Wang H, He Y, Sun Z, Ren S, Liu M, Wang G, Yang J. Microglia in depression: an overview of microglia in the pathogenesis and treatment of depression. J. Neuroinflammation, 19, 132 (2022).
• 3) Beurel E, Toups M, Nemeroff CB. The bidirectional relationship of depression and inflammation: double trouble. Neuron, 107, 234–256 (2020).
• 4) Perlman K, Benrimoh D, Israel S, Rollins C, Brown E, Tunteng J, You R, You E, Tanguay-Sela M, Snook E, Miresco M, Berlim MT. A systematic meta-review of predictors of antidepressant treatment outcome in major depressive disorder. J. Affect. Disord., 243, 503–515 (2019).
• 5) Khawam EA, Laurencic G, Malone DJ Jr. Side effects of antidepressants: an overview. Cleve. Clin. J. Med., 73, 351–353, 356–361 (2006).
• 6) Speers AB, Cabey KA, Soumyanath A, Wright KM. Effects of Withania somnifera (Ashwagandha) on stress and the stress-related neuropsychiatric disorders anxiety, depression, and insomnia. Curr. Neuropharmacol., 19, 1468–1495 (2021).
• 7) Li Y, Song W, Tong Y, Zhang X, Zhao J, Gao X, Yong J, Wang H. Isoliquiritin ameliorates depression by suppressing NLRP3-mediated pyroptosis via miRNA-27a/SYK/NF-kappaB axis. J. Neuroinflammation, 18, 1 (2021).
• 8) Psiuk D, Nowak EM, Dycha N, Lopuszanska U, Kurzepa J, Samardakiewicz M. Esketamine and psilocybin—the comparison of two mind-altering agents in depression treatment: systematic review. Int. J. Mol. Sci., 23, 11450 (2022).
• 9) Tao W, Ruan J, Wu R, Zhao M, Zhao T, Qi M, Yau S, Yao G, Zhang H, Hu Y, Chen G. A natural carotenoid crocin exerts antidepressant action by promoting adult hippocampal neurogenesis through Wnt/beta-catenin signaling. J. Adv. Res., 43, 219–231 (2023).
• 10) Zhou Y, Xu J, Luo H, Meng X, Chen M, Zhu D. Wnt signaling pathway in cancer immunotherapy. Cancer Lett., 525, 84–96 (2022).
• 11) Kim TW, Piao J, Koo SY, Kriks S, Chung SY, Betel D, Socci ND, Choi SJ, Zabierowski S, Dubose BN, Hill EJ, Mosharov EV, Irion S, Tomishima MJ, Tabar V, Studer L. Biphasic activation of WNT signaling facilitates the derivation of midbrain dopamine neurons from hESCs for translational use. Cell Stem Cell, 28, 343–355.e5 (2021).
• 12) Xiao Z, Cao Z, Yang J, Jia Z, Du Y, Sun G, Lu Y, Pei L. Baicalin promotes hippocampal neurogenesis via the Wnt/β-catenin pathway in a chronic unpredictable mild stress-induced mouse model of depression. Biochem. Pharmacol., 190, 114594 (2021).
• 13) Chen YE, Xu SJ, Lu YY, Chen SX, Du XH, Hou SZ, Huang HY, Liang J. Asperuloside suppressing oxidative stress and inflammation in DSS-induced chronic colitis and RAW 264.7 macrophages via Nrf2/HO-1 and NF-kappaB pathways. Chem. Biol. Interact., 344, 109512 (2021).
• 14) Wang X, Chen X, Zhang Z, Chen J, Ge Z, Huang S, Wei H, Li D. Asperuloside prevents peri-implantitis via suppression of NF-κB and ERK1/2 on rats. Pharmaceuticals (Basel), 15, 1027 (2022).
• 15) Qiu J, Chi G, Wu Q, Ren Y, Chen C, Feng H. Pretreatment with the compound asperuloside decreases acute lung injury via inhibiting MAPK and NF-κB signaling in a murine model. Int. Immunopharmacol., 31, 109–115 (2016).
• 16) Lan T, Li Y, Fan C, Wang L, Wang W, Chen S, Yu SY. MicroRNA-204-5p reduction in rat hippocampus contributes to stress-induced pathology via targeting RGS12 signaling pathway. J. Neuroinflammation, 18, 243 (2021).
• 17) Miguel Telega L, Berti R, Blazhenets G, Domogalla LC, Steinacker N, Omrane MA, Meyer PT, Coenen VA, Eder AC, Dobrossy MD. Reserpine-induced rat model for depression: Behavioral, physiological and PET-based dopamine receptor availability validation. Prog. Neuropsychopharmacol. Biol. Psychiatry, 133, 111013 (2024).
• 18) Shi ZM, Jing JJ, Xue ZJ, Chen WJ, Tang YB, Chen DJ, Qi XY, Huang L, Zou YQ, Wu XZ, Yang F. Stellate ganglion block ameliorated central post-stroke pain with comorbid anxiety and depression through inhibiting HIF-1alpha/NLRP3 signaling following thalamic hemorrhagic stroke. J. Neuroinflammation, 20, 82 (2023).
• 19) Xia J, Wang H, Zhang C, Liu B, Li Y, Li K, Li P, Song C. The comparison of sex differences in depression-like behaviors and neuroinflammatory changes in a rat model of depression induced by chronic stress. Front. Behav. Neurosci., 16, 1059594 (2023).
• 20) Kong Z, Liu C, Olatunji OJ. Asperuloside attenuates cadmium-induced toxicity by inhibiting oxidative stress, inflammation, fibrosis and apoptosis in rats. Sci. Rep., 13, 5698 (2023).
• 21) Shen Q, Chen Y, Shi J, Pei C, Chen S, Huang S, Li W, Shi X, Liang J, Hou S. Asperuloside alleviates lipid accumulation and inflammation in HFD-induced NAFLD via AMPK signaling pathway and NLRP3 inflammasome. Eur. J. Pharmacol., 942, 175504 (2023).
• 22) Xianyuan L, Wei Z, Yaqian D, Dan Z, Xueli T, Zhanglu D, Guanyi L, Lan T, Menghua L. Anti-renal fibrosis effect of asperulosidic acid via TGF-β1/smad2/smad3 and NF-κB signaling pathways in a rat model of unilateral ureteral obstruction. Phytomedicine, 53, 274–285 (2019).
• 23) Li D, Wang Y, Jin X, Hu D, Xia C, Xu H, Hu J. NK cell-derived exosomes carry miR-207 and alleviate depression-like symptoms in mice. J. Neuroinflammation, 17, 126 (2020).
• 24) Qiu H, Shen L, Shen Y, Mao Y. Identification of a miRNA-mRNA regulatory network for post-stroke depression: a machine-learning approach. Front. Neurol., 14, 1096911 (2023).
• 25) Gigliucci V, O’Dowd G, Casey S, Egan D, Gibney S, Harkin A. Ketamine elicits sustained antidepressant-like activity via a serotonin-dependent mechanism. Psychopharmacology (Berl.), 228, 157–166 (2013).
• 26) Zhou WJ, Xu N, Kong L, Sun SC, Xu XF, Jia MZ, Wang Y, Chen ZY. The antidepressant roles of Wnt2 and Wnt3 in stress-induced depression-like behaviors. Transl. Psychiatry, 6, e892 (2016).
• 27) Zhou L, Jiang J, Huang Z, Jin P, Peng L, Luo M, Zhang Z, Chen Y, Xie N, Gao W, Nice EC, Li JQ, Chen HN, Huang C. Hypoxia-induced lncRNA STEAP3-AS1 activates Wnt/β-catenin signaling to promote colorectal cancer progression by preventing m⁶A-mediated degradation of STEAP3 mRNA. Mol. Cancer, 21, 168 (2022).
• 28) Doumpas N, Lampart F, Robinson MD, Lentini A, Nestor CE, Cantu C, Basler K. TCF/LEF dependent and independent transcriptional regulation of Wnt/beta-catenin target genes. EMBO J., 38, e98873 (2019).
• 29) Martin PM, Stanley RE, Ross AP, Freitas AE, Moyer CE, Brumback AC, Iafrati J, Stapornwongkul KS, Dominguez S, Kivimae S, Mulligan KA, Pirooznia M, McCombie WR, Potash JB, Zandi PP, Purcell SM, Sanders SJ, Zuo Y, Sohal VS, Cheyette B. DIXDC1 contributes to psychiatric susceptibility by regulating dendritic spine and glutamatergic synapse density via GSK3 and Wnt/β-catenin signaling. Mol. Psychiatry, 23, 467–475 (2018).
• 30) Marzo A, Galli S, Lopes D, McLeod F, Podpolny M, Segovia-Roldan M, Ciani L, Purro S, Cacucci F, Gibb A, Salinas PC. Reversal of synapse degeneration by restoring Wnt signaling in the adult hippocampus. Curr. Biol., 26, 2551–2561 (2016).
• 31) Shen J, Zhang P, Li Y, Fan C, Lan T, Wang W, Yu SY. Neuroprotective effects of microRNA-211-5p on chronic stress-induced neuronal apoptosis and depression-like behaviours. J. Cell. Mol. Med., 25, 7028–7038 (2021).
• 32) Xiao W, Su J, Gao X, Yang H, Weng R, Ni W, Gu Y. The microbiota-gut-brain axis participates in chronic cerebral hypoperfusion by disrupting the metabolism of short-chain fatty acids. Microbiome, 10, 62 (2022).
• 33) Xu F, Han L, Wang Y, Deng D, Ding Y, Zhao S, Zhang Q, Ma L, Chen X. Prolonged anesthesia induces neuroinflammation and complement-mediated microglial synaptic elimination involved in neurocognitive dysfunction and anxiety-like behaviors. BMC Med., 21, 7 (2023).