Sunflower Trypsin Monocyclic Inhibitor Selected for the Main Protease of SARS-CoV-2 by Phage Display

Abstract

Main protease (Mpro), also known as 3-chymotrypsin-like protease (3CLpro), is a nonstructural protein (NSP5) of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) responsible for the cleavage of virus polyproteins during viral replication at 11 sites, which generates 12 functional proteins. Mpro is a cysteine protease that presents specificity for the amino acid residue glutamine (Gln) at the P1 position of the substrate. Due to its essential role in processing the viral polyprotein for viral particle formation (assembly), Mpro inhibition has become an important tool to control coronavirus disease 2019 (COVID-19), since Mpro inhibitors act as antivirals. In this work, we proposed to identify specific inhibitors of the Mpro of SARS-CoV-2 using a monocyclic peptide (sunflower trypsin inhibitor (SFTI)) phage display library. Initially, we expressed, purified and activated recombinant Mpro. The screening of the mutant SFTI phage display library using recombinant Mpro as a receptor resulted in the five most frequent SFTI mutant sequences. Synthetized mutant SFTIs did not inhibit Mpro protease using the fluorogenic substrate. However, the mutant SFTI 4 efficiently decreased the cleavage of recombinant human prothrombin as a substrate by Mpro, as confirmed by sodium dodecyl sulfate (SDS)–polyacrylamide gel electrophoresis (PAGE). Additionally, SFTI 4 presented a dissociation constant (KD) of 21.66 ± 6.66 µM for Mpro by surface plasmon resonance. Finally, 0.1 µM SFTI 4 reduced VERO cell infection by SARS-CoV-2 wt after 24 and 48 h. In conclusion, we successfully screened a monocyclic peptide library using phage display for the Mpro of SARS-CoV-2, suggesting that this methodology can be useful in identifying new inhibitors of viral enzymes.

INTRODUCTION

In December 2019, a novel coronavirus named severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) was announced by WHO as responsible for the outbreak of coronavirus disease 2019 (COVID-19). As of January 2023, the COVID-19 pandemic resulted in over 6.9 million deaths worldwide.¹⁾

SARS-CoV-2 is an enveloped, single-stranded, and positive-sense RNA virus that belongs to a group of pathogenic viruses called betacoronaviruses, one of four genera of the family Coronaviridae. This genus includes other pathogenic viruses, such as SARS-CoV and Middle East respiratory syndrome coronavirus (MERS-CoV), which caused outbreaks in 2003 and 2012, respectively.^2,3) The SARS-CoV-2 genome shares 79.6 and 50% homology with SARS-CoV and MERS, respectively.⁴⁾

SARS-CoV-2 infection starts by the interaction of the viral S protein with the host membrane protein angiotensin-converting enzyme 2 (ACE2), promoting viral uptake. Inside the cell, viral replication is initiated by the genomic RNA release, uncoating in the cytoplasm, and fast translation of two open reading frames (ORF1a and ORF1b) that generate two polyproteins (pp1a and pp1ab). These polyproteins are processed co and post translationally into nonstructural proteins (NSPs) responsible for the viral replication and transcription complex.⁵⁾

Host proteases initially process NSPs, and then viral papain-like protease (PLpro) (NSP3) and main protease (Mpro), also known as 3-chymotrypsin-like protease (3CLpro) (NSP5), continue the process, generating 16 functional proteins, 12 of which are generated by Mpro.⁶⁾

Mpro is a cysteine protease with a catalytic dyad at Cys145-His41 that has a strong preference for the amino acid residue glutamine (Gln) at the P1 position of the substrate.⁶⁾ Since its cleavage specificity is uncommon to the human proteases described in the literature, inhibitor molecules show low toxicity.^7,8) Inhibition of Mpro enzymatic activity might be a powerful therapeutic target for pathology control. Therefore, several studies have been conducted to search for SARS-CoV-2 antivirals, focusing on Mpro inhibition.⁹⁾ Among them, a synthetic compound named nirmatrelvir (PF-07321332) presented Ki value of 3.1 nM, and oral bioavailability in the clinical trial phase, and it did not inhibit several other cysteine (caspase 2, cathepsin B, and cathepsin L), serine (chymotrypsin, elastase, and thrombin) and aspartyl proteases (cathepsin D).¹⁰⁾ A combination of nirmatrelvir and ritonavir is the novel Pfizer agent Paxlovid^®, which showed significant results in patients at risk of serious illness,¹¹⁾ and it was approved by the U.S. Food and Drug Administration (FDA) as an antiviral drug,¹²⁾ as well as remdesivir and molnupiravir, viral RNA-dependent RNA polymerase (RdRp) inhibitors identified by a drug repurposing approach.^13,14) Ensitrelvir (Xocova^®), developed by Shionogi, was urgently approved as an antiviral agent for SARS-CoV-2 by inhibiting the SARS-CoV-2 Mpro,^15,16) and many other inhibitory compounds are still under study.¹⁷⁾ Despite the recent discovery, studies on the possible resistance of these antivirals have already been carried out taking into account the great possibility of mutation in the viral protein.¹⁶⁾

In 1985, a powerful molecular biology tool named phage display was described by Smith¹⁸⁾ and allows the selection of molecules with high binding affinity for a given target molecule. Initially, phage display was used for antibody selection and was later expanded for several applications, such as the identification of new ligands for specific targets, the development of drugs, vaccines and molecules that can be used as diagnostic tools¹⁹⁾ and the selection of protease inhibitors from peptide or inhibitor phage display libraries for proteases. The selection of inhibitors for proteases involved in diseases is a useful tool and can contribute to drug development.^20–24) Synthetic and natural peptides have been used not only for antivirals, but also for vaccine and diagnostic strategies.²⁵⁾ Peptides with protease inhibitory properties have already been reported to act on SARS-CoV and SARS-CoV-2 proteases. Inhibitors that mimic natural peptides known as peptidomimetics were reported to bind Mpro of SARS-CoV-2, and some of them are in the clinical trial stage.^26,27) Searching for these molecules can be performed through different methods, including phage display.²⁵⁾

Potent cyclic peptide inhibitors of SARS-CoV-2 Mpro were described using random nonstandard peptide integrated discovery (RaPID) mRNA display technology, and the selected molecules presented IC₅₀ values ranging from 0.070–12.7 µM for peptides 1–6.²⁸⁾

Sunflower trypsin inhibitor (SFTI)-1 is a small (14 aa) and potent cyclic inhibitor of bovine trypsin.²⁹⁾ It could be considered an interesting molecule to use in the genetic engineering of inhibitors due to its rigid and defined structure and small size, facilitating the subsequent synthesis of mutants.^30,31) Many studies have reported that modifications in SFTI amino acid sequence result in improved of inhibitory activity against proteases.³⁰⁾ Consequently, engineered inhibitors for several proteases are successful therapeutic targets for diseases such as cancer, skin disease, chronic inflammation³²⁾ and rheumatoid arthritis.³³⁾ A SFTI phage display library has been constructed and selected for mannose-binding lectin-associated serine proteases (MASPs), MASP-1 and MASP-2.³⁴⁾ In this work a SFTI phage display library (P1–P4′) was constructed, and mutant inhibitors were selected for the Mpro of SAR-CoV-2.

MATERIALS AND METHODS

Production of Recombinant Protein Mpro

The DNA insert corresponding to the coding sequence of Mpro from SARS-CoV-2 Wuhan strain was cloned and inserted into the pGEX-6p-1-lacO expression plasmid by GenScript (GenScript Biotech Corporation, Piscataway, NJ, U.S.A.) fused to a His₆-tag with a HRV 3C cleavage site (LEVLFQ↓GP) to facilitate purification and further removal of His₆-tag. The recombinant plasmid pGEX-6p-1-lacO-Mpro was used to transform Escherichia coli strain BL21 (DE3) Star competent cells (Invitrogen™). The expression and purification of Mpro was performed following the protocols described by van de Plassche et al. and Zhang et al.^35,36) with some modifications. One isolated colony-forming unit containing the plasmid was precultured in 200 mL of LB medium with ampicillin (100 µg/mL) and incubated for 20 h at 37 °C and 180 rpm. Next, the bacterial culture was transferred to 3.0 L of ZYM 5052 self-inducing medium (0.5% yeast extract, 50 mM Na₂HPO₄, 50 mM KH₂PO₄, 25 mM (NH₄)₂SO₄, 0.5% glycerol, 0.05% glucose, 1% tryptone, 0.2% α-D-lactose, and 100 µg/mL ampicillin) and shaken at 180 rpm at 37 °C until OD₆₀₀ 0.7–0.8, when the protein expression was conducted at 18 °C for 20 h at 180 rpm. Afterward, the cells were harvested by centrifugation at 4000 × g at 15 °C for 15 min. The bacterial pellet was resuspended in 150 mL of 20 mM Tris HCl, pH 7.8 buffer containing 150 mM NaCl, 5 mM imidazole and 1 mM dithiothreitol (DTT) and submitted to lysis in French Pressure^® (Thermo Scientific, Waltham, MA, U.S.A.) (3 times at 7.000–10.000 psi), and 20 µL of Benzonase^® Nuclease (Millipore, Bedford, MA, U.S.A.) was added before incubation at 4 °C for 20 h, followed by centrifugation at 28000 × g at 4 °C for 30 min. The supernatant containing the soluble protein was loaded on a nickel affinity column (HisTrap FF - GE Healthcare, Chicago, IL, U.S.A.) previously equilibrated with the same buffer. The column was washed with 70 mL of buffer to remove unspecific binding proteins, followed by two elution steps using buffer containing 40 and 200 mM imidazole, respectively. To cleave the His₆-tag from purified protein, a HRV 3C protease fused to glutathione-S-transferase (GST) from the Pierce kit™ HRV 3C Protease Solution kit (Thermo Scientific), was used following the instructions of the manufacturer. The reaction was transferred into a Slide-A-Lyzer dialysis cassette^® 10 K (Thermo Scientific) and dialyzed against buffer C (20 mM Tris HCl, pH 7.8 buffer containing 150 mM NaCl and 1 mM DTT) at 4 °C for 20 h. To remove the HRV 3C protease, His6-tag and eventual noncleft Mpro His₆-tag, the reaction was applied to a GSTrap FF (GE Healthcare) column connected to a nickel column HisTrap FF (GE Healthcare).³⁹⁾ The Mpro without His₆-tag was collected in the flow-through, and the buffer was exchanged to buffer D (20 mM Tris HCl, pH 8.0 buffer containing 150 mM NaCl and 1 mM ethylenediaminetetraacetic acid (EDTA)) using an Amicon Ultra 15 centrifugal filter (10 kD, Merck Millipore, Burlington, MA, U.S.A.) at 5000 × g and 4 °C. The purified Mpro was stored in buffer D at 4 °C.

Enzymatic Activity Assay for Mpro

Purified recombinant Mpro (5.8–27 nM) was preactivated by incubation with 50 mM Tris–HCl, pH 7.5 buffer containing 1 mM EDTA and 10 mM DTT for 10 min at 37 °C. Next, the synthetic fluorogenic FRET-based substrate Abz-SAVLQ↓SGFRK(Dnp)NH₂³⁷⁾ was added at different concentrations. Fluorescence was monitored continuously at 320 and 420 nm excitation and emission wavelength parameters, respectively, in a Hitachi F-2500 spectrofluorometer (Hitachi, Tokyo, Japan). The slope was converted into micromoles of hydrolyzed substrate per minute based on a calibration curve obtained from the complete hydrolysis. The kinetic constants were determined from the initial hydrolysis rates (<5% of total hydrolysis) using the equation described by the Michaelis & Menten equation using the GraFit^® 5.0 program (Erithacus Software, Horley, Surrey, U.K.).

Construction of the SFTI Phage Display Library

The SFTI (sunflower trypsin inhibitor) phage display library mutated at positions P1–P4′ of the amino acid sequence GRCTKSIPPICFPD²⁹⁾ was constructed. The oligonucleotides 1051 SFTI.Lib 5′-CTTTCTATGCGGCCCAGCCGGCCGGTCGCTGTACGNNSNNSNNSNNSNNSATCTGTTTCCCAGACGCGGCCGCTTTTCCT-3′, 1053 SFTI_Rev- 5′-CAAGGAAAAGCGGCCGCGTCTG-3′ and 1052 SFTI_Fw 5′-CTTTCTATGCGGCCCAGCCGGCCGG-3′ were provided by Exxtend (Sao Paulo, Brazil). The mutated DNA fragment amplification was performed by PCR, containing SFTI.lib as the DNA template (34 ng/reaction), oligonucleotides 1052 and 1053 (10 µM), dNTPs (0.2 mM each) and 5 U Taq DNA polymerase (GoTaq Promega, Wisconsin-U.S.A.). The amplified mutated SFTI DNA fragments and pCANTAB5E phagemid were purified and digested with 80 U Sfi I restriction enzyme overnight at 50 °C and then with 50 U Not I restriction enzyme overnight at 37 °C. The mutated DNA fragments were purified and ligated into the purified pCANTAB5E phagemid at a 1 : 100 ratio vector:fragment (84 : 8400 fmols:fmols) using T4 DNA ligase (Promega) under overnight incubation at 16 °C. E. coli TG1 strain competent cells were transformed with the purified ligated DNA by electroporation at 500 V for 10 ms using an ECM™ 830 electroporator (BTX). Afterward, transformed bacteria were pooled, and a small portion was diluted for library titration. The rest of the transformed bacteria culture was diluted to 100 mL SOBAG medium and incubated overnight at 30 °C for amplification. The library and amplified library titers were determined by the colony number at each dilution either for the original library (10¹ to 10⁵) or the amplified library (10⁶–10⁹). All dilutions were performed in 2xYT medium, and 100 µL of each dilution was plated on SOBAG medium containing ampicillin (200 µg/mL) and incubated overnight at 30 °C.

Biopanning of the SFTI Phage Library for Mpro

Biopanning was performed as described by Tanaka et al.,²⁰⁾ Soares et al.³⁸⁾ and Manzato et al.³⁹⁾ Initially, SFTI library bacteria culture was grown in 2xYT-GA medium at 37 °C until OD₅₅₀ between 0.5–0.7 and infected by M13K07 helper phage (MOI 1 : 50) for 1 h at 37 °C. Afterward, the culture was centrifuged (1000 × g for 10 min, room temperature), and the bacterial pellet was suspended in 2xYT medium containing kanamycin (50 µg/mL) and ampicillin (200 µg/mL) and incubated while shaking at 180 rpm overnight at 37 °C to produce phage particles. Then, the culture was centrifuged (1800 × g, 15 min at room temperature), and the supernatant was collected, filtered through a 0.2 µm filter and diluted 1 : 1 in blocking buffer (phosphate-buffered saline (PBS), pH 7.4 buffer containing 3% bovine serum albumin and 0.05% Tween 20). In summary, 200 µL (6.5 µg) per well of purified recombinant Mpro diluted in 50 mM Tris–HCl, pH 8.0 buffer containing 1 mM EDTA and 2 mM DTT was used for coating a 96-well plate (MaxSorb), which was incubated overnight at 4 °C. Then, the unbound proteins were removed, and the well was blocked with blocking buffer at 30 °C for 120 min. After washing with PBS containing 0.1% Tween 20 (PBS-T), 200 µL of phage solution was added to the plate well and incubated for 120 min at 30 °C. The bound phage elution was performed in two steps: preelution and elution. First, preelution to remove weaker binders was performed using 200 µL of 0.2 M KCl solution, pH 5.0 at 30 °C for 15 min. The elution solution was transferred to a microtube containing 30 µL of 1 M Tris–HCl pH 8.0 neutralizing solution. The elution of stronger binder phages was performed with 0.2 M KCl solution, pH 2.0, under the same conditions. The eluted phages were titered by serial dilution (10¹–10⁵) and used to reinfect E. coli TG1 cells in a 1 : 1 dilution (400 µL of TG1 cells with 400 µL of eluted phage solution) for 30 min at 37 °C. Subsequently, the remaining eluted phage was incubated with E. coli TG1 following the same procedure for titration. After incubation, the medium was replaced by 2xYT containing 200 µg/mL ampicillin and 2% (w/v) glucose and incubated overnight at 37 °C. Next, a phage library was produced using M13K07 helper phage (Invitrogen, MA, U.S.A.) as described above. After the third round of selection, several colonies were randomly picked, and the phagemid DNA was purified using a Fast-n-Easy Plasmid Mini-Prep Kit (Cellco, Sao Paulo, Brazil) and sequenced using a BigDye™ Terminator v3.1 Cycle Sequencing kit (Applied Biosystems™), primer pcantrv2 (CTCAGAGCCACCACCCTCATTTTA) and an ABI 3130 Applied Biosystems automatic sequencer.

Inhibition Assay of Mpro by SFTI Mutants

The selected peptides were synthetized by solid-phase methodology as described by Hirata et al.⁴⁰⁾ Recombinant Mpro (72 nM) was preincubated in reaction buffer (50 mM Tris-buffer, pH 7.5 containing 1 mM EDTA and 2 mM DTT) for 10 min at 37 °C. Next, different concentrations of monocyclic peptides SFTI 4 (20–300 µM diluted in 30% dimethyl sulfoxide (DMSO)) were added and incubated for 10 min at 37 °C. The residual enzyme activity was monitored using synthetic substrate Abz SAVLQ↓SGFRK(Dnp)NH2 (19 µM)³⁷⁾ in a microplate spectrophotometer Synergy HT (Bio-Tek, Winooski, VT, U.S.A.) at 320 and 420 nm for excitation and emission, respectively.

Inhibition Assay of SARS-CoV-2 Mpro Using Human Prothrombin as Substrate

Alternative substrates for Mpro proteolytic activity were evaluated. The amino acid sequences of full-length proteins were analyzed by the NetCorona v. 1.0 webserver to predict the presence of Mpro cleavage sites.⁴¹⁾ Proteins presenting score >0.5 were tested. For cleavage reaction, human prothrombin and bovine prothrombin proteins were incubated with purified Mpro in reaction buffer at 37 °C for 3 h. After incubation, the reaction mixtures were analyzed by 12% sodium dodecyl sulfate (SDS)–polyacrylamide gel electrophoresis (PAGE).⁴²⁾ After confirming the cleavage of human prothrombin protein (Haematologic Technologies Inc, Essex Junction, VT, U.S.A., Catalog number: HCP-0010), this protein (4 µg) was incubated with Mpro (4 µg) and different concentrations of monocyclic SFTI peptides 1, 3, and 4 (50–300 µM) as described above. The inhibition activity was evaluated by SDS–PAGE. Densitometry of the area corresponding to 75 kDa prothrombin band under different treatments with Mpro and SFTI peptides was analyzed using ImageJ software.⁴³⁾

Binding Analysis of Monocyclic SFTI Peptides and Mpro by Surface Plasmon Resonance

The binding assays were performed to evaluate interaction between monocyclic SFTI peptides 1 and 4 and Mpro by surface plasmon resonance, using a BIAcore T200 system equipped with a sensor chip CM5 equilibrated with HBS-EP buffer (0.01 M N-(2-hydroxyethyl)piperazine-N′-2-ethanesulfonic acid (HEPES), pH 7.4 containing 0.15 M NaCl, 3 mM EDTA, 0.005% (v/v) Surfactant P20) (GE Healthcare, NJ, U.S.A.). Recombinant Mpro (0.2 µg/mL) was used for immobilization onto Fc-4 flow cell as bound area at pH 4.0, to reach density of 100 resonance units (RU), and then, 1.0 M ethanolamine was applied to block the free ester groups on the chip surface. The same procedure was performed onto Fc-3 flow cell with 0.1 mg/mL of bovine serum albumin (BSA) at pH 4.5 as a reference area. The analyte (monocyclic SFTI mutant peptides 1 and 4) was diluted in equilibrium buffer (HBS-EP) to different concentrations: 0.1 to 50 µM. The monocyclic SFTI peptide solution was injected for 180 s during the association phase at a constant flow rate of 60.0 µL/min at 37 °C. The dissociation phase was followed for 1000 s at the same flow rate with HBS-EP (1x) buffer. The sensor chip surface was regenerated with 2.0 M glycine solution, pH 2.0. The dissociation constant (KD) value for SFTI mutant 4 was calculated using inhibitor concentration values versus R_max obtained from sensor-gram and binding equation of GraFit5 software.

Cytotoxicity Assay

The cytotoxicity of monocyclic peptides (SFTIs) on VERO CCL81 cells was evaluated using MTT (3-[4,5-dimethylthiazol-2-yl]-2,5 diphenyl tetrazolium bromide) assays. Briefly, VERO cells were seeded in a 96-well plate (1.2 × 10⁴ cells/well) and incubated with the peptides at serial concentrations (0.01–100 µM). Peptides diluted in water centrifuged at 8000 rpm for 5 min and the supernatant quantified by absorbance reading with the molar extinction coefficient using the nanodrop. After 48 h of incubation at 37 °C, the cells were incubated for an additional 4 h with MTT at a final concentration of 0.25 mg/mL to convert the MTT to formazan crystals in live cells. The formazan crystals formed in live cells were solubilized in DMSO and measured by absorbance (570 nm). The results are expressed as a percentage of viable cells (%). Only peptide concentrations at a minimum cell viability of approximately 90% were used for the treatment assays of cells infected by SARS-CoV-2 virus. Statistical significance was assessed by one-way ANOVA followed by Tukey’s multiple comparisons test using GraphPad Prism software v6.0.1 (GraphPad Software).

Antiviral Assay

VERO CCL-81 cells were seeded in a 96-well plate (1.2 × 10⁴ cells/well) in 100 µL of Dulbecco’s modified Eagle’s medium (DMEM) HG (high glucose) containing 10% fetal bovine serum (FBS), 100 U/mL penicillin/streptomycin, and 3.7 g/L NaHCO₃ and incubated for 24 h at 37 °C in a 5% CO₂ atmosphere. For viral titration, 20 µL of SARS-CoV-2 wild-type isolate (HIAE-02: SARS-CoV-2/SP02/human/2020/BRA, GenBank accession number MT126808) was added in 180 µL of DMEM HG 2.5% FBS and subjected to serial dilution (10⁻¹–10⁻¹²). After viral dilution 150 µL of the diluted virus was incubated in VERO cells. For the treated cell groups, chloroquine or the monocyclic SFTI peptide was added to the medium at a final concentration of 5  or 0.1 µM, respectively. Cytopathic effects were analyzed daily by optimal microscopy, and data is shown as the median tissue infection dose (TCID₅₀)/mL. The experiment was performed in a biosafety level 3 laboratory. Statistical significance was assessed by ANOVA followed by Dunnett’s multiple comparisons test using GraphPad Prism software v6.0.1 (GraphPad Software).

RESULTS

Recombinant Mpro and Kinetic Data

The recombinant Mpro was expressed in bacterial cells and purified by nickel affinity chromatography (Fig. 1A). After removing the His₆-tag, the purified Mpro was recovered in the flow-through as indicated in Fig. 1B. Purified recombinant Mpro presented a 34 kDa single protein band corresponding to the expected molecular weight on SDS–PAGE (Fig. 1C). The yield of purified Mpro was 0.435 mg of active protein/L of culture medium. The kinetic experiment using purified Mpro at 5.8 nM and FRET-based substrate Abz-SAVLQSGFRK(Dnp)NH2 showed a K_m of 7.13 ± 0.86 µM, and K_cat/K_m 14.7 (mM s)⁻¹.

Fig. 1. Recombinant Mpro Purification A) His Trap FF Chromatogram Using a 5 mL Column

The two-step elution was performed at 40 and 200 mM imidazole. The 200 mM peak indicated by the arrow contains the protein Mpro. B) GSTrap FF chromatogram using a 5 mL column coupled to a His trap FF Column 5 mL. The Mpro without a His6-tag present in the flow-through is indicated by the arrow in the chromatogram. C) SDS–PAGE 12%. Lanes: M, protein markers Precision Plus Protein ™ Standards (Bio-Rad). 1-Final purified Mpro enzyme without His₆-tag (34 kDa) 2.6 µg.

Screening SFTI Mutants for Mpro

The constructed SFTI phage library presented a titer of 2.1 × 10⁵ colony-forming unity (cfu), and after amplification, the titer was 2.66 × 10⁸ cfu/mL. The amplified SFTI phage library was used for screening ligands for recombinant Mpro. During the selection rounds, the phages were titrated to follow the enrichment of the phage binders. The library enrichment after each biopanning was determined by dividing the percentage of recovered phages by the value obtained for the previous round, and after the 3rd panning, the recovery percentage was 8.2 times higher than on the 2nd round, suggesting positive selection for Mpro (Table 1).

Table 1. Enrichment of SFTI Phage Library along the Screening for Mpro Ligands

	Phage recovery (%)	Enrichment (times)
Round 1	0.0043
Round 2	0.000061	0.0141
Round 3	0.0005	8.20

After the 3rd phage display panning round, eluted phages were used to infect E. coli TG1 cells, and phagemids from 67 cfu were purified and DNA sequenced. The complete list containing amino acid sequences is shown in Supplementary Table 1S, whereas the most frequent clones selected for Mpro are summarized in Supplementary Table 2S.

Despite the enrichment observed, the two most frequent sequences seemed unspecific. SQGQCI (SFTI 2) and QVNDRI (SFTI 3) also showed high frequencies in selections with other targets, such as Zika and Dengue virus proteases (unpublished data), suggesting that these phages were selected for other molecules. Thereafter, the focus of investigation using these molecules was centered on DQPGY (SFTI 4), which represented the third most frequent sequence and was selected exclusively for recombinant Mpro (Table 2). Nevertheless, monocyclic SFTI 4 peptide (20–300 µM) did not show inhibitory activity when monitored using the synthetic substrate Abz SAVLQ↓SGFRK(Dnp)NH2 (Supplementary Fig. 1S).

Table 2. Amino Acid Sequences of Mutant SFTI Phage Display Selected for Mpro

Sequence	Frequency (%)	Synthesized peptide number
#GRCTKSIPPICFPD	—	1
GRCTSQGQCICFPD	31.3%	2
GRCTQVNDRICFPD	19.4%	3
GRCTDQPGYICFSD	16.4%	4
GRCTLSAQLICFPD	10.4%	5
GRCTGWRQGICFPD	10.4%	6

The P1–P4′ amino acid position is indicated in red in SFTI wt. The 5 most frequent peptides are shown. ^# SFTI-wild type.

Inhibition of the Cleavage of Natural Proteins by SARS-CoV-2 Mpro in Vitro

Monocyclic SFTI peptides did not affect the proteolytic activity of Mpro using the fluorogenic substrate. Then, to find a natural substrate for Mpro, we analyzed the predicted proteolytic cleavage sites indicated by NetCorona webserver in recombinant proteins (Supplementary Table 3S). Proteins which presented score values >0.5 in NetCorona webserver were evaluated in in vitro assays as natural substrates for Mpro.

A putative cleavage site in bovine prothrombin for Mpro was predicted with a score of 0.542, but our experimental data did not confirm that. Nevertheless, the predicted cleavage site for human prothrombin presented a score of 0.682, and the protein cleaved by Mpro was confirmed under the tested conditions (Supplementary Fig. 2S). Based on the protein sequence, the human prothrombin cleaved by Mpro should generate two new protein bands, with molecular weights of approximately 70 and 15 kDa, as confirmed by SDS–PAGE (Supplementary Fig. 2S). Afterward, using human prothrombin as a substrate, we observed that monocyclic SFTI 4 peptide (300 µM) inhibited Mpro activity by decreasing the generation of cleaved products, while monocyclic SFTI 1 and 3 peptides did not show any inhibitory activity against human prothrombin processing (Fig. 2).

Fig. 2. Cleavage of Recombinant Proteins by Mpro

After cleavage reactions by Mpro at 37 °C for 3 h, reaction mixtures were analyzed by SDS–PAGE. Cleavage reaction of human prothrombin in the presence of monocyclic SFTI 1, SFTI 3 and SFTI 4 peptides at 50–300 µM. Mpro and uncleaved protein are shown by continuous and dashed lines, respectively, while asterisks indicate cleavage products. Densitometry of the 75 kDa prothrombin band was evaluated for different SFTI concentrations (Control without Mpro was determined as 100). Four micrograms of Mpro and human thrombin were used in each condition.

Binding Affinity and Inhibitory Profile of SFTI Mutants

The interactions between monocyclic SFTI peptides and Mpro were verified by surface plasmon resonance (SPR). Monocyclic SFTI 4 peptide, one of the most frequent peptides screened in the phage library, was chosen to perform this experiment and monocyclic SFTI 1 peptide (wt) was used as control. The results showed that monocyclic SFTI 1 (wt) did not bind to immobilized Mpro under these experimental conditions, while monocyclic SFTI 4 had fast binding affinity, but the complex was not stable (Fig. 3). The presented KD was 21.66 ± 6.66 µM, confirming the peptide and Mpro interaction.

Fig. 3. SPR Sensorgrams for the Binding of Monocyclic SFTI Peptides to Mpro at a Series of Increasing Concentrations (0.01–50 µM)

Monocyclic SFTI 4 peptide (green line) and monocyclic SFTI 1 peptide (red line). The plot shows the curve of monocyclic SFTI 4 peptide concentration values versus Rmax obtained from sensorgram. The curve was used to calculate the KD value for monocyclic SFTI 4 peptide by the binding equation of GraFit5 software.

Cytotoxicity Assay of Monocyclic SFTI Peptides in VERO Cells

The cytotoxicity levels of monocyclic SFTI 1, 3, and 4 peptides for VERO cells were estimated by MTT assay and caused a significant reduction in cells viability at concentrations of 10, and 1 µM for SFTI1 and SFTI4, respectively, while none of tested SFTI3 concentrations were able to cause a significative effect on cells (Supplementary Fig. 3S). Moreover, to evaluate the effect of monocyclic SFTI peptides on viral shedding, we performed a viral titration of SARS-CoV-2 wt in VERO CCL-81 cells. The monocyclic SFTI peptides concentration was based on 0.1 µM monocyclic SFTI 4, the concentration that did not impact cells viability, as showed by MTT assay. Results showed that 0.1 µM monocyclic SFTIs inhibited SARS-CoV-2 replication in VERO cells at 24 h time point, specially SFTI4, which showed an effect comparable (only 2 times higher) to 5 µM chloroquine (used as a control). At 48 h time point, monocyclic SFTIs 1 and 4 still presented significantly reduced viral replication in comparison to control group, but the values were around 10 times higher than observed in the group treated with chloroquine. Finally, at 72 h post-infection time point, none of the treatments significantly inhibited viral replication (Fig. 4).

Fig. 4. Antiviral Activity of Monocyclic SFTI 1, 3, and 4 Peptides at 0.1 µM Using a TCID50 Assay

The cytopathic effect of VERO cells infected with SARS-CoV-2 wt was evaluated at 24 (A), 48 (B), and 72 (C) hours after infection (h.p.i.). The positive control used was chloroquine at 5 µM. Data represented as mean ± standard deviation (S.D.). Statistical analysis comparing the treatment with SFTIs or chloroquine and control group (positive control for SARS-CoV-2 infected cells). ANOVA-Dunnett. * p ≤ 0.05; ** p ≤ 0.01; *** p ≤ 0.001; ns = not significant.

DISCUSSION

Since Mpro is an important protease for the SARS-CoV-2 replication cycle, specific inhibitors have therapeutic potential. In this work, we used a powerful biotechnological tool, phage display, to screen specific mutants of monocyclic SFTI for Mpro, which could be used as a potential therapeutic target.

The active recombinant Mpro was produced following a modified methodology further established by Zhang et al. and van de Plassche et al.,^35,36) resulting in satisfactory yields of pure and active enzyme for carrying out the experiments. K_m values were similar to those reported by other authors. For example, using the FRET-based substrate DABCYL-KTSAVLQSGFRKM-E(EDANS)–NH2, the K_m values observed were 16.4 ± 2 µM,⁴⁴⁾ 39 ± 0.8 µM⁴⁵⁾ and 28 ± 3.4 µM.⁴⁶⁾ Furthermore, SARS-CoV Mpro showed a K_m of 16 ± 3 µM using the same substrate (Abz-SAVLQSGFRK(Dnp)NH2)³⁷⁾_. Both synthetic substrates are based on the amino acid sequence corresponding to one of the 11 cleavage sites in the SARS-CoV-2 polyproteins by the Mpro enzyme, specifically, the cleavage site between the nsp4 and nsp5 proteins (N-terminal portion of the Mpro protein).⁴⁷⁾ The active Mpro in solution is a homodimer, and the dimer form seems to be highly active compared to the monomer form. This behavior has been extensively studied in silico studies^9,35,48) as is the case for Mpro from SARS-CoV.⁴⁹⁾

Mpro shows cleavage preference for substrates with a Gln residue at the P1 position.³⁶⁾ Inhibitors with a sequence similar to that of the substrate have been studied, presenting IC₅₀ values in the µM range.^7,8) The selected SFTI sequences in the phage display presented a high frequency of Gln residues in different positions from P1 to P4′.

The KD of monocyclic SFTI 4 peptide for Mpro was 21.66 ± 6.66 µM, data obtained by SPR. Despite having a binding affinity with Mpro, it is not stable in the complex. Monocyclic SFTI 4–Mpro interaction in the µM range are comparable to different molecules previously tested for Mpro, such as flavonoids, natural extracts, molecules from drug replacement, tannins and polyphenols,^50–54) suggesting that monocyclic SFTI 4 peptide may be a potential inhibitor.

Antibodies against Mpro have been detected in the blood, saliva and breast milk of patients with COVID-19,^55,56) indicating that the extravasation of the intracellular content to the extracellular space may occur during the infection. To identify possible human proteins as suitable substrates for Mpro, computational and omics (proteomics and N-terminomics) studies have been performed and revealed several proteins with different potential cleavage sites for Mpro.^57–61) Using one of these methodologies⁵⁷⁾ we found that human prothrombin could be a substrate for Mpro. Moreover, our results showed that monocyclic SFTI 4 peptide (GRCTDQPGYICFSD) inhibited the processing of this protein by Mpro, despite the negative results using the synthetic substrate FRET. One possible explanation for the difference in the Mpro inhibitory activity of monocyclic SFTI 4 peptide, depending on the substrate, could be a possible interaction with an allosteric site of the enzyme instead of its active site. In this case, monocyclic SFTI 4 peptide would only affect the Mpro activity for large substrates, which may present more intermolecular interactions than the peptide substrate. Computational docking studies were done, but the results did not clarify this question (data not shown). Corroborating our data, allosteric sites on the Mpro dimer have been identified as drug binding sites and these regions can modify the structure of the active site, leading to protease inhibition.⁶²⁾ To date, 6 allosteric sites with different levels of accessibility to drugs have been identified.^63–65) Some inhibitors for different allosteric sites in Mpro have already been identified, such as pelitinib, RS-102895, ifenprodil, PD-168568, tofogliflozin,^62,63) AT7519,⁶²⁾ GR04⁶⁵⁾ and niclosamide derivatives.⁶⁶⁾

A study that investigated the cellular penetration of peptides showed that SFTI wt was internalized in MCF-7 cells.⁶⁷⁾ Moreover, modified SFTI presented a half-life in human serum of 24 h.⁶⁸⁾ In addition, SFTI conjugates with fluorescent labels were efficiently internalized into living cancer (HeLa and MCF-7) or healthy cells (human fibroblasts).⁶⁹⁾ Therefore, monocyclic SFTI 4 peptide was used in VERO cell infection by SARS-CoV-2 assay, and our results suggested that monocyclic SFTI 4 peptide inhibited the viral infection within 24 and 48 h. At longer period of 72 h, the inhibition was not maintained, and one possible explanation is that the peptide may be digested by proteases from the host cell, according to what was observed by Sable et al.⁶⁸⁾ Although it was utilized high SFTI4 concentrations to inhibit Mpro proteolytic activity against prothrombin, the inhibitor concentration necessary to affect viral replication in VERO cells was significantly lower, probably because the Mpro concentration in cells during the viral infection should be considerably reduced in comparison to what was used on the enzymatic inhibition assay.

In conclusion, monocyclic SFTI 4 peptide, a small inhibitor selected from a mutant peptide phage display library, is an attractive molecule for genetic engineering since it could interact with Mpro from SARS-CoV-2. Structural conditions can be optimized by modeling to achieve energetically stable structures.⁷⁰⁾ Monocyclic SFTI 4 peptide is a potential target to be used in the peptidomimetics approach by adding a “warhead” chemical group in its structure, aiming to improve its inhibitory activity.

Acknowledgments

We are grateful to Jacilene Barbosa of Laboratório multiusuário 3—INFAR, UNIFESP for performing the DNA sequencing and Dr. Camila T. Nogueira for performing the first experiment of Mpro expression and purification.

Funding

This work was supported by Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP) (2012/03657-8, 2019/03779-5, 2020/05451-4, 2021/12804-3, 2020/02433-5, 2018/18257-1, 2018/15549-1, 2020/04923-0, 2021/14179-9), Conselho Nacional de Desenvolvimento Tecnológico (CNPq—302703/2017-9, 309551/2021-8), Coordenação de Aperfeiçoamento de Pessoal de Nível Superior and INCT–Entomologia Molecular.

Author Contributions

Conceived and designed the experiments: A.S. Tanaka, G.C. Ferreira, G. Palmisano, L.R. Fernandes, R.J.S. Torquato

Performed the experiments: G.C. Ferreira, V.M. Manzato, D.N. Okamoto, D.M. Santos, G.C.A. Costa, F.A.A. Silva, R.J.S. Torquato, M.A. Juliano

Contributed reagents/materials/analysis tools: G. Palmisano, M.A. Juliano, A.S. Tanaka

Drafting the article: G.C. Ferreira, A.S. Tanaka

Critical revision of the article: A.S. Tanaka, G.C.A. Costa, F.A.A. Silva, G. Palmisano

Conflict of Interest

The authors declare no conflict of interest.

Supplementary Materials

This article contains supplementary materials.

REFERENCES

• 1) WHO. COVID-19 weekly epidemiological update. World Health Organization, 124, 1-12 (2023).
• 2) Kadam SB, Sukhramani GS, Bishnoi P, Pable AA, Barvkar VT. SARS-CoV-2, the pandemic coronavirus: molecular and structural insights. J. Basic Microbiol., 61, 180–202 (2021).
• 3) Al-Horani RA, Kar S. Potential anti-SARS-CoV-2 therapeutics that target the post-entry stages of the viral life cycle: a comprehensive review. Viruses, 12, 1092 (2020).
• 4) Lu R, Zhao X, Li J, et al. Genomic characterisation and epidemiology of 2019 novel coronavirus: implications for virus origins and receptor binding. Lancet, 395, 565–574 (2020).
• 5) V’kovski P, Kratzel A, Steiner S, Stalder H, Thiel V. Coronavirus biology and replication: implications for SARS-CoV-2. Nat. Rev. Microbiol., 19, 155–170 (2021).
• 6) Arya R, Kumari S, Pandey B, Mistry H, Bihani SC, Das A, Prashar V, Gupta GD, Panicker L, Kumar M. Structural insights into SARS-CoV-2 proteins. J. Mol. Biol., 433, 166725 (2021).
• 7) Ullrich S, Sasi VM, Mahawaththa MC, Ekanayake KB, Morewood R, George J, Shuttleworth L, Zhang X, Whitefield C, Otting G, Jackson C, Nitsche C. Challenges of short substrate analogues as SARS-CoV-2 main protease inhibitors. Bioorg. Med. Chem. Lett., 50, 128333 (2021).
• 8) Kreutzer AG, Krumberger M, Diessner EM, Parrocha CMT, Morris MA, Guaglianone G, Butts CT, Nowick JS. A cyclic peptide inhibitor of the SARS-CoV-2 main protease. Eur. J. Med. Chem., 221, 113530 (2021).
• 9) Banerjee R, Perera L, Tillekeratne LMV. Potential SARS-CoV-2 main protease inhibitors. Drug Discov. Today, 26, 804–816 (2021).
• 10) Owen DR, Allerton CMN, Anderson AS, et al. An oral SARS-CoV-2 M^pro inhibitor clinical candidate for the treatment of COVID-19. Science, 374, 1586–1593 (2021).
• 11) Mahase E. Covid-19: Pfizer’s paxlovid is 89% effective in patients at risk of serious illness, company reports. BMJ, 375, n2713 (2021).
• 12) Yoshikawa H, Tomita T, Shigita E, Takamatsu H, Matsushima A, Yanagida T, Matsuo H. Evaluation of sources of drug interaction information for nirmatrelvir/ritonavir. Yakugaku Zasshi, 144, 733–740 (2024).
• 13) Tan B, Joyce R, Tan H, Hu Y, Wang J. SARS-CoV-2 main protease drug design, assay development, and drug resistance studies. Acc. Chem. Res., 56, 157–168 (2023).
• 14) Ghosh AK, Mishevich JL, Mesecar A, Mitsuya H. Recent drug development and medicinal chemistry approaches for the treatment of SARS-CoV-2 infection and COVID-19. ChemMedChem, 17, e202200440 (2022).
• 15) Unoh Y, Uehara S, Nakahara K, et al. Discovery of S-217622, a noncovalent oral SARS-CoV-2 3CL protease inhibitor clinical candidate for treating COVID-19. J. Med. Chem., 65, 6499–6512 (2022).
• 16) Mizuno A, Nakayoshi T, Kato K, Kurimoto E, Oda A. Computational estimation of residues involving resistance to the SARS-CoV-2 main protease inhibitor ensitrelvir based on virtual alanine scan of the active site. Biol. Pharm. Bull., 47, 967–977 (2024).
• 17) Tsuji K, Kobayakawa T, Ishii T, Higashi-Kuwata N, Azuma C, Shinohara K, Miura Y, Yamamoto K, Nishimura S, Hattori SI, Bulut H, Mitsuya H, Tamamura H. Exploratory studies of effective inhibitors against the SARS-CoV-2 main protease by halogen incorporation and amide bond replacement. Chem. Pharm. Bull., 71, 879–886 (2023).
• 18) Smith GP. Filamentous fusion phage: novel expression vectors that display cloned antigens on the virion surface. Science, 228, 1315–1317 (1985).
• 19) Smith GP, Petrenko VA. Phage display. Chem. Rev., 97, 391–410 (1997).
• 20) Tanaka AS, Silva MM, Torquato RJ, Noguti MA, Sampaio CA, Fritz H, Auerswald EA. Functional phage display of leech-derived tryptase inhibitor (LDTI): construction of a library and selection of thrombin inhibitors. FEBS Lett., 458, 11–16 (1999).
• 21) de Marco R, Azzolini SS, Lovato DV, Torquato RJ, Amino R, de Miranda A, Tanaka AS. Validation of phage display method for protease inhibitor selection using synthetic hybrid peptides. Comb. Chem. High Throughput Screen., 13, 829–835 (2010).
• 22) Zani ML, Moreau T. Phage display as a powerful tool to engineer protease inhibitors. Biochimie, 92, 1689–1704 (2010).
• 23) Wu CH, Liu IJ, Lu RM, Wu HC. Advancement and applications of peptide phage display technology in biomedical science. J. Biomed. Sci., 23, 8 (2016).
• 24) Chen S, Lovell S, Lee S, Fellner M, Mace PD, Bogyo M. Identification of highly selective covalent inhibitors by phage display. Nat. Biotechnol., 39, 490–498 (2021).
• 25) Al-Azzam S, Ding Y, Liu J, Pandya P, Ting JP, Afshar S. Peptides to combat viral infectious diseases. Peptides, 134, 170402 (2020).
• 26) Freire MCLC, Noske GD, Bitencourt NV, Sanches PRS, Santos-Filho NA, Gawriljuk VO, de Souza EP, Nogueira VHR, de Godoy MO, Nakamura AM, Fernandes RS, Godoy AS, Juliano MA, Peres BM, Barbosa CG, Moraes CB, Freitas-Junior LHG, Cilli EM, Guido RVC, Oliva G. Non-toxic dimeric peptides derived from the Bothropstoxin-I are potent SARS-CoV-2 and papain-like protease inhibitors. Molecules, 26, 4896 (2021).
• 27) Rut W, Groborz K, Zhang L, Sun X, Zmudzinski M, Pawlik B, Wang X, Jochmans D, Neyts J, Mlynarski W, Hilgenfeld R, Drag M. SARS-CoV-2 M^pro inhibitors and activity-based probes for patient-sample imaging. Nat. Chem. Biol., 17, 222–228 (2021).
• 28) Johansen-Leete J, Ullrich S, Fry SE, Frkic R, Bedding MJ, Aggarwal A, Ashhurst AS, Ekanayake KB, Mahawaththa MC, Sasi VM, Luedtke S, Ford DJ, O’Donoghue AJ, Passioura T, Larance M, Otting G, Turville S, Jackson CJ, Nitsche C, Payne RJ. Antiviral cyclic peptides targeting the main protease of SARS-CoV-2. Chem. Sci. (Camb.), 13, 3826–3836 (2022).
• 29) Luckett S, Garcia RS, Barker JJ, Konarev AV, Shewry PR, Clarke AR, Brady RL. High-resolution structure of a potent, cyclic proteinase inhibitor from sunflower seeds. J. Mol. Biol., 290, 525–533 (1999).
• 30) de Veer SJ, White AM, Craik DJ. Sunflower trypsin inhibitor-1 (SFTI-1): sowing seeds in the fields of chemistry and biology. Angew. Chem. Int. Ed., 60, 8050–8071 (2021).
• 31) Daly NL, Wilson DT. Plant derived cyclic peptides. Biochem. Soc. Trans., 49, 1279–1285 (2021).
• 32) de Veer SJ, Li CY, Swedberg JE, Schroeder CI, Craik DJ. Engineering potent mesotrypsin inhibitors based on the plant-derived cyclic peptide, sunflower trypsin inhibitor-1. Eur. J. Med. Chem., 155, 695–704 (2018).
• 33) Dahal A, Parajuli P, Singh SS, Shrestha L, Sonju JJ, Shrestha P, Chatzistamou I, Jois S. Targeting protein-protein interaction for immunomodulation: a sunflower trypsin inhibitor analog peptidomimetic suppresses RA progression in CIA model. J. Pharmacol. Sci., 149, 124–138 (2022).
• 34) Kocsis A, Kekesi KA, Szasz R, Vegh BM, Balczer J, Dobo J, Zavodszky P, Gal P, Pal G. Selective inhibition of the lectin pathway of complement with phage display selected peptides against mannose-binding lectin-associated serine protease (MASP)-1 and -2: significant contribution of MASP-1 to lectin pathway activation. J. Immunol., 185, 4169–4178 (2010).
• 35) Zhang L, Lin D, Sun X, Curth U, Drosten C, Sauerhering L, Becker S, Rox K, Hilgenfeld R. Crystal structure of SARS-CoV-2 main protease provides a basis for design of improved alpha-ketoamide inhibitors. Science, 368, 409–412 (2020).
• 36) van de Plassche MAT, Barniol-Xicota M, Verhelst SHL. Peptidyl acyloxymethyl ketones as activity-based probes for the main protease of SARS-CoV-2*. ChemBioChem, 21, 3383–3388 (2020).
• 37) Okamoto DN, Oliveira LC, Kondo MY, Cezari MH, Szeltner Z, Juhasz T, Juliano MA, Polgar L, Juliano L, Gouvea IE. Increase of SARS-CoV 3CL peptidase activity due to macromolecular crowding effects in the milieu composition. Biol. Chem., 391, 1461–1468 (2010).
• 38) Soares TS, Soares Torquato RJ, Alves Lemos FJ, Tanaka AS. Selective inhibitors of digestive enzymes from Aedes aegypti larvae identified by phage display. Insect Biochem. Mol. Biol., 43, 9–16 (2013).
• 39) Manzato VM, Torquato RJS, Lemos FJA, Nishiduka E, Tashima AK, Tanaka AS. A versatile inhibitor of digestive enzymes in Aedes aegypti larvae selected from a pacifastin (TiPI) phage display library. Biochem. Biophys. Res. Commun., 590, 139–144 (2022).
• 40) Hirata IYSC, Sedenho Cezari MH, Nakaie CR, Boschcov P, Ito AS, Juliano MA, Juliano L. Internally quenched fluorogenic protease substrates: solid-phase synthesis and fluorescence spectroscopy of peptides containing ortho-aminobenzoyl/dinitrophenyl groups as donor-acceptor pairs. Lett. Pept. Sci., 1, 299–308 (1995).
• 41) Kiemer L, Lund O, Brunak S, Blom N. Coronavirus 3CLpro proteinase cleavage sites: possible relevance to SARS virus pathology. BMC Bioinformatics, 5, 72 (2004).
• 42) Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature, 227, 680–685 (1970).
• 43) Schneider CA, Rasband WS, Eliceiri KW. NIH Image to ImageJ: 25 years of image analysis. Nat. Methods, 9, 671–675 (2012).
• 44) Noske GD, Nakamura AM, Gawriljuk VO, Fernandes RS, Lima GMA, Rosa HVD, Pereira HD, Zeri ACM, Nascimento AFZ, Freire M, Fearon D, Douangamath A, von Delft F, Oliva G, Godoy AS. A Crystallographic snapshot of SARS-CoV-2 main protease maturation process. J. Mol. Biol., 433, 167118 (2021).
• 45) Sun LY, Chen C, Su J, Li JQ, Jiang Z, Gao H, Chigan JZ, Ding HH, Zhai L, Yang KW. Ebsulfur and Ebselen as highly potent scaffolds for the development of potential SARS-CoV-2 antivirals. Bioorg. Chem., 112, 104889 (2021).
• 46) Ma C, Sacco MD, Hurst B, Townsend JA, Hu Y, Szeto T, Zhang X, Tarbet B, Marty MT, Chen Y, Wang J. Boceprevir, GC-376, and calpain inhibitors II, XII inhibit SARS-CoV-2 viral replication by targeting the viral main protease. Cell Res., 30, 678–692 (2020).
• 47) MacDonald EA, Frey G, Namchuk MN, Harrison SC, Hinshaw SM, Windsor IW. Recognition of divergent viral substrates by the SARS-CoV-2 main protease. ACS Infect. Dis., 7, 2591–2595 (2021).
• 48) Ferreira GM, Kronenberger T, Tonduru AK, Hirata RDC, Hirata MH, Poso A. SARS-COV-2 M^pro conformational changes induced by covalently bound ligands. J. Biomol. Struct. Dyn., 40, 12347–12357 (2022).
• 49) Grum-Tokars V, Ratia K, Begaye A, Baker SC, Mesecar AD. Evaluating the 3C-like protease activity of SARS-Coronavirus: recommendations for standardized assays for drug discovery. Virus Res., 133, 63–73 (2008).
• 50) Wang J, Zeng X, Yin D, Yin L, Shen X, Xu F, Dai Y, Pan X. In silico and in vitro evaluation of antiviral activity of wogonin against main protease of porcine epidemic diarrhea virus. Front. Cell. Infect. Microbiol., 13, 1123650 (2023).
• 51) Yan G, Li D, Lin Y, Fu Z, Qi H, Liu X, Zhang J, Si S, Chen Y. Development of a simple and miniaturized sandwich-like fluorescence polarization assay for rapid screening of SARS-CoV-2 main protease inhibitors. Cell Biosci., 11, 199 (2021).
• 52) Gupta A, Rani C, Pant P, Vijayan V, Vikram N, Kaur P, Singh TP, Sharma S, Sharma P. Structure-based virtual screening and biochemical validation to discover a potential inhibitor of the SARS-CoV-2 main protease. ACS Omega, 5, 33151–33161 (2020).
• 53) Li H, Xu F, Liu C, Cai A, Dain JA, Li D, Seeram NP, Cho BP, Ma H. Inhibitory effects and surface plasmon resonance-based binding affinities of dietary hydrolyzable tannins and their gut microbial metabolites on SARS-CoV-2 main protease. J. Agric. Food Chem., 69, 12197–12208 (2021).
• 54) Yang Z, Wang W, Qi Y, Yang Y, Chen CH, Liu JZ, Chu GX, Bao GH. Exploring new catechin derivatives as SARS-CoV-2 M^pro inhibitors from tea by molecular networking, surface plasma resonance, enzyme inhibition, induced fit docking, and metadynamics simulations. Comput. Biol. Med., 151 (Pt. A), 106288 (2022).
• 55) Martinez-Fleta P, Alfranca A, Gonzalez-Alvaro I, Casasnovas JM, Fernandez-Soto D, Esteso G, Caceres-Martell Y, Gardeta S, Lopez-Sanz C, Prat S, Mateu-Albero T, Gabrie L, Lopez-Granados E, Sanchez-Madrid F, Reyburn HT, Rodriguez Frade JM, Vales-Gomez M. SARS-CoV-2 cysteine-like protease antibodies can be detected in serum and saliva of COVID-19-Seropositive Individuals. J. Immunol., 205, 3130–3140 (2020).
• 56) Bauerl C, Randazzo W, Sanchez G, Selma-Royo M, Garcia Verdevio E, Martinez L, Parra-Llorca A, Lerin C, Fumado V, Crovetto F, Crispi F, Perez-Cano FJ, Rodriguez G, Ruiz-Redondo G, Campoy C, Martinez-Costa C, Collado MC. SARS-CoV-2 RNA and antibody detection in breast milk from a prospective multicentre study in Spain. Arch. Dis. Child. Fetal Neonatal Ed., 107, 216–221 (2022).
• 57) Miczi M, Golda M, Kunkli B, Nagy T, Tozser J, Motyan JA. Identification of host cellular protein substrates of SARS-COV-2 main protease. Int. J. Mol. Sci., 21, 9523 (2020).
• 58) Koudelka T, Boger J, Henkel A, Schonherr R, Krantz S, Fuchs S, Rodriguez E, Redecke L, Tholey A. N-terminomics for the identification of in vitro substrates and cleavage site specificity of the SARS-CoV-2 main protease. Proteomics, 21, 2000246 (2021).
• 59) Meyer B, Chiaravalli J, Gellenoncourt S, Brownridge P, Bryne DP, Daly LA, Grauslys A, Walter M, Agou F, Chakrabarti LA, Craik CS, Eyers CE, Eyers PA, Gambin Y, Jones AR, Sierecki E, Verdin E, Vignuzzi M, Emmott E. Characterising proteolysis during SARS-CoV-2 infection identifies viral cleavage sites and cellular targets with therapeutic potential. Nat. Commun., 12, 5553 (2021).
• 60) Pablos I, Machado Y, de Jesus HCR, et al. Mechanistic insights into COVID-19 by global analysis of the SARS-CoV-2 3CL^pro substrate degradome. Cell Rep., 37, 109892 (2021).
• 61) Miltner N, Kallo G, Csosz E, Miczi M, Nagy T, Mahdi M, Motyan JA, Tozser J. Identification of SARS-CoV-2 main protease (Mpro) cleavage sites using two-dimensional electrophoresis and in silico cleavage site prediction. Int. J. Mol. Sci., 24, 3236 (2023).
• 62) Gunther S, Reinke PYA, Fernandez-Garcia Y, et al. X-ray screening identifies active site and allosteric inhibitors of SARS-CoV-2 main protease. Science, 372, 642–646 (2021).
• 63) Alzyoud L, Ghattas MA, Atatreh N. Allosteric binding sites of the SARS-CoV-2 main protease: potential targets for broad-spectrum anti-coronavirus agents. Drug Des. Devel. Ther., 16, 2463–2478 (2022).
• 64) Douangamath A, Fearon D, Gehrtz P, et al. Crystallographic and electrophilic fragment screening of the SARS-CoV-2 main protease. Nat. Commun., 11, 5047 (2020).
• 65) Mahgoub RE, Mohamed FE, Alzyoud L, Ali BR, Ferreira J, Rabeh WM, AlNeyadi SS, Atatreh N, Ghattas MA. The discovery of small allosteric and active site inhibitors of the SARS-CoV-2 main protease via structure-based virtual screening and biological evaluation. Molecules, 27, 6710 (2022).
• 66) Samrat SK, Xu J, Xie X, Gianti E, Chen H, Zou J, Pattis JG, Elokely K, Lee H, Li Z, Klein ML, Shi PY, Zhou J, Li H. Allosteric inhibitors of the main protease of SARS-CoV-2. Antiviral Res., 205, 105381 (2022).
• 67) Cascales L, Henriques ST, Kerr MC, Huang YH, Sweet MJ, Daly NL, Craik DJ. Identification and characterization of a new family of cell-penetrating peptides: cyclic cell-penetrating peptides. J. Biol. Chem., 286, 36932–36943 (2011).
• 68) Sable R, Durek T, Taneja V, Craik DJ, Pallerla S, Gauthier T, Jois S. Constrained cyclic peptides as immunomodulatory inhibitors of the CD2:CD58 protein-protein interaction. ACS Chem. Biol., 11, 2366–2374 (2016).
• 69) Lesner A, Karna N, Psurski M, Legowska A, Wysocka M, Guzow K, Sieradzan A, Sienczyk M, Trzonkowski P, Pikula M, Zielinski M, Kosikowska P, Lukajtis R, Legowska M, Debowski D, Wiczk W, Rolka K. Fluorescent analogs of trypsin inhibitor SFTI-1 isolated from sunflower seeds—synthesis and applications. Biopolymers, 102, 124–135 (2014).
• 70) Seki Y, Watanabe C, Tani N, Kamisaka K, Ohyama T, Takaya D, Honma T. Structural stability and binding ability of SARS-CoV-2 main protease with GC376: a stereoisomeric covalent ligand analysis by FMO calculation. Chem-Bio Informatics Journal, 24, 13–24 (2024).