Royal Jelly Maintains Epidermal Stem Cell Properties by Repressing Senescence

Abstract

Royal jelly (RJ), a natural product secreted by honeybees, is widely used in topical skincare products to help maintain cutaneous homeostasis. Despite its popularity, the mechanism through which RJ exerts its effects on the skin has not been fully elucidated. This study aimed to explore the impact of RJ on the proliferative ability and senescence of human primary epidermal keratinocytes (HPEKs). Our data suggested that epidermal equivalents became thicker with more p63-expressing proliferative cells upon RJ addition to the culture medium. In a two-dimensional culture system, we evaluated the effect of RJ on the proliferation of HPEKs and observed only a slight increase in cell proliferation. This suggests that RJ does not significantly enhance the proliferation of HPEKs in the short term. However, long-term culture experiments demonstrated enhanced population doubling in the RJ-treated group, indicating that RJ inhibits senescence. RJ was found to suppress cellular senescence by modulating the expression levels of ΔNp63, p16, and p21. These results were further supported by the identification of major fatty acids, such as 10-hydroxy-2-decenoic acid, in RJ. Our findings indicate that RJ can maintain epidermal stem cell properties by repressing cellular senescence, providing insights into its mechanism of action in skincare applications.

INTRODUCTION

Epidermis is the outermost layer of the skin that plays a crucial role in protecting the body from various environmental stresses. It also has social significance because of its visibility. Hence, the condition of the epidermis has a significant impact on the QOL in both physiological and psychological aspects.

Epidermis is divided into four layers based on the position and morphology: basal, spinous, granular, and cornified.¹⁾ Epidermal stem/progenitor cells reside in the basal layer of the epidermis, where they proliferate and generate committed cells that undergo terminal differentiation during skin development and homeostasis. Transcription factor p63 is one of the primary regulators of proliferation within the basal layer of the epidermis²⁾ as well as a regulator of epidermal senescence.^3,4) The p63 gene, TP63, expresses two major isoforms, TAp63 and ΔNp63, produced through alternative promoter usage. While TAp63 includes a full-length N-terminal transactivation domain, ΔNp63 is transcribed from an alternative promoter, resulting in a unique N-terminal sequence.^5–7) ΔNp63 is the main isoform detected in the basal layers, which regulates the proliferation and inhibits the differentiation of keratinocytes, thereby contributing to the maintenance of keratinocyte stemness.²⁾ ΔNp63 also blocks keratinocyte senescence by inhibiting the p16^ink4a/p19^arf pathways in vitro,⁸⁾ and the conditional knockout of p63 in mice accelerates premature aging in vivo.³⁾

Royal jelly (RJ) is a yellowish-white, gel-texture substance secreted from the hypopharyngeal and mandibular glands of honeybees (Apis mellifera) that is an essential nutrient for queen bees. Owing to its high nutritional value, RJ is widely used in drugs, food, and cosmetics in many countries.⁹⁾ The chemical composition of RJ is 60–70% water, 9–18% proteins, 7.5–23% sugars, 3–8% lipids, and 1.5% other compounds, such as minerals and vitamins.¹⁰⁾ Trans-10-hydroxy-2-decenoic acid (10H2DA) and 10-hydroxydecanoic acid (10HDAA) are the two major unique medium-chain fatty acids in RJ that account for 60–80% of RJ lipids. When these fatty acids are incorporated into the body, they are metabolized and converted to 2-decenedioic acid (2DA) and sebacic acid (SA).¹⁰⁾

RJ exerts various biological effects, including antibacterial,¹¹⁾ anti-inflammatory,¹²⁾ antioxidant,¹³⁾ estrogen-like,¹⁴⁾ and anti-aging¹⁵⁾ effects, with minimal side effects. Protease-treated RJ (pRJ), an allergen-free form of RJ whose proteins have been converted to amino acids and peptides, has also been developed and reported to have additional benefits compared to non-protease-treated RJ (nRJ).^12,16) Owing to its positive properties, RJ is widely used in topical application medicines and cosmetics, such as ointments used in the treatment of various dermatoses, and moisturizing creams and lotions.¹⁷⁾ Although its mechanism of action remains unclear, recent studies have revealed more precise effects of RJ on the epidermis. Duplan et al. revealed that 10H2DA activates keratinocyte differentiation, restores skin barrier function, and reduces inflammation, resulting in moisturization of the epidermis.¹⁸⁾ Our previous report also indicated that RJ induces nicotinamide adenine dinucleotide (NAD)(P)H quinone oxidoreductase 1 (NQO1) expression, thus protecting the epidermis from oxidative stress.¹³⁾ However, the effect of RJ on the maintenance of epidermal homeostasis has not yet been fully elucidated.

In this study, we investigated the effect of RJ on the maintenance of epidermal homeostasis and the underlying mechanism. Our results show that RJ can maintain epidermal stem cell properties by repressing keratinocyte senescence. RJ and RJ-related fatty acids improved the establishment of a human epidermal equivalent model. Furthermore, we found that RJ repressed the replicative senescence of keratinocytes via upregulation of ΔNp63 and downregulation of p16 and p21 expression levels. These findings are important given the extensive use of RJ products in the cosmetic industry.

MATERIALS AND METHODS

Reagents

Lyophilized nRJ (lot number: YDP-M-200225) and pRJ (lot number: YRP-M-210728) were prepared by Yamada Bee Company Inc. (Okayama, Japan). RJ was standardized with specific amounts of fatty acids 10H2DA and 10HDAA: nRJ contained a minimum of 3.8% 10H2DA and 0.6% 10HDAA, while pRJ contained a minimum of 3.5% 10H2DA and 0.6% 10HDAA. The fatty acid 10H2DA was purchased from Hangzhou Eastbiopharm Co., Ltd. (Hangzhou, China), while 10HDAA was purchased from Combi-Blocks, Inc. (San Diego, CA, U.S.A.). Moreover, 2DA was purchased from Sundia MediTech Co., Ltd. (Shanghai, China) and SA was purchased from Sigma-Aldrich Co. LLC. (St. Louis, MO, U.S.A.).

Cell Culture

Human primary epidermal keratinocytes (HPEKs) were purchased from CELLnTEC (Bern, Switzerland) and maintained in CnT-Prime epithelial proliferation medium (CELLnTEC), according to the manufacturer’s protocol. Human epidermal equivalents were generated using CnT-Prime 3D Airlift Medium (CELLnTEC), as previously described.¹⁹⁾

Histology and Immunofluorescent Analysis

Skin equivalents were fixed in 4% paraformaldehyde, embedded in an optimal cutting temperature compound, frozen, and sectioned at 10 µm thickness. Sections were then subjected to either hematoxylin–eosin (H&E) staining or immunohistochemical analysis as previously described.²⁰⁾ The following were used as primary antibodies: rabbit polyclonal antibody against Ki67 (1/250; NOVUS Biological, Littleton, CO, U.S.A.), rabbit polyclonal antibody against p63 (1/200; Santa Cruz, Dallas, TX, U.S.A.), and chick polyclonal antibody against keratin 14 (1/1000; BioLegend, San Diego, CA, U.S.A.). Staining was performed using specific secondary antibodies conjugated to Alexa Fluor 488, Alexa Fluor 546, or Cy3 (1/1000). Following the final washing step, the slides were mounted with coverslips using ProLong Gold Antifade Mountant with 4,6-diamino-2-phenylindole (Thermo Fisher Scientific, Waltham, MA, U.S.A.). Light microscopy images were obtained using a microscope (BZ-9000; Keyence, Osaka, Japan). Fluorescence microscopy images were obtained using a confocal microscope (LSM 800, Carl Zeiss, Oberkochen, Germany).

Cell Viability Assay

HPEKs were seeded into a 96-well plate and incubated for 24 h in a 5% CO₂ incubator. The cells were treated with nRJ or pRJ for 48 h. The cell viability assay was performed using Cell Counting Reagent SF (Nacalai Tesque, Kyoto, Japan), according to the manufacturer’s protocol. The absorbance of the resultant formazan was measured at 450 nm using a Nivo microplate reader (PerkinElmer, Inc., Waltham, MA, U.S.A.).

5-Ethynyl-2-deoxyuridine (EdU) Proliferation Assay

HPEKs were seeded in a 35 mm dish at a density of 5 × 10³ cells/cm² and incubated for 24 h in a 5% CO₂ incubator. HPEKs were then treated with nRJ or pRJ for 48 h. After treatment, EdU labeling and detection were performed using the Click-iT EdU Alexa Fluor 488 Flow Cytometry Assay Kit (Thermo Fisher Scientific), according to the manufacturer's instructions. The cells were analyzed using flow cytometry (ec800 cell analyzer; SONY, Tokyo, Japan). FlowJo 10 software (Tree Star Inc., Ashland, OR, U.S.A.) was used for quantitative analysis.

Calculation of Population Doubling Level (PDL)

PDL was calculated by the following equations.

  

• N = Total number of cells harvested; N0 = Initial number of cells seeded.

To yield the cumulated doubling level, the population doubling for each passage was calculated and then added to the population doubling levels of the previous passages.

Senescence-Associated β-Galactosidase Staining

Cells were fixed with 2% paraformaldehyde/0.2% glutaradehyde for 5 min at room temperature and then washed 2 times with phosphate-buffered saline (PBS). The cells were then incubated overnight at 37 °C with fresh senescence-associated β-galactosidase (SA-β-Gal) chromogenic substrate solution (1 mg/mL Bluo-gal (Life Technologies), 40 mM citric acid (pH 6.0), 5 mM potassium ferrocyanide, 5 mM potassium ferricyanide, 150 mM NaCl, and 2 mM MgCl₂). To assess senescence induced by UVB irradiation, HPEKs were exposed to UVB radiation at a dose of 5 mJ/cm². Cells were then incubated for 72 h post-irradiation to allow senescence development. Following this, SA-β-gal activity was measured using the Cellular Senescence Detection Kit-SPiDER-β-gal (Dojindo Laboratories, Kumamoto, Japan) according to the manufacturer’s instructions. Briefly, cells were treated with Bafilomycin A1 for 1 h to inhibit endogenous β-galactosidase activity, reducing background noise. Cells were then incubated with the SPiDER-β-gal reagent for 30 min, followed by SYTOX Blue staining for dead cell removal. Fluorescence intensity was measured using an EC800 flow cytometer (SONY, Tokyo, Japan).

RNA Extraction, cDNA Generation, and Quantitative PCR (qPCR)

HPEKs were seeded into a 12-well plate and incubated for 24 h in a 5% CO₂ incubator. HPEKs were then treated with nRJ or pRJ for 72 h. Total RNA was extracted using an RNeasy Mini Kit (Qiagen, Hilden, Germany), according to the manufacturer’s instructions. cDNA was generated from 1 µg of total RNA using a Verso cDNA Synthesis Kit (Thermo Scientific) and purified using a MinElute PCR Purification Kit (Qiagen). qPCR analysis was conducted using THUNDERBIRD Next SYBR qPCR Mix (TOYOBO, Osaka, Japan), according to the manufacturer’s protocols. The relative expression value of each gene was calculated using the ΔΔCt method, and the most reliable internal control gene was determined using the geNorm software (Biogazelle, Zwijnaarde, Belgium). All primers used in this study are listed in Table 1.

Table 1. qPCR Primers Used in This Study

Gene		Primer sequence (5′→3′)
ΔNp63	F	ATGTTGTACCTGGAAAACAATGC
	R	CTGGAAGGACACGTCGAAACTGTG
CDKN1A	F	GTCACTGTCTTGTACCCTTGTG
	R	CGGCGTTTGGAGTGGTAGAAA
CDKN2A	F	AGCCTTCGGCTGACTGGCTGG
	R	CTGCCCATCATCATGACCTGGA
ACTB	F	CATGTACGTTGCTATCCAGGC
	R	CTCCTTAATGTCACGCACGAT
B2M	F	TATCCAGCGTACTCCAAAGA
	R	GACAAGTCTGAATGCTCCAC
GAPDH	F	CATGAGAAGTATGACAACAGCCT
	R	AGTCCTTCCACGATACCAAAGT
GUS	F	CACCAGGGACCATCCAATACC
	R	GGTTACTGCCCTTGACAGAGA
HPRT	F	ATTGTAATGACCAGTCAACAGGG
	R	GCATTGTTTTGCCAGTGTCAA
RN18S	F	ATCCATTGGAGGGCAAGTC
	R	GCTCCCAAGATCCAACTACG
UBE2D2	F	TGGCAAGCTACAATAATGGGG
	R	GGAGACCACTGTGATCGTAGA
UBE4A	F	GTACTTGGGATTTCACAGGTTGC
	R	GGCTAGAACTTTGCTGAGCATC

Western Blotting Analysis

HPEKs were seeded into a 6-well plate and incubated for 24 h in a 5% CO₂ incubator. HPEKs were then treated with nRJ or pRJ for 72 h. Cells were lysed with lysis buffer (20 mM Tris–HCl [pH 8.0], 1% sodium dodecyl sulfate (SDS), and 1 mM dithiothreitol (DTT)). Blots were probed with mouse monoclonal antibodies against p63 (clone 4A4) (Abcam, Cambridge, U.K.; ab735) and actin (clone C4) (Merck-Millipore, Billerica, MA, U.S.A.; MAB1501). Horseradish peroxidase (HRP)-conjugated anti-mouse immunoglobulin G (IgG) secondary antibody (Cell Signaling Technology; #7076) was used as a probe, and immunoreactive bands were visualized using the Immobilon Western Chemiluminescent HRP substrate (Merck-Millipore). Band intensity was measured using the ImageJ 1.49 software (National Institutes of Health, Bethesda, MD, U.S.A.).

Statistical Analysis

Statistical differences were determined using one-way ANOVA followed by Dunnett’s test using the GraphPad Prism 9 software (GraphPad Software, La Jolla, CA, U.S.A.). A value of p < 0.05 was considered to be statistically significant (**** p < 0.0001, *** p < 0.001, ** p < 0.01, * p < 0.05).

RESULTS

RJ Is Beneficial for Epidermal Development

To evaluate the effects of RJ on epidermal development, a human epidermal equivalent model was constructed in a culture medium containing RJ. In this study, lyophilized raw nRJ and pRJ, whose proteins were hydrolyzed using proteases, were used. As shown in Figs. 1A and B, H&E staining revealed that the thickness of the epidermis was significantly enhanced in the human epidermal equivalent model treated with nRJ or pRJ. In the epidermis, basal layer cells (the lowest cell layer) actively divide and migrate upward to form the spinous cells, which are large polygonal cells. Therefore, actively proliferating basal cells give rise to more spinous cells, resulting in the cells appearing more rounded (polygonal) instead of flattened. These results suggest that RJ has the ability to promote proliferation and induce differentiation of basal cells, resulting in a healthier cell shape of the epithelial tissue. Ki-67 is a cell proliferation marker and p63 is an important molecule for the maintenance of keratinocyte proliferative activity. We found that the number of p63- and Ki-67-positive cells was significantly increased in nRJ- or pRJ-treated epidermal skin equivalents (Fig. 1C), indicating that the proliferation of undifferentiated basal cells was promoted by the addition of RJ. These data suggest that RJ application facilitates epidermal development by improving the epidermal stem cell properties.

Fig. 1. Effect of Royal Jelly (RJ) on the Construction of the Human Epidermal Equivalent Model

(A–C) Human epidermal equivalent model was developed for 14 d supplemented with non-protease-treated RJ (nRJ) or protease-treated RJ (pRJ). (A) Hematoxylin and eosin staining was performed. White double arrow lines indicate the distance from the basal layer to granular layer. Scale bar, 50 µm. (B) Box plots represent the thickness of the epidermis (from basal layer to granular layer) of the skin equivalent in micrometers from three independent experiments. Thickness was measured in at least 20 representative fields of view per independent experiment. Data points are shown, with the box indicating the interquartile range, the line within the box representing the median, and the whiskers extending to the minimum and maximum values. (C) Immunohistochemical staining against Ki67 (green), p63 (red), and keratin 14 (orange) was performed. Blue signals indicate nuclear staining (4,6-diamino-2-phenylindole, DAPI). Scale bar, 20 µm. Graphs represent the mean ± standard error of the mean (S.E.M.) values for the number of p63- or Ki67-positive cells per field of the skin equivalent from three independent experiments. The positive cells were counted in at least three representative fields of view per independent experiment. One-way ANOVA followed by Dunnett’s test was used to determine statistical significance. **** p < 0.0001, *** p < 0.001, * p < 0.05.

RJ Has No Immediate Effect on Keratinocyte Proliferation

Next, we evaluated the effects of RJ on cell proliferation in a two-dimensional culture of HPEKs. Water-soluble tetrazolium salt (WST)-8 assay revealed that the number of living cells was slightly increased (approximately 1.1-fold and 1.4-fold in 10 µg/mL nRJ- and 100 µg/mL pRJ-treated cells and 10 µg/mL pRJ-treated cells, respectively) when treated with nRJ or pRJ (Fig. 2A); however, no significant difference was observed. To directly evaluate the rate of DNA synthesis in HPEKs, nuclear incorporation of EdU was also examined. As shown in Fig. 2B, an approximate 1.1-fold increase in EdU intake was observed in RJ-treated cells. These data suggest that RJ is not actively involved in the promotion of cell proliferation.

Fig. 2. Effect of RJ on the Proliferation of Human Primary Epidermal Keratinocytes (HPEKs)

(A) HPEKs were treated with nRJ or pRJ (10 or 100 µg/mL) for 48 h and subjected to the cell viability assay. Graphs indicate the mean ± S.E.M. values (fold increase over control) from eight independent experiments. (B) HPEKs were treated with nRJ or pRJ (10 or 100 µg/mL) for 48 h and subjected to the 5-ethynyl-2-deoxyuridine (EdU) incorporation assay. Graphs indicate the mean ± S.E.M. values for percentage of EdU-positive cells from five independent experiments. One-way ANOVA followed by Dunnett’s test was used to determine statistical significance.

RJ Suppresses the Replicative Senescence of Keratinocytes

Cellular senescence is one possible reason for reduced stem cell function. Therefore, we attempted to measure the population doubling level of HPEKs by culturing them for a long time. Control HPEKs reached their limit of cell proliferation at the earliest. In contrast, both nRJ and pRJ treatments increased the proliferative capacity of HPEKs (Fig. 3A). In addition, control HPEKs at day 42 showed characteristics typical of senescence, that is, large and flat cell morphology, whereas RJ-treated HPEKs still showed small and cobblestone-like morphology (Fig. 3B). To further investigate this phenomenon, cellular senescence was measured by staining for senescence-associated β-galactosidase (SA-β-Gal), which revealed that SA-β-Gal activity was increased only in control HPEKs (Fig. 3C). These data indicate that RJ suppresses senescence, thereby aiding in the maintenance of the stem cell properties of HPEKs.

Fig. 3. Effect of RJ on the Replicative Senescence of HPEKs

(A) Cumulative population doubling level (CPDL) of HPEKs was measured. The assay was discontinued when PDL values dropped below 0.5. The horizontal dotted line indicates the cessation of cell proliferation. No further significant proliferation was observed beyond this point. One representative experiment out of the three experiments performed is shown. (B) Representative phase-contrast cell images at day 48. Scale bar, 100 µm. (C) Representative images of SA-β-gal staining at day 42. Scale bar, 200 µm.

RJ Upregulates ΔNp63 and Suppresses p16 and p21 Expression Levels in Keratinocytes

Next, we evaluated the expression levels of ΔNp63 and several cellular senescence markers to understand the mechanism by which RJ suppresses senescence in HPEKs. Given that ΔNP63 is transcribed from an alternative promoter and possesses a unique N-terminus,⁷⁾ we designed primer pairs specific for the sequence encoding ΔNp63 isoforms to distinguish its expression from that of TAp63. qPCR analysis revealed that RJ significantly increased the expression of ΔNp63 (Fig. 4A). Western blotting analysis also revealed a significant increase in ΔNp63α protein expression in RJ-treated HPEKs (Fig. 4B). Furthermore, we found that the mRNA expression levels of cyclin-dependent kinase inhibitor 1A (CDKN1A; p21) and CDKN2A (p16) in HPEKs were significantly repressed by both nRJ and pRJ treatment (Fig. 4C). These data suggest that RJ suppresses cellular senescence by regulating ΔNp63, p16, and p21 expression levels.

Fig. 4. Effect of RJ on the Expression Levels of Epidermal Stem Cell and Senescence Markers

(A–C) HPEKs were treated with nRJ or pRJ (10 or 100 µg/mL) for 72 h and subjected to quantitative polymerase chain reaction (qPCR) analysis (A, C) or Western blotting analysis (B). (A) Gene expression levels of ΔNp63 were quantified via qPCR analysis. Graph indicates the mean ± S.E.M. values for the relative expression from six independent experiments. (B) Extracted proteins were immunoblotted with the p63 antibody. Graphs indicate the relative band intensities as determined using the ImageJ software and plotted as the mean of five independent experiments. (C) Gene expression levels of cyclin-dependent kinase inhibitor 1A (CDKN1A) and CDKN2A were quantified via qPCR analysis. Graphs indicate the mean ± S.E.M. values for the relative expression from six independent experiments. One-way ANOVA followed by Dunnett’s test was used to determine statistical significance. *** p < 0.001, ** p < 0.01, * p < 0.05.

RJ-Related Fatty Acids are Beneficial for Epidermal Development

Next, we identified the specific factors in RJ that are responsible for its beneficial effects on HPEKs. Our results revealed that pRJ, a protease-hydrolyzed RJ, is involved in suppressing keratinocyte senescence and regulating the gene expression of ΔNp63, p16, and p21 at levels similar to that maintained by nRJ (Figs. 1–4), indicating that the protein components in RJ do not contribute to these effects. Therefore, we investigated the effects of 10H2DA and 10HDAA, which are medium-chain fatty acids characteristic of RJ, and their metabolites, 2DA and SA,¹⁰⁾ on the development of epidermal equivalents. Each fatty acid was added at a concentration of 80 µM. As shown in Figs. 5A and B, the addition of 10H2DA, 10HDAA, 2DA, and SA resulted in significant epidermal thickening in the human epidermal equivalent model. Moreover, 10H2DA was found to be the most effective fatty acid (Fig. 5B). We also found that the number of p63- and Ki-67-positive cells was significantly increased in fatty acid-treated epidermal equivalents (Fig. 5C), similar to that in the RJ-treated equivalents (Fig. 1C). Senescence was induced in HPEKs by UVB exposure (5 mJ/cm²), and SA-β-Gal activity was measured to confirm senescence. Compared to the non-irradiated control, UVB-irradiated HPEKs exhibited a significant increase in SA-β-Gal activity, indicating successful senescence induction. In contrast, HPEKs treated with nRJ, pRJ, or fatty acids (10H2DA, 10HDA, 2DA, SA) showed a suppression of the UVB-induced increase in SA-β-Gal activity (Fig. 5D), suggesting that fatty acids, similarly to RJ, inhibit cellular senescence. Furthermore, qPCR analysis revealed that the expression of ΔNP63 was significantly upregulated in the presence of any of the fatty acids (Fig. 5E), while the expression levels of CDKN1A (p21) and CDKN2A (p16) were downregulated (Fig. 5F). These data suggest that fatty acids, similarly to RJ, suppresses cellular senescence by regulating ΔNp63, p16, and p21 expression levels.

Fig. 5. Effects of the Fatty Acids in RJ on the Development of the Human Epidermal Equivalent Model

(A–C) Human epidermal equivalent model was developed for 14 d supplemented with trans-10-hydroxy-2-decenoic acid (10H2DA), 10-hydroxydecanoic acid (10HDAA), 2-decenedioic acid (2DA), or sebacic acid (SA). (A) Hematoxylin and eosin staining was performed. White double arrow lines indicate the distance from the basal layer to granular layer. Scale bar, 50 µm. (B) Box plots represent the thickness of the epidermis (from basal layer to granular layer) of the skin equivalent in micrometers from three independent experiments. Thickness was measured in at least 20 representative fields of view per independent experiment. Data points are shown, with the box indicating the interquartile range, the line within the box representing the median, and the whiskers extending to the minimum and maximum values. (C) Immunohistochemical staining against Ki67 (green), p63 (red), and keratin 14 (orange) was performed. Blue signals indicate nuclear staining (DAPI). Scale bar, 20 µm. Graphs represent the mean ± S.E.M. values for the number of p63- or Ki67-positive cells per field of the skin equivalent from three independent experiments. Positive cells were counted in at least three representative fields of view per independent experiment. (D) HPEKs were treated with nRJ or pRJ at concentrations of 10 or 100 µg/mL, or with the fatty acids 10H2DA, 10HDA, 2DA, and SA at 20 µM. After 24 h of treatment, cells were exposed to UVB radiation (5 mJ/cm²) and cultured for an additional 72 h. Cellular senescence was assessed using SA-β-Gal staining via the Spider-β-Gal, followed by flow cytometry analysis. The median fluorescent intensity (MFI) was calculated and presented as mean ± S.E.M. from six independent experiments. (E, F) HPEKs were treated with 10H2DA, 10HDA, 2DA, or pRJ (20 µM) for 72 h and subjected to quantitative polymerase chain reaction (qPCR) analysis. (E) Gene expression levels of ΔNp63 were quantified via qPCR analysis. Graph indicates the mean ± S.E.M. values for the relative expression from six independent experiments. (F) Gene expression levels of cyclin-dependent kinase inhibitor 1A (CDKN1A) and CDKN2A were quantified via qPCR analysis. Graphs indicate the mean ± S.E.M. values for the relative expression from five independent experiments. One-way ANOVA followed by Dunnett’s test was used to determine statistical significance. **** p < 0.0001, *** p < 0.001, ** p < 0.01, * p < 0.05.

DISCUSSION

RJ is widely used in traditional medicine and cosmetics; however, its effects on epidermal keratinocytes have not yet been elucidated. In the present study, we used molecular and cellular approaches to generate scientific data on the effects of RJ on epidermal keratinocytes. Our results indicate that RJ may exert beneficial effects on the maintenance of epidermal stem cell properties by suppressing senescence. We found that RJ and RJ-related fatty acids significantly thickened the human epidermal equivalent (Figs. 1, 5). Moreover, the beneficial effect was not due to enhanced HPEK proliferation by RJ (Fig. 2), but due to the suppression of replicative senescence of HPEKs (Fig. 3).

RJ exerts anti-aging effects in various species.^21,22) Senescence is caused by various stresses, such as the accumulation of reactive oxygen species, damage to telomeres, activation of oncogenes, and dysfunction of mitochondria. The main characteristic of senescence can be defined as a stable growth arrest, which is implemented by the activation of p16^INK4a and p53/p21^CIP1 tumor suppressor networks.²³⁾ In this study, we found that RJ and RJ-related fatty acids suppressed cellular senescence by inhibiting CDKN1A (p21) and CDKN2A (p16) expression levels in HPEKs (Figs. 3–5). Although the mechanism by which RJ contributes to the inhibition of these genes could not be determined in the present study, it is possible that the antioxidant activity of RJ contributes to the repression of p21 and p16 expression. We previously reported that RJ induced the expression of NQO1 and protected the skin against oxidative stress.¹³⁾ However, as these effects were attributed solely to 10H2DA rather than 10HDAA, the antioxidant effect of elevated NQO1 expression does not seem to be the main reason for the inhibition of p16 and p21 expression levels by RJ treatment, although it may have a little effect on the present results. Another possible mechanism by which RJ suppresses p16 and p21 expression is the upregulation of ΔNp63 expression (Figs. 1, 4). p63 is a transcription factor that belongs to the p53 gene family. The N-terminal truncated p63 isoform, ΔNp63α, is the main isoform detected in the basal layer and has the ability to directly bind to the p16, p19, and p21 promoters to repress their expression and prevent cellular senescence.^8,24,25) LeBoeuf et al. also indicated that histone deacetylase-1/2 together with ΔNp63 is required for the suppression of p21 and p16 in undifferentiated keratinocytes.²⁶⁾ However, further experiments are required to determine whether the increase in ΔNp63 expression induced by RJ and RJ-related fatty acids contributes to the direct suppression of CDKN1A (p21) and CDKN2A (p16) expression levels.

RJ contains approximately 4% 10H2DA and 1.5% 10HDAA, which are unique medium-chain fatty acids. In this study, the maximum concentration of RJ used in the 3D culture was 400 µg/mL. The concentration of 10H2DA, the most abundant fatty acid in RJ, at 400 µg/mL RJ was calculated to be approximately 86 µM. Therefore, we treated keratinocytes with 80 µM of each fatty acid (10H2DA, 10HDAA, 2DA, and SA) in the 3D culture. Our data revealed that all fatty acids investigated in this study (10H2DA, 10HDAA, 2DA, and SA) contributed to the enhancement of epidermal thickness equivalent to levels comparable to RJ, indicating that these fatty acids are active compounds in this reaction (Fig. 5). The concentrations of 2DA and SA in RJ are much lower than those of 10H2DA and 10HDAA, and 2DA and DA are metabolized from 10H2DA and 10HDAA, respectively, in vivo.¹⁰⁾ Therefore, RJ administration is expected to be effective in maintaining epidermal homeostasis even after metabolism in vivo.

Traditionally, RJ is used for the improvement of menopause-related symptoms.⁹⁾ Therefore, the estrogenic activity of RJ has attracted attention and its efficacy has been investigated. RJ enhances the proliferation of estrogen-sensitive breast cancer cell line, MCF-7 and upregulates the transcription of genes dependent on the estrogen-responsive element via interaction with estrogen receptors (ERs).¹⁴⁾ Suzuki et al. reported that 10H2DA, 10HDAA, and 2DA bind to the ER-β, thereby enhancing the ER response.²⁷⁾ In addition, Moutsatsou et al. also reported that fatty acids of RJ, such as 10H2DA, SA, and 3,10-dihydroxydecanoic, present strong estrogenic effects that mediate estrogen signaling by modulating the recruitment of ERs and co-activators to the target genes.²⁸⁾ Interestingly, estrogen signaling has also been shown to regulate p63, particularly ΔNp63, through ERα, as reported in studies investigating breast cancer cell lines.²⁹⁾ Since p63 plays a critical role in the maintenance and proliferation of keratinocytes, the estrogenic activity of RJ and its fatty acids could potentially influence ΔNp63 expression, contributing to epidermal thickening and enhanced keratinocyte proliferation, as observed in this study. Estrogen also affects various skin conditions. Application of 17β-estradiol, the most potent estrogen, increases the proliferative capacity of epidermal keratinocytes in both humans and mice, resulting in a thicker epidermis.^30–32) Therefore, the estrogenic activities of fatty acids in RJ may contribute to the beneficial effects on epidermal keratinocytes and potentially the regulation of p63 expression. However, the estrogenic activity of RJ remains ambiguous as a recent study indicated that RJ exhibited little or no estrogenic activity via ER-mediated genomic signaling pathway both in vitro and in vivo.³³⁾ This point needs to be investigated further in future studies.

Overall, this study provides the first evidence that RJ has a positive impact on epidermal keratinocytes by maintaining their stem cell properties via senescence inhibition. The main advantage of bee-based cosmetics is their high efficacy, with minimal side effects. Hence, RJ can potentially be used as a functional cosmetic ingredient.

Acknowledgments

We thank Ayumu Morioka and Taiki Higuchi for their technical assistance in this study.

Conflict of Interest

Mariko Moriyama, Yuko Miyake, and Hiroyuki Moriyama declare no competing interests. Nobuaki Okumura is an employee of Yamada Bee Company Inc.

REFERENCES

• 1) Watt FM. Terminal differentiation of epidermal keratinocytes. Curr. Opin. Cell Biol., 1, 1107–1115 (1989).
• 2) Senoo M, Pinto F, Crum CP, McKeon F. p63 is essential for the proliferative potential of stem cells in stratified epithelia. Cell, 129, 523–536 (2007).
• 3) Keyes WM, Wu Y, Vogel H, Guo X, Lowe SW, Mills AA. p63 deficiency activates a program of cellular senescence and leads to accelerated aging. Genes Dev., 19, 1986–1999 (2005).
• 4) Rivetti di Val Cervo P, Lena AM, Nicoloso M, Rossi S, Mancini M, Zhou H, Saintigny G, Dellambra E, Odorisio T, Mahe C, Calin GA, Candi E, Melino G. p63-microRNA feedback in keratinocyte senescence. Proc. Natl. Acad. Sci. U.S.A., 109, 1133–1138 (2012).
• 5) Truong AB, Kretz M, Ridky TW, Kimmel R, Khavari PA. p63 regulates proliferation and differentiation of developmentally mature keratinocytes. Genes Dev., 20, 3185–3197 (2006).
• 6) Candi E, Rufini A, Terrinoni A, Dinsdale D, Ranalli M, Paradisi A, De Laurenzi V, Spagnoli LG, Catani MV, Ramadan S, Knight RA, Melino G. Differential roles of p63 isoforms in epidermal development: selective genetic complementation in p63 null mice. Cell Death Differ., 13, 1037–1047 (2006).
• 7) Mangiulli M, Valletti A, Caratozzolo MF, Tullo A, Sbisa E, Pesole G, D’Erchia AM. Identification and functional characterization of two new transcriptional variants of the human p63 gene. Nucleic Acids Res., 37, 6092–6104 (2009).
• 8) Ha L, Ponnamperuma RM, Jay S, Ricci MS, Weinberg WC. Dysregulated DeltaNp63alpha inhibits expression of Ink4a/arf, blocks senescence, and promotes malignant conversion of keratinocytes. PLOS ONE, 6, e21877 (2011).
• 9) Bălan A, Moga MA, Dima L, Toma S, Elena Neculau A, Anastasiu CV. Royal jelly-A traditional and natural remedy for postmenopausal symptoms and aging-related pathologies. Molecules, 25, 3291 (2020).
• 10) Yamaga M, Tani H, Yamaki A, Tatefuji T, Hashimoto K. Metabolism and pharmacokinetics of medium chain fatty acids after oral administration of royal jelly to healthy subjects. RSC Adv., 9, 15392–15401 (2019).
• 11) Šedivá M, Laho M, Kohátová L, Mojžišová A, Majtán J, Klaudiny J. 10-HDA, a major fatty acid of royal jelly, exhibits pH dependent growth-inhibitory activity against different strains of paenibacillus larvae. Molecules, 23, 3236 (2018).
• 12) Gu H, Song I-B, Han H-J, Lee N-Y, Cha J-Y, Son Y-K, Kwon J. Anti-inflammatory and immune-enhancing effects of enzyme-treated royal jelly. Appl. Biol. Chem., 61, 227–233 (2018).
• 13) Okumura N, Ito T, Degawa T, Moriyama M, Moriyama H. Royal jelly protects against epidermal stress through upregulation of the NQO1 expression. Int. J. Mol. Sci., 22, 12973 (2021).
• 14) Mishima S, Suzuki KM, Isohama Y, Kuratsu N, Araki Y, Inoue M, Miyata T. Royal jelly has estrogenic effects in vitro and in vivo. J. Ethnopharmacol., 101, 215–220 (2005).
• 15) Kunugi H, Mohammed Ali A. Royal jelly and its components promote healthy aging and longevity: from animal models to humans. Int. J. Mol. Sci., 20, 4662 (2019).
• 16) Nagai T, Inoue R, Suzuki N, Nagashima T. Antioxidant properties of enzymatic hydrolysates from royal jelly. J. Med. Food, 9, 363–367 (2006).
• 17) Kurek-Górecka A, Górecki M, Rzepecka-Stojko A, Balwierz R, Stojko J. Bee products in dermatology and skin care. Molecules, 25, 556 (2020).
• 18) Duplan H, Questel E, Hernandez-Pigeon H, Galliano MF, Caruana A, Ceruti I, Ambonati M, Mejean C, Damour O, Castex-Rizzi N, Bessou-Touya S, Schmitt AM. Effects of hydroxydecine((R)) (10-hydroxy-2-decenoic acid) on skin barrier structure and function in vitro and clinical efficacy in the treatment of UV-induced xerosis. Eur. J. Dermatol., 21, 906–915 (2011).
• 19) Moriyama M, Moriyama H, Uda J, Matsuyama A, Osawa M, Hayakawa T. BNIP3 plays crucial roles in the differentiation and maintenance of epidermal keratinocytes. J. Invest. Dermatol., 134, 1627–1635 (2014).
• 20) Moriyama M, Moriyama H, Uda J, Kubo H, Nakajima Y, Goto A, Akaki J, Yoshida I, Matsuoka N, Hayakawa T. Beneficial effects of the genus aloe on wound healing, cell proliferation, and differentiation of epidermal keratinocytes. PLOS ONE, 11, e0164799 (2016).
• 21) Honda Y, Fujita Y, Maruyama H, Araki Y, Ichihara K, Sato A, Kojima T, Tanaka M, Nozawa Y, Ito M, Honda S. Lifespan-extending effects of royal jelly and its related substances on the nematode Caenorhabditis elegans. PLOS ONE, 6, e23527 (2011).
• 22) Okumura N, Toda T, Ozawa Y, Watanabe K, Ikuta T, Tatefuji T, Hashimoto K, Shimizu T. Royal jelly delays motor functional impairment during aging in genetically heterogeneous male mice. Nutrients, 10, 1191 (2018).
• 23) McHugh D, Gil J. Senescence and aging: Causes, consequences, and therapeutic avenues. J. Cell Biol., 217, 65–77 (2018).
• 24) Su X, Cho MS, Gi YJ, Ayanga BA, Sherr CJ, Flores ER. Rescue of key features of the p63-null epithelial phenotype by inactivation of Ink4a and Arf. EMBO J., 28, 1904–1915 (2009).
• 25) Westfall MD, Mays DJ, Sniezek JC, Pietenpol JA. The Delta Np63 alpha phosphoprotein binds the p21 and 14-3-3 sigma promoters in vivo and has transcriptional repressor activity that is reduced by Hay–Wells syndrome-derived mutations. Mol. Cell. Biol., 23, 2264–2276 (2003).
• 26) LeBoeuf M, Terrell A, Trivedi S, Sinha S, Epstein JA, Olson EN, Morrisey EE, Millar SE. Hdac1 and Hdac2 act redundantly to control p63 and p53 functions in epidermal progenitor cells. Dev. Cell, 19, 807–818 (2010).
• 27) Suzuki KM, Isohama Y, Maruyama H, Yamada Y, Narita Y, Ohta S, Araki Y, Miyata T, Mishima S. Estrogenic activities of fatty acids and a sterol isolated from royal jelly. Evid. Based Complement. Alternat. Med., 5, 295–302 (2008).
• 28) Moutsatsou P, Papoutsi Z, Kassi E, Heldring N, Zhao C, Tsiapara A, Melliou E, Chrousos GP, Chinou I, Karshikoff A, Nilsson L, Dahlman-Wright K. Fatty acids derived from royal jelly are modulators of estrogen receptor functions. PLOS ONE, 5, e15594 (2010).
• 29) Ho JY, Chang FW, Huang FS, Liu JM, Liu YP, Chen SP, Liu YL, Cheng KC, Yu CP, Hsu RJ. Estrogen enhances the cell viability and motility of breast cancer cells through the ERalpha-DeltaNp63-integrin beta4 signaling pathway. PLOS ONE, 11, e0148301 (2016).
• 30) Verdier-Sevrain S, Yaar M, Cantatore J, Traish A, Gilchrest BA. Estradiol induces proliferation of keratinocytes via a receptor mediated mechanism. FASEB J., 18, 1252–1254 (2004).
• 31) Movérare S, Lindberg MK, Faergemann J, Gustafsson JA, Ohlsson C. Estrogen receptor alpha, but not estrogen receptor beta, is involved in the regulation of the hair follicle cycling as well as the thickness of epidermis in male mice. J. Invest. Dermatol., 119, 1053–1058 (2002).
• 32) Son ED, Lee JY, Lee S, Kim MS, Lee BG, Chang IS, Chung JH. Topical application of 17beta-estradiol increases extracellular matrix protein synthesis by stimulating TGF-beta signaling in aged human skin in vivo. J. Invest. Dermatol., 124, 1149–1161 (2005).
• 33) Ishida K, Matsumaru D, Shimizu S, Hiromori Y, Nagase H, Nakanishi T. Evaluation of the estrogenic action potential of royal jelly by genomic signaling pathway in vitro and in vivo. Biol. Pharm. Bull., 45, 1510–1517 (2022).