2024 Volume 47 Issue 2 Pages 383-388
To clarify the causes of breed differences in serum testosterone levels of male pigs, which affect the mRNA expression of drug metabolizing enzymes and drug transporters in the liver and kidney, we focused on testicular enzymes and proteins involved in testosterone biosynthesis process and comparatively examined their mRNA levels by real time RT-PCR among low serum testosterone-type Landrace pigs and high serum testosterone-type Meishan and Landrace/Meishan-crossbreed (LM and ML) pigs. Testicular mRNA levels of the enzymes (3-hydroxy-3-methylglutaryl-CoA synthase 1 and 3-hydroxy-3-methylglutaryl-CoA reductase) and proteins (low density lipoprotein receptor and scavenger receptor class B member 1) affecting intracellular levels of cholesterol, a precursor of testosterone, were 2–5-fold higher in Meishan, LM and ML pigs than in Landrace pigs. Likewise, the mRNA levels of steroidogenic acute regulatory protein, which imports cholesterol to the inner mitochondrial membrane, and of testosterone biosynthesis enzymes (CYP11A1 and CYP17A1) were over 10-fold and approximately 3-fold higher, respectively, in Meishan, LM and ML pigs than in Landrace pigs. Furthermore, positive correlations between those mRNA levels and serum testosterone levels were observed. Despite large breed differences in testicular mRNA levels described above, no significant breed differences in intratesticular testosterone levels were observed. The present findings strongly suggest that breed differences in serum testosterone levels of male pigs are probably, at least in part, caused by differences in testicular mRNA levels of enzymes and proteins involved in testosterone biosynthesis process and by differences in the levels of testosterone released from testes.
Drug metabolizing enzymes (DMEs) and drug transporters play critical roles in the pharmacokinetics of xenobiotics, including drugs.1,2) Their expression and activities are often influenced by a variety of host factors, such as sex, age and physiological state.1,3–5) Accordingly, for establishment of appropriate drug therapy for individuals, analyzing the factors that cause individual differences in the gene expression of DMEs and drug transporters is necessary. However, such research in humans is difficult because it is difficult to obtain samples.
Pigs are attracting attention as human model animals because of their anatomical and physiological resemblance to humans.6) So, using several breeds of pigs, we have found for the first time that there are serum testosterone-dependent sex and breed differences in the mRNA levels of several DMEs7–11) and drug transporters12) in the liver and kidney, and further demonstrated that breed differences in serum testosterone levels in males are due to genetic factors.8) However, the specific cause of this difference has not been elucidated.
Testosterone is primarily synthesized from cholesterol in a multi-step process in the testis.13,14) Intracellular cholesterol is supplied by de novo synthesis as well as by uptake from circulating lipoproteins: low-density lipoproteins (LDLs) and high-density lipoproteins (HDLs) are taken up by the LDL receptor (LDLR) and the HDL receptor (scavenger receptor class B member 1, SCARB1), respectively. Intracellular cholesterol is imported into mitochondria by steroidogenic acute regulatory protein (STAR) and converted to pregnenolone by CYP11A1, a rate-limiting enzyme for testosterone biosynthesis. Pregnenolone is further converted to testosterone by several enzymes, including CYP17A1.
Therefore, to clarify the causes of breed differences in serum testosterone levels of male pigs, we comparatively examined the testicular mRNA levels of enzymes and proteins involved in testosterone biosynthesis process using several pig breeds with genetic differences in serum testosterone levels. Furthermore, the serum estradiol level in pigs is reportedly to be higher in males than in females15); therefore, we also examined the testicular mRNA level of the aromatase, CYP19A3, which converts testosterone to estradiol,16) for understanding sex differences in serum estradiol level.
Both sexes of 5-month-old Landrace, Meishan and crossbred F1 [female Landrace × male Meishan (LM); female Meishan × male Landrace (ML)] pigs were used. These are the same pigs used in our previous studies on breed differences.12) Some of the Meishan and Landrace males were castrated at 1-month-old and killed at 5-month-old. These castrated pigs were also the same as those used previously.12) The testis and serum were collected from each pig between 10 and 11 a.m., and stored at −80 °C until use. All animal experiments were conducted in accordance with the guidelines of the Animal Care Committee of the National Institute of Animal Sciences and National Institute of Livestock and Grassland Science, Tsukuba, Japan.
Sex Hormone LevelsIntratesticular testosterone and estradiol levels were measured using a testosterone enzyme-linked immunosorbent assay (ELISA) kit (ENZO Life Sciences Inc., Farmingdale, NY, U.S.A.) and an Estradiol enzyme immunoassay (EIA) Kit (Cayman Chemical Company, Ann Arbor, MI, U.S.A.), respectively, following the manufacturers’ instructions. The testis from each pig was homogenized in three volumes (w/v) of 1.15% KCl. The homogenate was centrifuged at 9000 × g at 4 °C for 20 min, and the resultant supernatant was further centrifuged at 105000 × g at 4 °C for 1 h. The supernatant was then extracted twice with diethyl ether or methylene chloride for the measurement of intratesticular testosterone and estradiol, respectively. These extracts were evaporated under N2 gas. The resultant residues were dissolved in the corresponding buffers supplied in the testosterone and estradiol assay kits, and used to measure each hormone. Testosterone and estradiol levels are shown as amount per 1 g of testis tissue.
Estradiol levels in the sera prepared from individual pigs were also quantified using an Estradiol EIA Kit (Cayman) following the manufacturer’s instructions, as described above. As for serum testosterone levels, previously obtained data12) were used.
mRNA Levels of Testicular Enzymes and ProteinsThe mRNA levels of 3-hydroxy-3-methylglutaryl-CoA synthase 1 (HMGCS1), 3-hydroxy-3-methylglutaryl-CoA reductase (HMGCR), LDLR, SCARB1, STAR, CYP11A1, CYP17A1, CYP19A1, CYP19A2 and CYP19A3 in the testis were measured by real time RT-PCR using the primer sets shown in Table 1. Beta actin (ACTB) mRNA was used as an internal standard.
| Gene | Forward primer (5′-3′) | Reverse primer (5′-3′) | Amplicon size (bp) | Accession No. |
|---|---|---|---|---|
| HMGCS1 | gagaagacactcatcacttggtcaa | tgcttttcatccactcgaactagg | 97 | NM_001252215 |
| HMGCR | tccagtccaggtcaggtgatg | tctgcatttcagggaaatactcatg | 99 | NM_001122988 |
| LDLR | agtcagtgacgatgtcccaaca | agaggaggatgagcagtgcaat | 120 | NM_001206354 |
| SCARB1 | tgctgttcatccccatcgtcta | cccttgggagctggtgtcat | 139 | NM_213967 |
| STAR | tttggagagatgcctgagcagaa | gtttggtctttgagggacttccag | 100 | NM_213755 |
| CYP11A1 | atgacaagctgctctcagaagatg | tcatacaagtgccattgcagagtc | 100 | NM_214427 |
| CYP17A1 | gccaaggaggtgcttctcaag | cgaaggcaatccccttttggtt | 100 | NM_214428 |
| CYP19A1 | cactggctttcttctcttggtttg | ccagaggaatctgaggtaggaaatt | 109 | NM_214429 |
| CYP19A2 | ctgtacaaaaagcataaagagtctgtg | tctctgctgtgataatgctgca | 94 | NM_214430 |
| CYP19A3 | cataatgaagcacaatcattacacgt | gggccggacagagcttttg | 150 | NM_214431 |
| ACTB | caccccgtgctgctgacc | tgaaggtctcgaacatgatctgg | 82 | XM_003124280 |
Briefly, total RNA was prepared from individual testes using TRIzol Reagent (Invitrogen Corp., Carlsbad, CA, U.S.A.). Each prepared total RNA was treated with deoxyribonuclease (DNase) using a RNase-Free DNase Set (Qiagen, Hilden, Germany) and then purified using an RNeasy Mini Kit (Qiagen) following the manufacturer’s instructions. A portion (4 µg) of total RNA was converted to cDNA in 20 µL reverse transcription (RT)-reaction mixture using the SuperScript First-Strand Synthesis System for RT-PCR (Invitrogen) and random hexamers in accordance with the manufacturer’s instructions. Real-time RT-PCR was performed on an ABI PRISM 7500 Sequence Detection System using Power SYBR green master mix (PE Applied Systems, Tokyo, Japan) as described previously.17) The amount of each cDNA was determined by the relative standard curve method in accordance with PE Applied Biosystems User Bulletin #2 (1997). Standard curves were generated using an RT-reaction mixture with total RNA extracted from the testis of Landrace pigs.
Statistical AnalysisStatistical differences were assessed by Tukey’s multiple comparison test or Student’s t-test.
Cholesterol is a precursor for testosterone biosynthesis; therefore, we first examined the testicular mRNA levels of cholesterol biosynthesis enzymes, HMGCS1 and HMGCR, the rate limiting enzyme.18) These mRNA levels were approximately 2-fold higher in high serum testosterone-type Meishan, LM and ML pigs than in low serum testosterone-type Landrace pigs (Fig. 1A). Likewise, testicular mRNA levels of LDLR and SCARB1, which are involved in uptake of lipoproteins supplying cholesterol from blood,13) were 4–5-fold higher in Meishan, LM and ML pigs than in Landrace pigs (Fig. 1B).
The level of each mRNA is shown as a ratio to that of ACTB mRNA. Each symbol represents each individual pig, and the bar in each group shows the mean. □, Landrace pigs (L); ○, Meishan pigs (M); △, LM pigs; ◇, ML pigs. * Significant differences from Landrace pigs were assessed using Tukey’s multiple comparison test: * p < 0.01.
STAR is located in the mitochondrial membrane and plays an important role in the transport of free cholesterol into mitochondria.13,19) Therefore, we first examined the mRNA levels of STAR in the testes of low serum testosterone-type Landrace and high serum testosterone-type Meishan, LM and ML pigs. As shown in Fig. 2, the levels of testicular STAR mRNA in Meishan, LM and ML pigs were over 10-fold higher than those in Landrace pigs. Testicular mRNA levels of CYP11A1 and CYP17A1, which are key enzymes for testosterone biosynthesis,13,14) were next examined. Similar to breed differences observed in the mRNA expression of STAR, these mRNA levels were approximately 3-fold higher in Meishan, ML and LM pigs than in Landrace pigs (Fig. 2).
The level of each mRNA is shown as a ratio to that of ACTB mRNA. Each symbol represents each individual pig, and the bar in each group shows the mean. □, Landrace pigs (L); ○, Meishan pigs (M); △, LM pigs; ◇, ML pigs. *, ** Significant differences from Landrace pigs were assessed using Tukey’s multiple comparison test: * p < 0.05, ** p < 0.01.
Next, we examined the intratesticular testosterone levels in all the pig breeds used. Despite the large differences in testicular mRNA levels of enzymes and proteins involved in testosterone biosynthesis process between high and low serum testosterone-types of pig breeds (Figs. 1, 2), there were no significant breed differences in intratesticular testosterone levels (Fig. 3).
Testicular testosterone levels are shown as ng/g tissue. Each symbol represents each individual pig, and the bar in each group shows the mean. □, Landrace pigs (L); ○, Meishan pigs (M); △, LM pigs; ◇, ML pigs. Significant differences from Landrace pigs were assessed using Tukey’s multiple comparison test.
The correlations between serum testosterone levels and testicular mRNA levels of HMGCS1, HMGCR, LDLR, SCARB1, STAR, CYP11A1 and CYP17A1 were examined by regression analysis. As shown in Fig. 4, positive correlations were found between them.
The level of each mRNA is shown as ratio to that of ACTB mRNA, and each symbol represents each individual pig. The data shown in Figs. 1 and 2 were used for each mRNA level, and previously obtained data12) were used for serum testosterone level. □, Landrace pigs (L); ○, Meishan pigs (M); △, LM pigs; ◇, ML pigs. Correlations were assessed by regression analysis, where r is the correlation coefficient.
The absence of any breed differences in intratesticular testosterone levels (Fig. 3) prompted us to examine the testicular mRNA levels of CYP19A3, which converts testosterone to estradiol,16) in all pig breeds. The CYP19A3 mRNA levels in high serum testosterone-type Meishan, LM and ML pigs were over 10-fold higher than those in low serum testosterone-type Landrace pigs (Fig. 5), and no such breed differences among Meishan, LM and ML pigs were observed. In addition, pigs also possess CYP19A1 and CYP19A2 genes16); however, these mRNA levels in the testis were either below the detection limit or extremely low.
The level of CYP19A3 mRNA is shown as a ratio to that of ACTB mRNA. Each symbol represents each individual pig, and the bar in each group shows the mean. □, Landrace pigs (L); ○, Meishan pigs (M); △, LM pigs; ◇, ML pigs. * Significant differences from Landrace pigs were assessed using Tukey’s multiple comparison test: * p < 0.01.
The differences in the testicular mRNA levels of CYP19A3 between low serum testosterone-type Landrace pigs and high serum testosterone-type Meishan, LM and ML pigs (Fig. 5) led us to investigate whether there are differences in intratesticular and serum estradiol levels between low serum testosterone-type and high serum testosterone-type pigs. Intratesticular and serum estradiol levels were higher in Meishan, LM and ML pigs than in Landrace pigs (Fig. 6).
Testicular and serum estradiol levels are shown as ng/g tissue and ng/mL, respectively. Each symbol represents each individual pig, and the bar in each group shows the mean. □, Landrace pigs (L); ○, Meishan pigs (M); △, LM pigs; ◇, ML pigs. *, ** Significant differences from Landrace pigs were assessed using Tukey’s multiple comparison test: * p < 0.05, ** p < 0.01.
Serum estradiol levels are reportedly to be higher in male pigs than in female pigs15); therefore, we further examined the sex differences in each pig breed. Serum estradiol levels in females of all breeds were 89.6–127.2 pg/mL (Supplementary Fig. 1) and significantly lower (Student’s t-test, p < 0.01) than those in corresponding males shown in Fig. 6. To further clarify the cause(s) of such sex differences, the effect of castration on serum estradiol levels of males was investigated using high serum testosterone-type Meishan and low serum testosterone-type Landrace pigs. Castration reduced serum estradiol levels of males to those of females in both breeds; serum estradiol levels of the castrated Meishan and Landrace pigs were 131.3 ± 51.9 pg/mL (n = 3) and 112.1 ± 10.0 pg/mL (n = 3), respectively, and those of female Meishan and Landrace pigs were 112.8 ± 6.6 pg/mL (n = 6) and 102.6 ± 12.0 pg/mL (n = 5), respectively.
We have previously demonstrated that breed differences in serum testosterone levels of male pigs occur through genetic differences.8) However, more specific causes remain unclear. Here, we focused on testosterone biosynthesis in the testis and comparatively examined the testicular mRNA levels of enzymes and proteins involved in testosterone biosynthesis process using low and high serum testosterone-types of pig breeds.
The mRNA levels of the enzymes (HMGCS1 and HMGCR for cholesterol biosynthesis; CYP11A1 and CYP17A1 for testosterone biosynthesis) and proteins (LDLR and SCARB1 for cholesterol uptake; STAR for cholesterol import into mitochondria) in the testis were significantly higher in high serum testosterone-type Meishan, LM and ML pigs than in low testosterone-type Landrace pigs. Furthermore, there were positive correlations between those mRNA levels and serum testosterone levels. These results strongly suggest that breed differences in serum testosterone levels are, at least in part, dependent on differences in the testicular mRNA levels of enzymes and proteins involved in testosterone biosynthesis process.
Despite the large breed differences in the gene expression of testicular enzymes and proteins involved in testosterone biosynthesis process, no breed differences in intratesticular testosterone levels were observed. This indicates that the intratesticular testosterone level would be maintained at a level to sustain testis functions related to spermatogenesis and male fertility via Leydig, Sertoli and peritubular myoid cells expressing androgen receptor.20–22) Furthermore, excess testosterone would be released from the testis via multidrug and toxic compound extrusion (MATE) proteins23,24) and converted to its metabolite(s), including estradiol. These inferences are supported by breed differences in serum testosterone levels and in serum and intratesticular estradiol levels in males. Incidentally, the mRNA level of the aromatase, CYP19A3, in the testis was higher in high serum testosterone-type Meishan, LM and ML pigs than in low serum testosterone-type Landrace pigs.
In addition, consistent with previously reported results,15) serum estradiol levels of male pigs were higher than those in females in all the pig breeds examined. Furthermore, serum estradiol levels in males of Meishan and Landrace pigs were decreased to the corresponding female levels by castration. This indicates that the testis is an important tissue for producing estradiol and strongly suggests that estradiol biosynthesis in the testis is the cause of sex differences in serum estradiol levels in each breed.
The gene expression levels of testicular enzymes and proteins involved in testosterone/estradiol biosynthesis in LM and ML pigs, which are cross breeds of high serum sex hormone-type Meishan and low serum sex hormone-type Landrace pigs, were almost the same as those of Meishan pigs. This strongly suggests that the gene expression levels of those enzymes and proteins are determined by autosomal dominant inheritance.
In conclusion, we propose that breed differences in serum testosterone levels of male pigs are highly correlated with differences in the expression levels of genes encoding testicular enzymes (HMGCS1, HMGCR, CYP11A1 and CYP17A1) and proteins (LDLR, SCARB1 and STAR) involved in testosterone biosynthesis process together with differences in the levels of testosterone released from testes. However, the causes of breed differences in those gene expression levels in the testis remain unclear. In this study, we also reveal that the testis is an important tissue for producing sex hormones, testosterone and estradiol, and for determining levels of serum sex hormones in male pigs. Our present findings will help us for understanding individual differences in the levels of blood sex hormones, especially testosterone, in men.
This study was supported by the NIAS (National Institute of Agrobiological Sciences) Strategic Research Fund. We thank Tsukuba Operation Unit 7 (Technical Support Center of Central Region, NARO, Tsukuba, Japan) for animal care and collecting tissues.
The authors declare no conflict of interest.
This article contains supplementary materials.
