Lymphatic Endothelial Cells Produce Chemokines in Response to the Lipid Nanoparticles Used in RNA Vaccines

Abstract

RNA vaccines based on Lipid nanoparticles (LNP) were put into practical use within only one year after the global outbreak of the coronavirus disease 2019 (COVID-19). This success of RNA vaccine highlights the utility of an mRNA delivery system as a vaccination strategy. Potent immunostimulatory activity of LNPs (i.e., inflammation occurring at the injection site and the production of inflammatory cytokines) have recently been reported. However, we have only limited knowledge concerning which cells are responsible for responding to the LNPs. We report herein on in vitro chemokine production from non-immune cells in response to exposure to LNPs. In this study, SM-102, an ionizable lipid that is used in the approved RNA vaccine for the clinical usage of COVID-19 mRNA vaccine, was used. Immortalized mouse lymphatic endothelial cells (mLECs) or professional antigen presenting cells (APCs) such as RAW 264.7 monocyte/macrophage cells were incubated with LNPs that contained no mRNA. As a result, chemokines involved in the recruitment of monocytes/neutrophils were produced only by the mLECs following the LNP treatment. These findings indicate that LEC appear to serve as the cell that sends out initial signals to response LNPs.

INTRODUCTION

Looking back on the history of the development of the public health system, vaccination has been one of the most effective approaches for protecting us from infectious diseases.¹⁾ mRNA vaccines are game changers in the response to the recent global pandemic. Their use has expanded with unprecedented speed and scale²⁾ since the WHO declared coronavirus disease 2019 (COVID-19) pandemic. Unlike other vaccines such as live-attenuated vaccines, viral-vectored vaccines, or DNA-based vaccines, mRNA vaccines do not contain any live microbes that might be a cause of additional infection and/or do not pose any concern for genome DNA integration in host cells.^3,4) Unlike these conventional vaccines,^5,6) mRNA vaccines can be rapidly designed based on genetic information of the pathogenic microbe.^7,8)

One of the key advances in the field of RNA therapeutics was the establishment of the methods for the artificial synthesis of mRNA (i.e., employment of Cap (1) structure, modification of uridine nucleotides, and the addition of a poly (A) tail^9–13)). It is particularly noteworthy that modified uridines such as N1-methyl-pseudouridine and 5-methoxy-uridine effectively avoid the stimulation of Pattern Recognition Receptors (PRRs), thereby reducing innate immune activation and improving translation.^14,15) The removal of double stranded RNA (dsRNA) byproducts could also silence PRR sensing and could also result in a high level of protein production.^16–18) Another key advance was the development of lipid nanoparticles (LNPs) that are composed of ionizable lipids.⁵⁾ LNPs containing mRNA (mRNA-LNPs) can also be formed with helper phospholipids, cholesterol, and polyethylene glycol conjugated lipids (PEG-lipids), as well as ionizable lipids. The use of an ionizable lipid assists in the cytoplasmic delivery of mRNA by promoting endosomal escape.^19,20) Both of the currently used COVID-19 RNA vaccines, mRNA-1273 (Moderna) and BNT162b2 (Pfizer-BioNtech) approved by the U.S. Food and Drug Administration (FDA), used this LNP technology.²⁰⁾

Preclinical and clinical studies of mRNA-LNPs showed that an antigen-specific immune response is induced by the immunostimulatory activity of the mRNA-LNPs which induces the robust activation of innate immune systems.^21–24) Since the nucleoside-modified mRNA was designed to be a non-inflammatory molecule, it is generally assumed that the LNPs themselves are potent drivers for inducing strong adjuvant activity.¹⁸⁾ Recent studies demonstrated that the activation of humoral immunity by an mRNA-LNP vaccination²⁵⁾ was induced via the activation of T follicular helper (Tfh) cells and germinal center (GC) B cells in draining lymph nodes.^26,27) These findings were also confirmed in human peripheral blood samples upon a severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) mRNA vaccination.^26,28–30)

The production of antibodies and the expansion/activation of immune cells have been used as indexes for investigating the efficacy of vaccines.^31,32) These types of evaluations could only be conducted by in vivo approaches and they require time and the use of animals.³³⁾ The development of an alternative in vitro system for assaying the immunostimulatory activity of mRNA-LNPs would pave the way for the high throughput evaluation of the efficacy of mRNA-LNPs at the early stage of their development.^33,34) In addition, it could allow the mechanism of RNA vaccines, which remains to be elucidated, to be better understood. Since the immunostimulatory effect depends on the intrinsic immunostimulatory activity of ionizable lipids,^22,35) it is important to identify cells that can respond to empty-LNPs that do not contain encapsulated mRNA.

It has been proposed that LNPs promote antigen presentation via activating professional antigen presenting cells such as monocytes, dendritic cells (DCs), and macrophages.^35,36) However, evidence showing that these cells directly recognize LNPs to induce innate immunity at the early stage of vaccination has not been confirmed. In the present study, we provide the first report that empty-LNPs that contain SM-102, an ionizable lipid used in SARS-CoV-2 mRNA vaccines,³⁷⁾ are recognized by immortalized mouse lymphatic endothelial cells (mLECs).

MATERIALS AND METHODS

Materials

Detailed information on the suppliers of reagents used in this study, including item numbers of all reagents, is listed as Supplementary Table S1 in Supplementary Materials.

Animal Experiments

Wild type female BALB/c mice (6–10 weeks old) were purchased from Nippon SLC, Inc. (Shizuoka, Japan). The breeding and experiments were conducted under the guidelines for handling experimental animals, approved by the Animal Care Committee of Chiba University.

Cell Lines

The murine immortalized lymphatic endothelial cells (mLECs) derived from mouse skin tissue was prepared as described in a previous report of our lab.³⁸⁾ mLECs were cultured using Endothelial Cell Growth Medium MV kit (PromoCell, Heidelberg, Germany) supplemented with additional 1 µg/mL solution of Blasticidin S (Wako, Osaka, Japan) and 1% penicillin/streptomycin mixed solution (Nacalai Tesque, Kyoto, Japan) at 33 °C in a 5% CO₂ humidified atmosphere.

The RAW 264.7 cells were cultured in D-MEM (high glucose) medium supplemented with 10% (v/v) fetal bovine serum (FBS) (Life Science Production Ltd., U.K.), and 1% penicillin/streptomycin mixed solution at 37 °C in a 5% CO₂ humidified atmosphere. The cells were collected and seeded in a separate dish with fresh medium at 2 or 3 d intervals (cell passage). The cells were used in experiments after the third cell passage.

Preparation of in Vitro Transcription of IVT-mRNA

The pcDNA3.1 vector was used as coding template for ovalbumin (OVA). The pcDNA3.1-OVA was linearized by treatment with a restriction enzyme (AscI) (New England Biolabs, MA, U.S.A.). After phenol-chloroform extraction and ethanol precipitation, the linearized pDNA was transcribed into mRNA using a MEGAscript T7 Transcription Kit according to the manufacture’s protocol (Life Technologies, Carlsbad, CA, U.S.A.) following the manufacturer’s instructions. The uridine was then substituted by a modified nucleobase of m1ψ (N1-Methylpseudouridine-5′-Triphosphate) from TriLink, Llc. (San Diego, CA, U.S.A.). The 5′ cap and 3′ poly(A) tail was added following the protocol of the ScriptCap Cap 1 Capping System (Cellscript LLC, WI, U.S.A.) and a poly(A) Tailing Kit (Invitrogen, Waltham, MA, U.S.A.), respectively. The transcribed mRNA was stored in DDW at −80 °C. The concentration of single-strand DNA (linearized pDNA) and transcribed mRNA were measured by NanoDrop™ One (Thermo Fisher Scientific, Waltham, MA, U.S.A.).

LNP Formulation

SM-102 and cholesterol were purchased from Cayman Chemical (Ann Arbor, MI, U.S.A.) and Sigma-Aldrich (St. Louis, MO, U.S.A.), respectively. The 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC) and 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol) 2000 (SUNBRIGHT^® GM-020) were purchased from the NOF CORPORATION (Tokyo, Japan). The LNPs were formulated at a % molar composition of SM-102/DSPC/Chol/DMG-PEG 2000 = 50/10/38.5/1.5, respectively, and at a total N/P ratio of 5.5. The lipid mixtures dissolved in 99.5% ethanol was mixed with Sodium Acetate buffer (6.25 mM, pH 5.0) with or without IVT-mRNA using the NanoAssemblr^®Ignite™ device (Precision Nanosystem, Inc., Vancouver, Canada) with NxGen Cartridge (Precision Nanosystem, Inc.) following manufacturer provided protocols. To verify whether the LNPs produced were incorporated by cells, 0.2% DiD (Invitrogen) was further added as 1.5 mol % of total lipid. The total flow rate and flow rate ratio (buffer/ethanol) were 2 mL/min and FRR = 3/1, respectively. The collected LNP suspensions were then filtered with additional MES buffer (20 mM, pH 5.5) at a 4-fold volume against an ultrafiltration membrane of AmiconUltra-4-100 K (Merck, Darmstadt, Germany). Centrifugation were performed at 1000 × g and 25 °C for a maximum of 5 min per round. The isolated LNPs remaining in the membrane were again dialyzed using phosphate-buffered saline (D-PBS (−)) at pH 7.4 once for removing the ethanol and raising the pH to physiological pH at the same centrifugation conditions as indicated above. The resultant concentrated LNPs suspension were collected and diluted to the adequate concentration. The z-average diameter, Poly Dispersity Index (PdI) and zeta-potential were reported for each formulation in this study, assessed by Zetasizer Nano ZS (Malvern Instruments Ltd., Malvern, U.K.).

RiboGreen Assay

The Quant-it™ RiboGreen assay (Thermo Fisher Scientific) was used to quantify the recovery efficiency and encapsulation efficiency of the mRNA-loaded LNPs. Briefly, serially diluted mRNA samples for a 6-point standard curve ranged from 2000–0 ng/mL, and mRNA-LNPs at a concentration of 1000 ng mRNA/mL were prepared using D-PBS (−). Quant-it™ RiboGreen reagent was diluted 1 : 200 into D-PBS (−), in the presence or absence of 0.4% (w/v) Triton X-100 (Nacalai Tesque). A 50 µL aliquot of a diluted mRNA sample or an LNP suspension was pipetted into the wells of a black 96-well microplate (Corning, Corning, NY, U.S.A.), followed by 50 µL of RiboGreen solution (TritonX-100 (+) or Triton (−)) added into the wells. After shaken (500 rpm, orbital shaking) for 5 min at room temperature, fluorescence intensities were measured using a plate reader of Infinite M200 PRO (TECAN, Männedorf, Switzerland) with following settings: Excitation at 484 nm and Emission at 535 nm. Recovery efficiency was back-calculated based on the total RNA signal released from the Triton-lysed LNP samples using the standard curve of TrionX-100 (+). Free mRNA signal was measured in the absence of Triton X-100 lysis. The encapsulation efficiency was then calculated as follows:

  

In Vivo Immunization

Female, 6–10 week-old Balb/c mice were immunized with 1.5 µg of mOVA-LNP_SM-102. The second boost immunization was completed at 2 weeks after the first immunization. Serum samples were collected 14 d after each immunization (before the 2nd immunization at day 14), and stored at −80 °C until enzyme-linked immunosorbent assay (ELISA) analysis. The mice were sacrificed before serum was collected at day 28.

Ovalbumin Protein-Specific Immunoglobulin G (IgG) Quantification by ELISA

ELISA was performed to investigate anti- OVA IgG antibodies in serum. Clear Flat-Bottom Immuno Nonsterille 96-Well Plates (Thermo Fisher Scientific) were coated with 10 µg/mL ovalbumin (Sigma-Aldrich) in 50 mM carbonate coating buffer (Na₂CO₃/NaHCO₃, pH 9.6) at 4 °C for 16 h. The coated plates were washed five times with washing buffer (0.1% (w/v) Tween 20 in PBS) and then blocked with 10% FBS in washing buffer at 37 °C for 2 h. Fifty microliters serum samples were serially diluted with washing buffer (Final dilution: 1 : 1000, 1 : 10000, 1 : 100000, 1 : 1000000, 1 : 10000000) were applied into each well. After shaking (300 rpm, orbital shaking) at room temperature for 1 h, the plates were washed and incubated with Goat Anti-mouse IgG-Fc Fragment Antibodies (Bethyl Laboratories) which were diluted in washing buffer at 2000-fold at 25 °C for another 1 h. Followed by 5-times washing, 100 µL TMB (EMD Millipore) was applied into each well for development. Reactions were stopped by adding 5 M Sulfuric Acid (Nacalai Tesque) and the absorbance was measured at 450 nm using a microplate reader (TECAN).

In Vitro Cellular Uptake Analysis by Flow Cytometry

In this assay, 1,1′-Dioctadecyl-3,3,3′,3′-tetramethylindocarbocyanine (DiD) (Invitrogen) was added in addition to the lipid solution of the LNP at 0.2 mol%. Before the 0.25–1 mM DiD-labeled LNPs were added to the cells, mouse lymphatic endothelial cells (mLEC) were seeded into 24-well plates at a density of 1 × 10⁵ cells/well and incubated at 33 °C for 24 h. After a 4-h LNP treatment at 33 °C, the cells were collected by centrifugation at 220 × g and 22 °C for 3 min. RAW 264.7 cells were also seeded into 24-well plates at a density of 1 × 10⁵ cells/well and incubated at 37 °C for 24 h. Followed by treated with 0.25–1 mM 0.2% DiD-labeled LNP_SM-102 for 4 h in 37 °C incubator, cells were collected by centrifugation at 1000 rpm and 4 °C for 5 min.

A flow cytometry (FCM) buffer was prepared as described in a previous report.³⁸⁾ After collecting the cells and removing the of supernatant, the obtained pellets were washed twice with FCM buffer. After being suspended in 300 µL FCM buffer, the cells were analyzed with an FCM Novocyte (Agilent Technologies, Santa Clara, CA, U.S.A.). The DiD was excited with a red laser (640 nm), with detection using a 660/30 nm bandpass filter.

Total RNA Extraction from Cells

After the removal of growth media, 500 µL of TRIzol™ Reagent (TaKaRa Bio Inc., Shiga, Japan) per 1 × 10⁵ cells were added into each well to lyse the cells. The lysate was then homogenized thoroughly, 100 µL chloroform (Nacalai Tesque) was added, and it was allowed to separate into a clear upper aqueous layer (containing RNA). After incubation for 2–3 min, the lysate was centrifuged at 12000 × g and 4 °C for 15 min, and the mixture separated into a lower red phenol-chloroform, an interphase of protein, and a colorless upper aqueous phase that contained RNA. The aqueous phase was collected and transferred to a new tube. Then 1 µL glycogen (20 mg/mL, Nacalai Tesque) and 250 µL isopropanol (Nacalai Tesque) were added to remove remaining RNA and precipitate RNA from the aqueous layer. The RNA was pelleted by centrifugation at 12000 × g and 4 °C for 10 min, and the pellet was sufficiently washed by 75% ethanol twice by centrifugation at 7500 × g and 4 °C for 5 min to remove impurities. The pellet then was resuspended in 20 µL deuterium-depleted water (DDW) and stored in DDW at −80 °C.

Reverse Transcription of RNA and RT-PCR

Aliquots of 0.2 µg RNA were reverse-transcribed using a High-Capacity RNA-to-cDNA™ Kit (Thermo Fisher Scientific) according to the manufacturers' instructions. The obtained cDNA was used for quantitative PCR analysis (RT-PCR). The mRNA levels of the target mRNA expression were determined by using THUNDERBIRD Probe qPCR Mix (TOYOBO Ltd., Aichi, Japan). The mRNA levels were normalized against glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA determined by THUNDERBIRD SYBR qPCR Mix (TOYOBO) and specific primers (CGACTTCAACAGCAACTCCCACTCTTCC 28mer and TGGGTGGTCCAGGGTTTCTTACTCCTT 27mer).

For RT-PCR, the primers of the target mRNA expression used were: mouse CCL2 primers CAGGTCCCTGTCATGCTTCT 20mer and GAGTGGGGCGTTAACTGCAT 20mer; mouse CCL7 GCTGCTTTCAGCATCCAAGTGG 21mer and CCAGGGACACCGACTACTG 19mer, mouse CXCL1 CTGGGATTCACCTCAAGAACATC 23mer and CAGGGTCAAGGCAAGCCTC 19mer, mouse CXCL2 CCAACCACCAGGCTACAGG 19mer and GCGTCACACTCAAGCTCTG 19mer; mouse CXCL5 TCCAGCTCGCCATTCATGC 19mer and TTGCGGCTATGACTGAGGAAG 21mer.

RNA Sequencing

After removing the growth media, 500 µL of TRIzol™ Reagent (TaKaRa Bio Inc.) per 1 × 10⁵ cells was added into each well to lyse the cells. The lysate was then homogenized thoroughly, 100 µL chloroform (Nacalai Tesque) was added, and the resulting suspension was allowed to separate into a clear upper aqueous layer (containing RNA). After incubated for 2–3 min, the lysate was centrifuged at 12000 × g and 4 °C for 15 min, so the mixture separated into a lower red phenol-chloroform, an interphase of protein, and a colorless upper aqueous phase of RNA. The aqueous phase was collected and transferred to a new tube. Then 1 µL glycogen (20 mg/mL, Nacalai Tesque) and 250 µL isopropanol (Nacalai Tesque) were added to remove remaining RNA and precipitate RNA from the aqueous layer. The RNA was pelleted by centrifugation at 12000 × g and 4 °C for 10 min, and the pellet was sufficiently washed twice with 75% ethanol by centrifugation at 7500 × g and 4 °C for 5 min to remove impurities. The pellet was then resuspended in 20 µL deuterium-depleted water (DDW) and stored in DDW at −80 °C. Two samples from each group were analyzed by RNA sequencing. Data preprocessing, the Heatmap analysis, and the gene clustering analysis were performed using iDEP.³⁹⁾ As a data pretreatment, genes expressed at a level of 1 or higher in all samples were set as threshold values, and the data converted into logs was acquired. In the gene clustering analysis, 1000 genes that had large fluctuations were divided into 3 clusters and analyzed. The Pathway database was set to Kyoto Encyclopedia of Genes and Genomes (KEGG). Each of the three clusters is shown below. A: Gene group that decreases with empty-LNP_SM-102, B: Gene group that increases with empty-LNP _SM-102, and C: Gene group with large individual differences. The fluctuated genes were analyzed using iDEP. The volatility was set to extract more than double the fluctuation with iDEP. In each sample group, the gene cluster was extracted into Excel, and a gene oncology (GO) analysis was performed using DAVID.

Detection of Chemokine Secretion of ELISA

After serial dilutions of the collected supernatants of cells, concentration of chemokines was measured by ELISA kit purchased from R&D systems (Minneapolis, MN, U.S.A.) and Proteintech Group Inc. (Rosemont, IL, U.S.A.) according to the manufacturer's instructions.

Statistical Analysis

Statistical analyses were performed by using Statcel 4 (OMS, Saitama, Japan). Comparison of two groups was made with Student’s t-test. Comparison of multiple groups was made with One-way ANOVA with Dunnett test. p < 0.05 were considered to be statistically significant.

RESULTS

Antibody Production after RNA Vaccination via Various Routes of Administration

The efficacy of the RNA vaccine used in this study was confirmed by administering mRNA-LNPs to BALB/c mice via various routes of administration. The mRNA-LNPs were prepared with SM-102/DSPC/cholesterol/DMG-PEG₂₀₀₀ = 50/10/38.5/1.5. The resulting mRNA-LNPs were administrated via subcutaneous (s.c.), intramuscular (i.m.), or intravenous (i.v.) injection. The physical properties of the mRNA-LNPs are shown in Table 1. mRNA encoding OVA as a model antigen was encapsulated in the LNPs (mOVA-LNPs) and injected at a dose of 1.5 µg mRNA. As a positive control, a mixture of poly I:C and OVA protein was s.c. administered. These vaccines were administered 2 times (day 0 and day 14). At 14 d after the administration of the second booster (day 28), the production of anti-OVA IgG was induced by s.c. and i.m. injection, but no antibody production was detected in the case of the i.v. injection (Figs. 1A, B).

Table 1. Properties of the LNP_SM-102

Sample	Size (nm)a)	PdIa)	Zeta-potential (mV)a)	Encapsulation efficiencyb)
mRNA-LNPSM-102	100.8 ± 7.5	0.19 ± 0.03	−1.82 ± 1.32	69.10 ± 3.82
Empty LNPSM-102	83.3 ± 10.0	0.21 ± 0.06	2.13 ± 0.13	—

a) Particle properties were determined using dynamic light scattering. b) Encapsulation efficiency was determined by Ribogreen^® assay.

Fig. 1. Production of the Anti-OVA Antibody after a Priming and a Boost Injection

(A, B) OVA-specific IgG response after first and second immunization with mOVA-LNP_SM-102. BALB/c mice were administrated with PBS (negative control), recombinant OVA protein (10 µg) plus Poly I:C (2 µg, s.c.), or mOVA-LNP_SM-102 (1.5 µg/mouse) via s.c., i.m., or i.v. injection. Serum was analyzed by ELISA to detect the OVA-specific IgG. Data are presented as the mean ± standard error of the mean (S.E.M.) (n = 3 to 4); * p < 0.05, ** p < 0.01.

This observation indicated that topical administration is required to induce humoral immunity by mRNA-LNPs. We therefore hypothesized that a series of cells could have been to the LNPs only after the s.c. and that i.m. injection was responsible for the initial immune-stimulation. When administrated via the s.c. or i.m. route, large fractions of the mRNA-LNPs entered to lymphatic systems.^40–43) Based on this finding, we focused our efforts on lymph endothelial cells (LECs), which constitute lymphatic vessels in our body.

Empty-LNP_SM-102 Caused an Increased Expression of Ccl2 mRNA in mLECs

We used immortalized mLECs that had been previously established.³⁸⁾ The cellular uptake of the empty-LNP_SM-102 by the mLECs was analyzed by flow cytometry. As control cells, a mouse monocyte/macrophage cell line RAW 264.7 cells were used. Both mLEC cells and RAW 264.7 cells were treated with 0.2% DiD-labeled empty-LNP_SM-102 ranging from 0.25-1 mM (Figs. 2A–D). At 4 h after the incubation, the percentages of DiD-positive cells were nearly 100% in both the mLECs and RAW 264.7 cells. The mean fluorescence intensity (MFI) of the DiD-positive cells increased depending on the dose of the empty-LNP_SM-102.

Fig. 2. Cellular Uptake and Ccl2 Expression in mLECs and RAW 264.7 Cells

Flow cytometry analysis of the uptake of empty-LNP_SM-102 labeled with DiD in mLECs (A, C) or RAW 264.7 cells (B, D). The expression of Ccl2 mRNA in mLECs (E) and RAW 264.7 cells (F) were analyzed by qPCR. Each bar indicates the mean ± S.E.M. (n = 3). Statistical analyses were performed with one-way ANOVA, * p < 0.05; ** p < 0.01; *** p < 0.001.

After treating mLECs and RAW 264.7 cells with empty-LNP_SM-102, they were lysed and cellular mRNA was extracted. The expression of Ccl2 mRNA was evaluated by RT-PCR. The results indicated that Ccl2 was significantly up-regulated in the mLECs and that this upregulation was dose-dependent (Fig. 2E). In contrast, no obvious differences in Ccl2 expression were observed in RAW 264.7 cells (Fig. 2F). It should be noted that the RAW 264.7 cells used in this study have the ability to produce Ccl2 since the treatment with lipopolysaccharide (LPS) induced the robust up-regulation of Ccl2 in these RAW 264.7 cells (Supplementary Fig. S1). These results indicate that mLECs represent possible cells that could directly respond to the empty-LNP_SM-102.

A Set of Chemokines Was Induced by the Empty-LNP_SM-102 Treatment

To investigate other proteins whose expression was changed after the empty-LNP_SM-102 treatment, an RNA-seq analysis was carried out at 4 h after the treatment with the empty-LNP_SM-102. The top 1000 genes with large deviations between the empty-LNP_SM-102 and vehicle (PBS) were classified into 3 clusters (Fig. 3A). Clusters A and B included genes that were down-regulated and up-regulated by the empty-LNP_SM-102, respectively. Cluster C contained genes with large deviations among the samples. The enrichment analysis of the pathways using KEGG suggested that cluster B contained genes related to the inflammatory reaction, while cluster A showed no enrichment of these pathways (Fig. 3B). Genes that were enriched in cluster B included Nfkbia (IkBa), Lcn2, Cxcl5, Cxcl1, Ccl7, Ccl2, Cxcl2, Lif, and Icam1. The differentially expressed genes (DEGs) were then analyzed. As shown in Fig. 3C, a series of chemokines was also listed in the 108 up-regulated genes. These observations suggest that mLECs can respond to the LNPs and trigger the recruitment of immune cells in the lymphatic system.

Fig. 3. RNA Sequencing Analysis of mLECs after Treatment with Empty-LNP_SM-102

Four hours after the treatment with the empty-LNP_SM-102, mRNA of the mLECs was extracted and an RNA sequence analysis was performed. Results of the clustering analysis (A). Enriched pathways included in Cluster B (B). Analysis of differential expressed genes (DEGs) (C).

Validation of the mRNA Expression of Chemokines Derived from RNA-Sequencing

The up-regulation of chemokines other than Ccl2 was evaluated by RT-PCR to validate the RNA-sequencing (seq) results. As a result, the expression of Cxcl1 and Ccl7 in mLECs was significantly up-regulated by the treatment with the empty-LNP_SM-102. The expression of Cxcl2 and Cxcl5 could not be analyzed because of the intrinsically low expression level (Fig. 3C). These results serve to confirm that the production of chemokines from mLECs was increased by the empty-LNP_SM-102 (Fig. 4A). It is also noteworthy that the expression of chemokines in RAW 264.7 cells was not observed (Fig. 4B).

Fig. 4. Up-Regulation of Chemokines

Increase in chemokine mRNA found in the RNA-sequencing analysis was validated. The mRNA expression of Ccl2 and Cxcl1 in mLECs (A) and RAW 264.7 cells (B). The statistical significance was determined by the Student’s t-test.

Validation of Chemokine Induction by ELISA

The secretion of the chemokines was further measured by ELISA. Consistent with the results for mRNA expression, an increase in the concentration of Ccl2 was observed at 4 h after the LNP_SM-102-treatment (Fig. 5A). In addition, the LNP_SM-102 showed a tendency to increase the protein expression of Ccl7 and Cxcl1 (Figs. 5B, C), but this increase was not statistically significant.

Fig. 5. Production of Chemokines from mLECs by Empty-LNP_SM-102

Production of Ccl2, Ccl7, and Cxcl1 were measured by ELISA. The results were (A) The protein expression of Ccl2 increased significantly after the treatment with the LNP_SM-102. (B, C) A increasing tendency was found in Ccl7 and Cxcl1 upon treatment with the empty-LNP_SM-102. The statistical significance was determined by ANOVA, * p < 0.05; ** p < 0.01; *** p < 0.001.

DISCUSSION

Recent studies have shown that LNPs cause the maturation and activation of peripheral blood monocytes (PBMCs), and interleukin (IL)-1β is a key regulator of the immune responses that are induced by mRNA-LNP_SM-102in vitro.⁴⁴⁾ In an in vitro study, following 6 or 24 h of treatment with empty LNPs, the production of pro-inflammatory cytokines and chemokines such as IL-6, IFNγ and CXCL13 was significantly elevated in the supernatants of monocyte-derived dendritic cells isolated from human PBMC—the maturation of both cDC1 and cDC2 subsets was observed.³⁵⁾ However, the empty liposomes had induced no cytokines 4 h after treatment. It was reported that LNPs exacerbated inflammation.⁴⁵⁾ In other words, when previously stimulated phagocytes took up the LNPs, the production of inflammatory cytokines was significantly increased. In this case, LNP treatment is a secondary stimulus and not the starting point for an immune response. It is possible that the first response is induced by the stimulation of non-immune cells, and that the LNPs only amplify the inflammatory reactions. It was also reported that mRNA-LNPs induced the production of inflammatory cytokines such as IL-6, tumor necrosis factor α (TNFα), and IFNβ.⁴⁶⁾ These reports indicated that, even when the quality of mRNA was improved, the mRNA molecules still contribute to the stimulation of innate immune.^44,46) Therefore, the mechanism responsible for the initial immune activation and the cells that are responsible for directly sensing the LNPs has not been fully identified.

It is possible that humoral factors produced from non-immune cells could serve as starting points for immune activation. Non-immune cells in the skin and muscle, which includes epithelial cells, epidermal keratinocytes, and stromal cells, are expected to participate in innate immune responses, and not simply as only the structural architecture.⁴⁷⁾ For example, epithelial cells elicit TSLP, IL-33, and IL-25 type 2 immunity against infections, allergies, and chemical injuries.⁴⁸⁾ CXCL1, CXCL2, CXCL8, and CCL20-produced keratinocytes recruit neutrophils and IL-17-produced immune cells in the development of psoriasis.⁴⁹⁾ Fibroblasts sense dangers such as DAMPs and PAMPs via TLRs, and react to the dangers via the secretion of chemokines such as CXCL9 and CXCL10.^50,51)

Non-immune cells are also involved in the trafficking of antigens from the injection site via the s.c. and/or i.m. injection sites of vaccine. For example, a study showed that after 6 h of an i.m. administration of enhanced green fluorescent protein (EGFP) mRNA-LNP vaccine, the mRNA and EGFP protein was detectable in both infiltrating cells and the cells of connective tissue and adipose tissue, such as fibroblasts and adipocytes, at the injection sites in rodents. Similar results were observed in NHPs 8 h following injection.⁵²⁾ However, it was also reported that skin keratinocytes and fibroblasts were less likely to be the responders of LNP_SM-102,⁵³⁾ since the uptake of LNP_SM-102 by these cells in human skin cell suspension (hSCS) was extremely low. On the other hand, the LECs in the body could have taken up the LNPs via apolipoprotein in an E-dependent manner.³⁸⁾ Therefore, the LECs are important candidate cells that contribute to the priming of the innate immune response induced by LNPs.

In this study, we report that the mLECs can produce chemokines in response to treatment with empty-LNPs. We focused on mLECs as the target cells based on the results that antibody production was dependent on the route of administration (Fig. 1). No anti-OVA IgG production was detected, even after a booster administration of the mOVA-LNP_SM-102 via i.v. injection, while both s.c. and i.m. injection induced a high humoral immunity. The efficient production of the antibodies against the antigen encoded in the mRNA could be observed when the mRNA-LNPs were topically administered. It is known that mRNA-LNPs administrated i.v. are taken up by liver parenchyma cells via Apolipoprotein E (ApoE)-Low Density Lipoprotein Receptor (LDLR) systems.⁵⁴⁾ On the other hand, when administered to the skin and/or muscle, the LNPs are drained into the lymphatic systems where they flow to lymph nodes via lymphatic vessels,^41,55) and the LNPs were also taken up by mLECs that are present in the skin around the site of administration in vivo.³⁸⁾

A response of lymphatic system against an approved adjuvant AS01 was reported.⁵⁶⁾ After the injection of AS01 with Hepatitis B virus antigens (HBsAg), the migration of lymphocytes through lymphatic vessels was tracked by lymphatic cannulation. The results indicated that CD14⁺ monocytes and neutrophils migrated to the afferent lymphatics of both iliac and prefemoral lymph nodes in 4–12 h. Increased antigen-specific MHC^high DCs were then observed at 48 h after post vaccination. In vivo studies of mRNA-LNPs showed that gene expression monitored based on the bioluminescence of luciferase was measurable at 3 h-post injection,⁵⁷⁾ and that serum cytokine responses and chemokines peaked at 6 h after immunization.¹⁸⁾ Early events of in vivo cytokine profiles sensing to LNPs after primary immunization was investigated at 4 h after the LNPs treatment.⁵⁸⁾ The adjuvant activity of the empty-LNPs was minimized within 24 h: an immune response was not observed when the antigen protein was injected to the same site 24 h after the preliminary injection of the empty-LNP. These observations indicate that immune stimulation by the mRNA-LNPs would occur quickly when they were injected, but would be rapidly reduced within 24 h. Based on this information, we investigated the innate immune response at 4 h after the empty-LNP _SM-102 treatment.

The recruitment of the innate immune cells to the injection sites and subsequent drainage to draining lymph nodes via lymphatic vessels is an important step in the vaccination process.^18,55,59,60) In the case of mRNA-LNPs, the infiltration of neutrophils/monocytes at the site of injection is a well known phenomenon.²⁷⁾ Chemokines are vital for governing the trafficking and positioning of leukocytes while regulating immune responses within lymphoid tissue.⁶¹⁾ Therefore, the production of Ccl2, an important chemokine which recruits monocytes/neutrophils, from the mLECs was investigated. As a result, the empty-LNP_SM-102 treatment induced a dose-dependent up-regulation of Ccl2 mRNA. An up-regulation of Ccl2 requires a very high concentration of LNPs: more than 1 mM of total lipids. Reaching such a concentration would be reasonable, however, since particles administered topically are not diluted by body fluids compared with those administered via the blood. This suggests that the tissues at the injection site would have been exposed to a high concentration of LNPs. For example, if one microgram of mRNA-LNP_SM-102 with an N/P ratio of 5.5 is administered in a volume of 20–50 µL, the calculations indicate that the cells at the injection site would be exposed to a concentration of LNPs equivalent to 0.5–1.5 mM total lipid. In a clinical situation, 100 µg of RNA is generally injected. Thus, the injection site is exposed to much higher concentrations of lipids. To test whether the production of chemokines is dependent on cell damage due to the high concentration of LNPs, the viability of the cells was investigated. The cells did not show a decrease in cell viability even at high concentrations of up to 1 mM (Supplementary Fig. S4). Therefore, we could conclude that cell damage-associated immune stimulation is not a main cause of chemokine production from mLECs in the setup of our experiment.

RNA-seq analysis revealed that the production of Ccl7, Cxcl1, Cxcl2, and Cxcl5 was also up-regulated. This observation is in agreement with findings reported in a previous study, namely that RNA vaccines induced both neutrophil infiltration and chemokine production including Ccl2, Ccl7, Cxcl1, and Cxcl2 at the injection site.²⁷⁾ Therefore, in vitro studies with mLECs could, at least in part, reproduce the phenomena occurring in vivo. An increase in the concentration of the adhesion molecule Icam-1 was generally observed in the activated endothelial cells.^62–64) It was confirmed that Icam-1 is expressed in stimulated mLECs, and it further induced the migration of DCs,⁶⁵⁾ neutrophils.⁶⁶⁾ The migration of CD4⁺ T cells from inflamed skin to draining lymph nodes is then accelerated.⁶⁷⁾ Previous studies showed that 18 h stimulation with chemokine Ccl2 induced the expression of Icam-1 on human lymphatic endothelial cells.⁶⁸⁾ These results suggest that mLECs, after being stimulated by LNP_SM-102, might attract innate immune cells by producing chemokines, and this may stimulate these those cells to migrate to the lymph node via Icam-1.

While chemokines can induce further cytokine production,^69–73) it is still difficult to conclude that mLECs are the cells that are responsible for causing the inflammatory response. It should be noted here that Zc3h12a, also referred to as Regnase-1, was induced by the empty-LNP_SM-102. This protein specifically degrades the mRNA of Il-6 and Il-12. Nfkbia (IkBa), an inhibitor of NF-κB signaling, was also found to be up-regulated by the empty-LNP_SM-102 in mLECs. These observations suggest that mLECs simply recruit neutrophils/monocytes, but not induce an inflammatory response. To establish an in vitro assay that can reproduce the in vivo immune stimulation-related events, it will be necessary to analyze the contribution of other cells by means of co-culture experiments with mLECs. Cytokine and chemokine-mediated leukocyte inflammation⁷⁴⁾ is important, not only for the vaccination efficiency of an RNA vaccine but is also responsible for the adverse effects (AEs).^18,27,75,76) Therefore, if a system could be developed that can reproduce the in vivo inflammatory response based on LECs, it could also be used for safety evaluation.

Meanwhile, the mRNA expression level of Ccl2 in RAW 264.7 cells was not increased by the empty-LNP_SM102 treatment (Fig. 2B). In addition to this, a monocyte/macrophage cell line, bone marrow-derived dendritic cells (Supplementary Figs. S2A, B) do not respond to the empty-LNP_SM-102 either, while they are able to take up these particles (Supplementary Fig. S2C). This observation suggests that the contribution of these phagocytes is marginal in the initial stage of LNPs-triggered innate immune-stimulation.

The mechanism responsible for the up-regulation of chemokines in mLECs remains to be clarified. mLECs contain pattern recognition receptors (PRRs) such as TLR2, TLR3, TLR4, and TLR5. As a result, mLECs can intrinsically respond to Pathogen Associated Molecular Pattern Molecules (PAMPs) and Damage Associated Molecular Pattern molecules (DAMPs).^77–79) However, given the fact that these PRRs are also present on phagocytic cells, it is not likely that LEC produce chemokines in a PRR-dependent manner. Proinflammatory cytokines and chemokines could also be produced by integrated stress response (ISR),⁸⁰⁾ which share the phosphorylation eukaryotic translation initiation factor 2α. The transient down-regulation of the translation of and subsequent transcriptional regulation induces inflammation or cell death. For example, stress caused by the infectious bronchitis virus results in the production of chemokine IL-8 in the lung adenocarcinoma cell line H1299.⁸⁰⁾ The contribution of the ISR should be investigated in the future.

CONCLUSION

In the present study, we confirm that mLECs respond to empty-LNPs by inducing the production of chemokines such as Ccl2. This system reproduces, at least in part, the phenomenon that occurs at an early stage of in vivo response to the mRNA-LNPs. While it is plausible that these chemokines attract cells in the blood circulation to the injection site, the further cellular interaction towards pro-inflammatory responses remains to be clarified. These findings will be useful for the development of more efficient and safer RNA vaccines.

Acknowledgments

The authors wish to thank Dr. M. S. Feather for his helpful advice in writing the English manuscript.

Funding

H. Tanaka and H. Akita were supported by a JST CREST grant [JPMJCR17H1]. H. Akita is also supported by AMED (JP223fa627002, 21am0401030h0001, 22am0401030h0002 and 23am0401030h0003), and partially by the JSPS KAKENHI [21K18320], The Asahi Glass Foundation and The Canon Foundation. H. Tanaka was supported by the JSPS KAKENHI [21K18035], and Kato Memorial Bioscience Foundation.

Author Contributions

Conceptualization; H. T., Y. S., H. A., Data curation; Y. L., H. T., M. S., Formal Analysis; Y. L., H. T., M. S., Y. S., Funding acquisition; H. T., H. A., Investigation Y. L., M. S., Methodology; Y. L., M. S., Project administration; H. T., H. A. Resources Y. S., Software; not applicable, Supervision; H. H., H. A., Validation; H. T., Y. S., H. T., Visualization; Y. L., H. T., Writing—original draft; H. T., Y. L., Writing—review & editing; H. T., Y. L., M. S., Y. S., H. H., H. A.

Y. L., H. T., and M. S. contributed equally.

Conflict of Interest

The authors declare no conflict of interest.

Data Availability

The data that support the findings of this study are available from the corresponding authors, H.T. and H.A., upon reasonable request.

Supplementary Materials

This article contains supplementary materials. The following files are available at free of charge: List of information on suppliers of the reagents, Supplementary figures (Figs. S1–S4) (PDF).

REFERENCES

• 1) Feng C, Li Y, Ferdows BE, Patel DN, Ouyang J, Tang Z, Kong N, Chen E, Tao W. Emerging vaccine nanotechnology: from defense against infection to sniping cancer. Acta Pharm. Sin. B, 12, 2206–2223 (2022).
• 2) Fang E, Liu X, Li M, Zhang Z, Song L, Zhu B, Wu X, Liu J, Zhao D, Li Y. Advances in COVID-19 mRNA vaccine development. Signal Transduct. Target. Ther., 7, 94 (2022).
• 3) Chaudhary N, Weissman D, Whitehead KA. mRNA vaccines for infectious diseases: principles, delivery and clinical translation. Nat. Rev. Drug Discov., 20, 817–838 (2021).
• 4) Domazet-Lošo T. mRNA vaccines: why is the biology of retroposition ignored? Genes (Basel), 13, 719 (2022).
• 5) Pardi N, Hogan MJ, Porter FW, Weissman D. mRNA vaccines—a new era in vaccinology. Nat. Rev. Drug Discov., 17, 261–279 (2018).
• 6) Jackson NAC, Kester KE, Casimiro D, Gurunathan S, DeRosa F. The promise of mRNA vaccines: a biotech and industrial perspective. NPJ Vaccines, 5, 11 (2020).
• 7) Iavarone C, O’Hagan DT, Yu D, Delahaye NF, Ulmer JB. Mechanism of action of mRNA-based vaccines. Expert Rev. Vaccines, 16, 871–881 (2017).
• 8) Liu T, Liang Y, Huang L. Development and delivery systems of mRNA vaccines. Front. Bioeng. Biotechnol., 9, 718753 (2021).
• 9) Stepinski J, Waddell C, Stolarski R, Darzynkiewicz E, Rhoads RE. Synthesis and properties of mRNAs containing the novel “anti-reverse” cap analogs 7-methyl(3′-O-methyl)GpppG and 7-methyl (3′-deoxy)GpppG. RNA, 7, 1486–1495 (2001).
• 10) Gallie DR. The cap and poly(A) tail function synergistically to regulate mRNA translational efficiency. Genes Dev., 5, 2108–2116 (1991).
• 11) Ross J, Sullivan TD. Half-lives of beta and gamma globin messenger RNAs and of protein synthetic capacity in cultured human reticulocytes. Blood, 66, 1149–1154 (1985).
• 12) Schuberth-Wagner C, Ludwig J, Bruder AK, Herzner AM, Zillinger T, Goldeck M, Schmidt T, Schmid-Burgk JL, Kerber R, Wolter S, Stümpel JP, Roth A, Bartok E, Drosten C, Coch C, Hornung V, Barchet W, Kümmerer BM, Hartmann G, Schlee M. A Conserved histidine in the RNA sensor RIG-I controls immune tolerance to N1-2'O-methylated self RNA. Immunity, 43, 41–51 (2015).
• 13) Abbas YM, Laudenbach BT, Martínez-Montero S, Cencic R, Habjan M, Pichlmair A, Damha MJ, Pelletier J, Nagar B. Structure of human IFIT1 with capped RNA reveals adaptable mRNA binding and mechanisms for sensing N1 and N2 ribose 2′-O methylations. Proc. Natl. Acad. Sci. U.S.A., 114, E2106–E2115 (2017).
• 14) Freund I, Eigenbrod T, Helm M, Dalpke AH. RNA modifications modulate activation of innate Toll-like receptors. Genes (Basel), 10, 92 (2019).
• 15) Mo Z, Li Q, Cai L, Zhan M, Xu Q. The effect of DNA methylation on the miRNA expression pattern in lipopolysaccharide-induced inflammatory responses in human dental pulp cells. Mol. Immunol., 111, 11–18 (2019).
• 16) Mu X, Greenwald E, Ahmad S, Hur S. An origin of the immunogenicity of in vitro transcribed RNA. Nucleic Acids Res., 46, 5239–5249 (2018).
• 17) Foster JB, Choudhari N, Perazzelli J, Storm J, Hofmann TJ, Jain P, Storm PB, Pardi N, Weissman D, Waanders AJ, Grupp SA, Kariko K, Resnick AC, Barrett DM. Purification of mRNA encoding chimeric antigen receptor is critical for generation of a robust T-cell response. Hum. Gene Ther., 30, 168–178 (2019).
• 18) Verbeke R, Hogan MJ, Loré K, Pardi N. Innate immune mechanisms of mRNA vaccines. Immunity, 55, 1993–2005 (2022).
• 19) Tanaka H, Takata N, Sakurai Y, Yoshida T, Inoue T, Tamagawa S, Nakai Y, Tange K, Yoshioka H, Maeki M, Tokeshi M, Akita H. Delivery of oligonucleotides using a self-degradable lipid-like material. Pharmaceutics, 13, 544 (2021).
• 20) Han X, Zhang H, Butowska K, Swingle KL, Alameh MG, Weissman D, Mitchell MJ. An ionizable lipid toolbox for RNA delivery. Nat. Commun., 12, 7233 (2021).
• 21) Alameh MG, Weissman D, Pardi N. Messenger RNA-based vaccines against infectious diseases. Curr. Top. Microbiol. Immunol., 440, 111–145 (2022).
• 22) Alameh MG, Tombácz I, Bettini E, et al. Lipid nanoparticles enhance the efficacy of mRNA and protein subunit vaccines by inducing robust T follicular helper cell and humoral responses. Immunity, 54, 2877–2892.e7 (2021).
• 23) Jackson LA, Anderson EJ, Rouphael NG, et al. An mRNA vaccine against SARS-CoV-2—preliminary report. N. Engl. J. Med., 383, 1920–1931 (2020).
• 24) Mulligan MJ, Lyke KE, Kitchin N, et al. Phase I/II study of COVID-19 RNA vaccine BNT162b1 in adults. Nature, 586, 589–593 (2020).
• 25) Matsumura T, Takano T, Takahashi Y. Immune responses related to the immunogenicity and reactogenicity of COVID-19 mRNA vaccines. Int. Immunol., 35, 213–220 (2023).
• 26) Li C, Lee A, Grigoryan L, et al. Mechanisms of innate and adaptive immunity to the Pfizer-BioNTech BNT162b2 vaccine. Nat. Immunol., 23, 543–555 (2022).
• 27) Ndeupen S, Qin Z, Jacobsen S, Bouteau A, Estanbouli H, Igyártó BZ. The mRNA-LNP platform’s lipid nanoparticle component used in preclinical vaccine studies is highly inflammatory. iScience, 24, 103479 (2021).
• 28) Painter MM, Mathew D, Goel RR, et al. Rapid induction of antigen-specific CD4⁺ T cells is associated with coordinated humoral and cellular immunity to SARS-CoV-2 mRNA vaccination. Immunity, 54, 2133–2142.e3 (2021).
• 29) Oberhardt V, Luxenburger H, Kemming J, et al. Rapid and stable mobilization of CD8⁺ T cells by SARS-CoV-2 mRNA vaccine. Nature, 597, 268–273 (2021).
• 30) Goel RR, Painter MM, Apostolidis SA, et al. mRNA vaccines induce durable immune memory to SARS-CoV-2 and variants of concern. Science, 374, abm0829 (2021).
• 31) Bergamaschi C, Pagoni M, Rosati M, Angel M, Tzannou I, Vlachou M, Darmani I, Ullah A, Bear J, Devasundaram S, Burns R, Baltadakis I, Gigantes S, Dimopoulos MA, Pavlakis GN, Terpos E, Felber BK. Reduced antibodies and innate cytokine changes in SARS-CoV-2 BNT162b2 mRNA vaccinated transplant patients with hematological malignancies. Front. Immunol., 13, 899972 (2022).
• 32) Sahin U, Muik A, Vogler I, et al. BNT162b2 vaccine induces neutralizing antibodies and poly-specific T cells in humans. Nature, 595, 572–577 (2021).
• 33) Sanyal G. Development of functionally relevant potency assays for monovalent and multivalent vaccines delivered by evolving technologies. NPJ Vaccines, 7, 50 (2022).
• 34) Akkermans A, Chapsal JM, Coccia EM, et al. Animal testing for vaccines. Implementing replacement, reduction and refinement: challenges and priorities. Biologicals, 68, 92–107 (2020).
• 35) Connors J, Joyner D, Mege NJ, Cusimano GM, Bell MR, Marcy J, Taramangalam B, Kim KM, Lin PJC, Tam YK, Weissman D, Kutzler MA, Alameh MG, Haddad EK. Lipid nanoparticles (LNP) induce activation and maturation of antigen presenting cells in young and aged individuals. Commun. Biol., 6, 188 (2023).
• 36) Lee J, Kim D, Byun J, Wu Y, Park J, Oh YK. In vivo fate and intracellular trafficking of vaccine delivery systems. Adv. Drug Deliv. Rev., 186, 114325 (2022).
• 37) Chen K, Fan N, Huang H, Jiang X, Qin S, Xiao W, Zheng Q, Zhang Y, Duan X, Qin Z, Liu Y, Zeng J, Wei Y, Song X. mRNA vaccines against SARS-CoV-2 variants delivered by lipid nanoparticles based on novel ionizable lipids. Adv. Funct. Mater., 32, 2204692 (2022).
• 38) Sakurai Y, Yoshikawa K, Arai K, Kazaoka A, Aoki S, Ito K, Nakai Y, Tange K, Furihata T, Tanaka H, Akita H. siRNA delivery to lymphatic endothelial cells via ApoE-mediated uptake by lipid nanoparticles. J. Control. Release, 353, 125–133 (2023).
• 39) Ge SX, Son EW, Yao R. iDEP: an integrated web application for differential expression and pathway analysis of RNA-Seq data. BMC Bioinformatics, 19, 534 (2018).
• 40) Gomi M, Sakurai Y, Okada T, Miura N, Tanaka H, Akita H. Development of sentinel LN imaging with a combination of HAase based on a comprehensive analysis of the intra-lymphatic kinetics of LPs. Mol. Ther., 29, 225–235 (2021).
• 41) Gomi M, Sakurai Y, Sato M, Tanaka H, Miyatake Y, Fujiwara K, Watanabe M, Shuto S, Nakai Y, Tange K, Hatakeyama H, Akita H. Delivering mRNA to secondary lymphoid tissues by phosphatidylserine-loaded lipid nanoparticles. Adv. Healthc. Mater., 12, 2202528 (2023).
• 42) Chen J, Ye Z, Huang C, Qiu M, Song D, Li Y, Xu Q. Lipid nanoparticle-mediated lymph node-targeting delivery of mRNA cancer vaccine elicits robust CD8⁺ T cell response. Proc. Natl. Acad. Sci. U.S.A., 119, e2207841119 (2022).
• 43) Suzuki Y, Miyazaki T, Muto H, Kubara K, Mukai Y, Watari R, Sato S, Kondo K, Tsukumo SI, Yasutomo K, Ito M, Tsukahara K. Design and lyophilization of lipid nanoparticles for mRNA vaccine and its robust immune response in mice and nonhuman primates. Mol. Ther. Nucleic Acids, 30, 226–240 (2022).
• 44) Tahtinen S, Tong AJ, Himmels P, Oh J, Paler-Martinez A, Kim L, Wichner S, Oei Y, McCarron MJ, Freund EC, Amir ZA, de la Cruz CC, Haley B, Blanchette C, Schartner JM, Ye W, Yadav M, Sahin U, Delamarre L, Mellman I. IL-1 and IL-1ra are key regulators of the inflammatory response to RNA vaccines. Nat. Immunol., 23, 532–542 (2022).
• 45) Parhiz H, Brenner JS, Patel PN, et al. Added to pre-existing inflammation, mRNA-lipid nanoparticles induce inflammation exacerbation (IE). J. Control. Release, 344, 50–61 (2022).
• 46) Moradian H, Roch T, Anthofer L, Lendlein A, Gossen M. Chemical modification of uridine modulates mRNA-mediated proinflammatory and antiviral response in primary human macrophages. Mol. Ther. Nucleic Acids, 27, 854–869 (2022).
• 47) Cavagnero KJ, Gallo RL. Essential immune functions of fibroblasts in innate host defense. Front. Immunol., 13, 1058862 (2022).
• 48) Roan F, Obata-Ninomiya K, Ziegler SF. Epithelial cell-derived cytokines: more than just signaling the alarm. J. Clin. Invest., 129, 1441–1451 (2019).
• 49) Furue M, Furue K, Tsuji G, Nakahara T. Interleukin-17A and keratinocytes in psoriasis. Int. J. Mol. Sci., 21, 1275 (2020).
• 50) Wang J, Duan Z, Chen X, Li M. The immune function of dermal fibroblasts in skin defence against pathogens. Exp. Dermatol., 32, 1326–1333 (2023).
• 51) Crowley T, Buckley CD, Clark AR. Stroma: the forgotten cells of innate immune memory. Clin. Exp. Immunol., 193, 24–36 (2018).
• 52) Hassett KJ, Rajlic IL, Bahl K, White R, Cowens K, Jacquinet E, Burke KE. mRNA vaccine trafficking and resulting protein expression after intramuscular administration. Mol. Ther. Nucleic Acids, 35, 102083 (2024).
• 53) Chang DF, Court KA, Holgate R, Davis EA, Bush KA, Quick AP, Spiegel AJ, Rahimi M, Cooke JP, Godin B. Telomerase mRNA enhances human skin engraftment for wound healing. Adv. Healthc. Mater., 13, 2302029 (2024).
• 54) Shimosakai R, Khalil IA, Kimura S, Harashima H. mRNA-loaded lipid nanoparticles targeting immune cells in the spleen for use as cancer vaccines. Pharmaceuticals (Basel), 15, 1017 (2022).
• 55) Irvine DJ, Aung A, Silva M. Controlling timing and location in vaccines. Adv. Drug Deliv. Rev., 158, 91–115 (2020).
• 56) Neeland MR, Shi W, Collignon C, Taubenheim N, Meeusen EN, Didierlaurent AM, de Veer MJ. The lymphatic immune response induced by the adjuvant AS01: a comparison of intramuscular and subcutaneous immunization routes. J. Immunol., 197, 2704–2714 (2016).
• 57) Sabnis S, Kumarasinghe ES, Salerno T, Mihai C, Ketova T, Senn JJ, Lynn A, Bulychev A, McFadyen I, Chan J, Almarsson Ö, Stanton MG, Benenato KE. A novel amino lipid series for mRNA delivery: improved endosomal escape and sustained pharmacology and safety in non-human primates. Mol. Ther., 26, 1509–1519 (2018).
• 58) Tregoning JS, Stirling DC, Wang Z, Flight KE, Brown JC, Blakney AK, McKay PF, Cunliffe RF, Murugaiah V, Fox CB, Beattie M, Tam YK, Johansson C, Shattock RJ. Formulation, inflammation, and RNA sensing impact the immunogenicity of self-amplifying RNA vaccines. Mol. Ther. Nucleic Acids, 31, 29–42 (2023).
• 59) Tozuka M, Oka T, Jounai N, Egawa G, Ishii KJ, Kabashima K, Takeshita F. Efficient antigen delivery to the draining lymph nodes is a key component in the immunogenic pathway of the intradermal vaccine. J. Dermatol. Sci., 82, 38–45 (2016).
• 60) Backlund CM, Holden RL, Moynihan KD, Garafola D, Farquhar C, Mehta NK, Maiorino L, Pham S, Iorgulescu JB, Reardon DA, Wu CJ, Pentelute BL, Irvine DJ. Cell-penetrating peptides enhance peptide vaccine accumulation and persistence in lymph nodes to drive immunogenicity. Proc. Natl. Acad. Sci. U.S.A., 119, e2204078119 (2022).
• 61) Oo YH, Shetty S, Adams DH. The role of chemokines in the recruitment of lymphocytes to the liver. Dig. Dis., 28, 31–44 (2010).
• 62) Bogunovic M, Ginhoux F, Wagers A, Loubeau M, Isola LM, Lubrano L, Najfeld V, Phelps RG, Grosskreutz C, Scigliano E, Frenette PS, Merad M. Identification of a radio-resistant and cycling dermal dendritic cell population in mice and men. J. Exp. Med., 203, 2627–2638 (2006).
• 63) Sawa Y, Ueki T, Hata M, Iwasawa K, Tsuruga E, Kojima H, Ishikawa H, Yoshida S. LPS-induced IL-6, IL-8, VCAM-1, and ICAM-1 expression in human lymphatic endothelium. J. Histochem. Cytochem., 56, 97–109 (2008).
• 64) Bui TM, Wiesolek HL, Sumagin R. ICAM-1: a master regulator of cellular responses in inflammation, injury resolution, and tumorigenesis. J. Leukoc. Biol., 108, 787–799 (2020).
• 65) Johnson LA, Clasper S, Holt AP, Lalor PF, Baban D, Jackson DG. An inflammation-induced mechanism for leukocyte transmigration across lymphatic vessel endothelium. J. Exp. Med., 203, 2763–2777 (2006).
• 66) Rigby DA, Ferguson DJ, Johnson LA, Jackson DG. Neutrophils rapidly transit inflamed lymphatic vessel endothelium via integrin-dependent proteolysis and lipoxin-induced junctional retraction. J. Leukoc. Biol., 98, 897–912 (2015).
• 67) Teijeira A, Hunter MC, Russo E, Proulx ST, Frei T, Debes GF, Coles M, Melero I, Detmar M, Rouzaut A, Halin C. T cell migration from inflamed skin to draining lymph nodes requires intralymphatic crawling supported by ICAM-1/LFA-1 interactions. Cell Rep., 18, 857–865 (2017).
• 68) Kawai Y, Kaidoh M, Yokoyama Y, Sano K, Ohhashi T. Chemokine CCL2 facilitates ICAM-1-mediated interactions of cancer cells and lymphatic endothelial cells in sentinel lymph nodes. Cancer Sci., 100, 419–428 (2009).
• 69) Gschwandtner M, Derler R, Midwood KS. More than just attractive: how CCL2 influences myeloid cell behavior beyond chemotaxis. Front. Immunol., 10, 2759 (2019).
• 70) Laufer JM, Legler DF. Beyond migration—chemokines in lymphocyte priming, differentiation, and modulating effector functions. J. Leukoc. Biol., 104, 301–312 (2018).
• 71) Hou SM, Chen PC, Lin CM, Fang ML, Chi MC, Liu JF. CXCL1 contributes to IL-6 expression in osteoarthritis and rheumatoid arthritis synovial fibroblasts by CXCR2, c-Raf, MAPK, and AP-1 pathway. Arthritis Res. Ther., 22, 251 (2020).
• 72) Guo L, Li N, Yang Z, Li H, Zheng H, Yang J, Chen Y, Zhao X, Mei J, Shi H, Worthen GS, Liu L. Role of CXCL5 in regulating chemotaxis of innate and adaptive leukocytes in infected lungs upon pulmonary influenza infection. Front. Immunol., 12, 785457 (2021).
• 73) Brunner PM, Glitzner E, Reininger B, Klein I, Stary G, Mildner M, Uhrin P, Sibilia M, Stingl G. CCL7 contributes to the TNF-alpha-dependent inflammation of lesional psoriatic skin. Exp. Dermatol., 24, 522–528 (2015).
• 74) Harada A, Sekido N, Akahoshi T, Wada T, Mukaida N, Matsushima K. Essential involvement of interleukin-8 (IL-8) in acute inflammation. J. Leukoc. Biol., 56, 559–564 (1994).
• 75) Trougakos IP, Terpos E, Alexopoulos H, Politou M, Paraskevis D, Scorilas A, Kastritis E, Andreakos E, Dimopoulos MA. Adverse effects of COVID-19 mRNA vaccines: the spike hypothesis. Trends Mol. Med., 28, 542–554 (2022).
• 76) Sprent J, King C. COVID-19 vaccine side effects: the positives about feeling bad. Sci. Immunol., 6, eabj9256 (2021).
• 77) Rodrigues LOCP, Graça RSF, Carneiro LAM. Integrated stress responses to bacterial pathogenesis patterns. Front. Immunol., 9, 1306 (2018).
• 78) Wu Y, Zhang Z, Li Y, Li Y. The regulation of integrated stress response signaling pathway on viral infection and viral antagonism. Front. Microbiol., 12, 814635 (2022).
• 79) Kubelkova K, Bostik V, Joshi L, Macela A. Innate immune recognition, integrated stress response, infection, and tumorigenesis. Biology (Basel), 12, 499 (2023).
• 80) Zhu QC, Li S, Yuan LX, Chen RA, Liu DX, Fung TS. Induction of the proinflammatory chemokine interleukin-8 is regulated by integrated stress response and AP-1 family proteins activated during coronavirus infection. Int. J. Mol. Sci., 22, 5646 (2021).