Causes of Sex Differences in Serum Cholesterol and Triglyceride Levels in Meishan Pigs

Abstract

To clarify the causes of sex differences (male < female) in the serum total cholesterol (TCHO) and triglyceride (TG) levels in Meishan pigs, we examined the sex differences in mRNA levels of key hepatic enzymes involved in the biosynthesis/metabolism of cholesterol and TG using real-time RT-PCR. There were no sex differences in mRNA levels of 3-hydroxy-3-methylglutaryl-CoA reductase and CYP51A1 for cholesterol biosynthesis, or of the rate-limiting enzyme CYP7A1 for bile acid synthesis from cholesterol. By contrast, sex differences (male < female) were observed in mRNA levels of glycerol-3-phosphate acyltransferase 1 (GPAT1), a rate-limiting enzyme for TG biosynthesis. However, the sex differences in mRNA levels of carnitine palmitoyltransferase 1A (CPT1A) and acyl-CoA dehydrogenase long chain (ACADL), key enzymes for the oxidation of the fatty acids that are structural components of TG, were the opposite (male > female). Castration of male pigs led to an increase in the mRNA level of GPAT1 and decreases in those of CPT1A and ACADL. Furthermore, testosterone propionate (TP)-treatment of castrated males and intact females restored and changed, respectively, these mRNA levels to those of intact males. Notably, castration and TP-treatment increased and decreased, respectively, serum and hepatic TG levels. These findings suggest that sex differences in the serum and hepatic TG levels in Meishan pigs are closely correlated with differences in testosterone-associated mRNA expression levels of the key enzymes (GPAT1, CPT1A, and ACADL) involved in the TG biosynthesis process, although no causes of sex differences in serum and hepatic TCHO levels could be found.

INTRODUCTION

Serum total cholesterol (TCHO) and triglyceride (TG) levels are important factors in the development of cardiovascular disease.¹⁾ There are sex differences in serum TCHO and TG levels, and the sex difference patterns in the maturation period vary by animal species.^2–4) However, the causes of species-associated sex differences in serum lipid levels remain unclear.

We previously reported that there were sex differences (male < female) in serum TCHO and TG levels in Meishan pigs⁴⁾ and further found that there were testosterone-associated sex differences in hepatic mRNA levels of several drug-metabolizing enzymes (DMEs)⁵⁾ and drug transporters in Meishan pigs.⁶⁾ Considering involvement of sex hormones in development of cardiovascular disease,^7,8) Meishan pigs would be useful animals for understanding the sex differences in human cardiovascular disease. Therefore, based on those previous results obtained using Meishan pigs,^5,6) we herein investigated the causes of sex differences in serum TCHO and TG levels in Meishan pigs.

To achieve such purposes, we examined whether there are sex differences in mRNA expression levels of key hepatic enzymes involved in the biosynthesis/metabolism of cholesterol and TG. For the mRNAs whose expression levels showed sex differences, we examined whether the mRNAs are expressed in a testosterone-associated fashion, and further investigated the relationship between their mRNA levels and the corresponding lipid levels.

MATERIALS AND METHODS

Animals and Testosterone-Treatment

Meishan pigs, including castrated male pigs and testosterone propionate (TP)-treated castrated males and intact females, herein used were the same group described in a previous study,⁹⁾ and all the pigs used were sacrificed at 5-month-old.⁹⁾

All animal experiments were conducted under the guidelines of the Animal Care Committee of the National Institute of Livestock and Grassland Science, Tsukuba, Japan.

Measurement of TCHO and TG Levels

Serum TCHO and TG levels were measured at Oriental Yeast, Co. (Tokyo, Japan), with a 7180 Automatic Analyzer (Hitachi, Tokyo, Japan). Hepatic TCHO and TG levels were measured at Skylight Biotec Inc. (Akita, Japan) by the Folch method¹⁰⁾ using Cholestest CHO and Cholestest TG (Sekisui Medical Co., Ltd., Tokyo, Japan), respectively. TCHO and TG values were indicated per 1 g of liver weight.

Measurement of mRNA Expression

mRNA levels were measured by real-time RT-PCR as previously described.¹¹⁾ The measured mRNAs were as follows: 3-hydroxy-3-methylglutaryl-CoA reductase (HMGCR) and CYP51A1 for cholesterol biosynthesis^12,13); CYP7A1 for bile acid synthesis from cholesterol¹²⁾; acetyl-CoA carboxylase alpha (ACACA) and fatty acid synthase (FASN) for fatty acid biosynthesis¹⁴⁾; glycerol-3-phosphate acyltransferase 1 (GPAT1) for TG biosynthesis^14,15); and acyl-CoA oxidase 1 (ACOX1), carnitine palmitoyltransferase 1A (CPT1A), and acyl-CoA dehydrogenase long chain (ACADL) for fatty acid oxidation.^14,16,17) Primer sets are shown in Table 1. Ribosomal protein 18S (18S) mRNA was used as an internal standard. Each mRNA level was determined by the relative standard curve method according to PE Applied Biosystems User Bulletin #2 (1997). Standard curves were generated with RT products derived from total RNA extracted from female pig liver.

Table 1. Primer Pairs Used in This Study

Gene name	Primer (5′-3′)	Amplicon size (bp)	Concentration of each primer (nM)	Accession No.
HMGCR	tccagtccaggtcaggtgatg (forward)	99	200	NM_001122988
	tctgcatttcagggaaatactcatg (reverse)		200
CYP51A1	ccaccattaacttatgaccagctca (forward)	86	100	NM_214432
	attatcggaggtcgaagtcttaacg (reverse)		100
CYP7A1	tccaccttagatgacgcagagaa (forward)	127	200	NM_001005352
	ctttcattgcttcagggctcctaa (reverse)		200
ACACA	aacctggattctgaagccaag (forward)	410	400	NM_001114269
	cgacgcatggttttcaccagatc (reverse)		400
FASN	gacggctcacacaccttcgt (forward)	130	200	NM_001099930
	cttgctccatgtcggtgaact (reverse)		200
GPAT1	ttagtcccagtcttgctgagcag (forward)	102	400	AY284842
	gctcctcaccaaaatcgctgt (reverse)		400
ACOX1	gctgcgaaaaaccttcaaactg (forward)	110	200	NM_001101028
	acgtagtggcaatgtgcctca (reverse)		200
CPT1A	ggtggagctgtttgatttggag (forward)	108	200	NM_001129805
	tcccccacaataatgtacgacac (reverse)		200
ACADL	tgagttggcagtttcagccagt (forward)	104	200	NM_213897
	gcaccgtctgtatatgtgccact (reverse)		200
18S	cggctaccacatccaaggaag (forward)	187	100	AY265350
	gctggaattaccgcggctg (reverse)		100

Statistical Analysis

Statistical differences were assessed by Tukey’s multiple comparison test or Student’s t-test.

RESULTS AND DISCUSSION

Sex Differences in Serum TCHO and TG Levels

TCHO levels in males (74.8 ± 12.8 mg/dL, n = 5) were significantly lower (p < 0.01 by Student’s t-test) than in females (98.2 ± 8.4 mg/dL, n = 5). TG levels were significantly lower (p < 0.01 by Student’s t-test) in males (22.6 ± 4.4 mg/dL, n = 5) than in females (56.2 ± 15.9 mg/dL, n = 5). These sex differences are consistent with those in our previous report.⁴⁾

Hepatic mRNA Levels of Enzymes Involved in Biosynthesis/Metabolism of Cholesterol and TG

In the present experiments, we used the liver which is a major organ of biosynthesis/metabolism of cholesterol and TG. We first examined whether there are sex differences in mRNA levels of key enzymes (HMGCR, CYP51A1, and CYP7A1) involved in cholesterol biosynthesis/metabolism.^12,13) No sex differences in the levels of these mRNAs were observed (Table 2), suggesting that these enzymes are not the factors producing sex differences in serum TCHO levels.

Table 2. Sex Differences in the Levels of mRNAs of Key Enzymes Involved in Cholesterol and Lipid Biosynthesis/Metabolism in Meishan Pigs

Genes	Male	Female
Cholesterol biosynthesis/metabolism-related genes
HMGCR	1.980 ± 0.650	1.419 ± 0.776
CYP51A1	1.102 ± 0.195	0.927 ± 0.258
CYP7A1	1.346 ± 0.588	1.387 ± 0.652
TG biosynthesis process-related genes
ACACA	1.549 ± 0.279	1.221 ± 0.365
FASN	1.026 ± 0.481	1.589 ± 0.405
GPAT1	0.425 ± 0.254b)	1.953 ± 0.556
ACOX1	1.905 ± 0.378a)	1.131 ± 0.390
CPT1A	3.862 ± 1.223b)	0.463 ± 0.163
ACADL	7.508 ± 1.995b)	2.239 ± 0.596

The level of each mRNA was expressed as the relative ratio to the level of 18S mRNA in individual livers, and each datum represents the mean ± standard deviation (S.D.) (n = 5 for males and n = 5 for females). ^a,b)The significance of differences between males and females was assessed by Student’s t-test: ^a)p < 0.05, ^b)p < 0.01.

To clarify the causes of sex differences in serum TG levels, we examined mRNA levels of GPAT1, a rate-limiting enzyme for TG biosynthesis,^14,15) and found that its levels were lower in males than in females (Table 2). By contrast, mRNA levels of peroxisomal ACOX1 and mitochondrial CPT1A and ACADL mediating the oxidation of fatty acids,^14,16,17) which are structural components of TG, were higher in males than in females (Table 2). In addition, no sex differences in hepatic mRNA levels of ACACA and FASN, key enzymes for fatty acid biosynthesis,¹⁴⁾ were observed (Table 2). These results suggest that sex differences in the mRNA levels of GPAT1, ACOX1, CPT1A, and ACADL, but not of ACACA and FASN, cause the sex differences in serum TG levels.

Effects of Testosterone on Hepatic mRNA Expression of GPAT1, ACOX1, CPT1A, and ACADL

To investigate the potential involvement of testosterone in the sex differences in mRNA levels shown in Table 2, effects of castration and/or TP-treatment on GPAT1, ACOX1, CPT1A, and ACADL mRNA levels were examined (Fig. 1). GPAT1 mRNA levels in castrated males increased to female levels. However, TP-treatments of castrated males and intact females decreased these levels to intact male levels. By contrast, the mRNA levels of CPT1A and ACADL in castrated males decreased to those of intact females, while TP-treatments increased those levels to intact male levels in the castrated males and intact females. No such effects of castration or TP-treatment were observed for mRNA levels of ACOX1. These results indicate that TP downregulates the GPAT1 gene, while upregulating the CPT1A and ACADL genes.

Fig. 1. Effects of Testosterone on Hepatic mRNA Levels of GPAT1, ACOX1, CPT1A, and ACADL

The bar in each group shows the mean. Each symbol represents an individual pig. ^aThe significance of differences from male pigs was assessed by Tukey’s post hoc test among intact male (M), castrated male (CM), and intact female (F) pigs: ^ap < 0.01. *The significance of differences between TP-treated and untreated pigs was assessed by Student’s t-test: * p < 0.01.

We further examined the relationships between serum testosterone levels and hepatic mRNA levels of GPAT1, CPT1A, and ACADL by regression analysis (Fig. 2). A negative correlation between serum testosterone levels and GPAT1 mRNA levels was observed, while there were positive correlations between serum testosterone levels and CPT1A and ACADL mRNA levels. Considering these findings, gene expression of GPAT1, CPT1A, and ACADL is thought to occur in a testosterone-associated manner.

Fig. 2. Correlations between Serum Testosterone Levels and Hepatic mRNA Levels of GPAT1, CPT1A, and ACADL

Each symbol represents an individual pig. The mRNA levels are based on the data shown in Fig. 1, and the serum testosterone levels for males (●) and females (○) are based on previously obtained data.⁹⁾ Correlations were assessed by regression analysis, with the correlation coefficient denoted as r.

Effects of Testosterone on Serum and Hepatic TG Levels

We examined whether testosterone affects serum and hepatic TG levels. Both serum and hepatic TG levels in males were increased to intact female levels by castration, while those levels in the castrated males and intact females were decreased to intact male levels by TP-treatment (Fig. 3). Accordingly, sex differences (male < female) in serum and hepatic TG levels in Meishan pigs seem to be, at least in part, dependent on the testosterone-associated differences in the GPAT1, CPT1A, and ACADL gene expression levels. To confirm the validity of this hypothesis, the relationships between GPAT1, CPT1A, and ACADL mRNA levels and serum or hepatic TG levels were examined by regression analysis. Positive correlations were observed between GPAT1 mRNA level and serum and hepatic TG levels, while negative correlations were observed between CPT1A and ACADL mRNA levels and serum and hepatic TG levels (Fig. 4). In addition, no effects of castration and TP-treatment on serum and hepatic TCHO levels were observed (data not shown). Our present findings and the previous report describing markedly reduced circulating levels of TG, but not TCHO, in men following testosterone-treatment¹⁸⁾ suggest that serum androgen levels have a major influence on serum TG level. In addition, testosterone has been reported to affect lipid accumulation in adipose tissue and lipid consumption in skeletal muscle through tissue-dependent regulation of the genes involved in lipid metabolism,^8,19) and such effects of testosterone may be one of the causes of testosterone-related differences in serum TG levels in Meishan pigs.

Fig. 3. Effects of Testosterone on Serum and Hepatic TG Levels

The bar in each group shows the mean. Each symbol represents an individual pig. ^a,bThe significance of differences from male pigs was assessed by Tukey’s post hoc test among intact male (M), castrated male (CM), and female (F) pigs: ^ap < 0.05, ^bp < 0.01. *^,**The significance of differences between TP-treated and untreated pigs was assessed by Student’s t-test: * p < 0.05, ** p < 0.01.

Fig. 4. Correlations between Hepatic GPAT1, CPT1A, and ACADL mRNA Levels and TG Levels in Serum and Liver

Each symbol represents an individual pig. The mRNA levels are based on the data shown in Fig. 1, and the serum and hepatic TG levels for males (●) and females (○) are based on the data shown in Fig. 3. Correlations were assessed by regression analysis, with the correlation coefficient denoted as r.

CONCLUSION

We herein propose that testosterone-associated sex differences in mRNA levels of key hepatic enzymes (GPAT1, CPT1A, and ACADL) involved in the TG biosynthesis process are highly correlated with sex differences in serum and hepatic TG levels in Meishan pigs. However, the causes of sex differences in serum TCHO levels could not be determined. Nevertheless, the present findings should help understand the role of testosterone in the development of metabolic syndrome, including cardiovascular disease, in men.

Acknowledgments

The authors thank Tsukuba Operation Unit 7, Technical Support Center of Central Region, NARO, Tsukuba, Japan, for the care of animals and collection of tissues.

Conflict of Interest

The authors declare no conflict of interest.

REFERENCES

• 1) Heo JH, Jo S-H. Triglyceride-rich lipoproteins and remnant cholesterol in cardiovascular disease. J. Korean Med. Sci., 38, e295 (2023).
• 2) Matsuzawa T, Nomura M, Unno T. Clinical pathology reference ranges of laboratory animals. J. Vet. Med. Sci., 55, 351–362 (1993).
• 3) Kawaguchi H, Yamada T, Miura N, Noguchi M, Izumi H, Miyoshi N, Tanimoto A. Sex differences of serum lipid profile in novel microminipigs. In Vivo, 27, 617–621 (2013).
• 4) Kojima M, Sekimoto M, Degawa M. Gender-related differences in the level of serum lipids in Meishan pigs. J. Health Sci., 54, 97–100 (2008).
• 5) Kojima M. Sex and breed differences in the constitutive gene expression of hepatic drug metabolizing enzymes in Meishan and Landrace pigs: testosterone-mediated differences. Jpn. Agric. Res. Q., 54, 7–12 (2020).
• 6) Kojima M, Degawa M. Sex, organ, and breed differences in the mRNA expression of drug transporters in the liver and kidney of pigs. Biol. Pharm. Bull., 45, 508–516 (2022).
• 7) Vitale C, Fini M, Speziale G, Chierchia S. Gender differences in the cardiovascular effects of sex hormones. Fundam. Clin. Pharmacol., 24, 675–685 (2010).
• 8) Kelly DM, Jones TH. Testosterone: a metabolic hormone in health and disease. J. Endocrinol., 217, R25–R45 (2013).
• 9) Kojima M, Sekimoto M, Degawa M. Androgen-mediated down-regulation of CYP1A subfamily genes in the pig liver. J. Endocrinol., 207, 203–211 (2010).
• 10) Folch J, Lees M, Sloane Stanley GH. A simple method for the isolation and purification of total lipids from animal tissues. J. Biol. Chem., 226, 497–509 (1957).
• 11) Kojima M, Degawa M, Nemoto K. Androgen-dependent expression of CUX2 mRNA in the pig liver is associated with that of drug metabolizing enzymes and drug transporters. Biol. Pharm. Bull., 46, 482–487 (2023).
• 12) Russell DW. Cholesterol biosynthesis and metabolism. Cardiovasc. Drugs Ther., 6, 103–110 (1992).
• 13) Porter TD. Electron transfer pathway in cholesterol synthesis. Lipids, 50, 927–936 (2015).
• 14) Nguyen P, Leray V, Diez M, Serisier S, Le Bloc’h J, Siliart B, Dumon H. Liver lipid metabolism. J. Anim. Physiol. Anim. Nutr. (Berl.), 92, 272–283 (2008).
• 15) Takeuchi K, Reue K. Biochemistry, physiology, and genetics of GPAT, AGPAT, and lipin enzymes in triglyceride synthesis. Am. J. Physiol. Endocrinol. Metab., 296, E1195–E1209 (2009).
• 16) Houten SM, Violante S, Ventura FV, Wanders RJA. The biochemistry and physiology of mitochondrial fatty acid β-oxidation and its genetic disorders. Annu. Rev. Physiol., 78, 23–44 (2016).
• 17) Poirier Y, Antonenkov VD, Glumoff T, Hiltunen JK. Peroxisomal β-oxidation-A metabolic pathway with multiple functions. Biochim. Biophys. Acta, 1763, 1413–1426 (2006).
• 18) Corona G, Monami M, Rastrelli G, Aversa A, Sforza A, Lenzi A, Forti G, Mannucci E, Maggi M. Type 2 diabetes mellitus and testosterone: a meta-analysis study. Int. J. Androl., 34, 528–540 (2011).
• 19) Rizk J, Sahu R, Duteil D. An overview on androgen-mediated actions in skeletal muscle and adipose tissue. Steroids, 199, 109306 (2023).