2024 年 47 巻 7 号 p. 1265-1274
There is evidence that propolis exhibits anti-inflammatory, anticancer, and antioxidant properties. We assessed the potential beneficial effects of Brazilian propolis on liver injury in nonalcoholic fatty liver disease (NAFLD). Our findings demonstrate that Brazilian propolis suppresses inflammation and fibrosis in the liver of mice with NAFLD by inhibiting the expression of genes involved in endoplasmic reticulum (ER) stress. Additionally, Brazilian propolis also suppressed the expression of ER stress-related genes in HepG2 cells treated with an excess of free fatty acids, leading to cell apoptosis. A deeper analysis revealed that kaempferol, one of the components present in Brazilian propolis, induces cell proliferation through the mitogen-activated protein kinase (MAPK)/extracellular signal-regulated kinase (ERK) pathway and protects against oxidative stress. In conclusion, Brazilian propolis exhibits hepatoprotective properties against oxidative stress by inhibiting ER stress in NAFLD-induced model mice.
Nonalcoholic fatty liver disease (NAFLD) is a prevalent chronic liver disease affecting adults and children worldwide.1) It is considered an outcome of obesity that can progress to nonalcoholic steatohepatitis (NASH), a chronic disease characterized by liver steatosis, inflammation, and fibrosis that ultimately leads to cirrhosis, hepatocellular carcinoma, and end-stage liver failure. The mechanism of NASH is referred to as the “two-hit theory.”1) The “first hit” is caused by background factors (e.g., overnutrition, obesity, diabetes) that lead to lipid droplet deposition in hepatocytes. The “second hit” can be associated with oxidative stress, endoplasmic reticulum (ER) stress, or an excess of free fatty acids, which have potential to cause inflammation and fibrosis in the liver.2) The treatment for NASH is limited to lifestyle changes based on a healthy diet and physical activity to lose weight.3) Moreover, effective drug treatments for NASH are still unavailable, thereby prevention is essential.
Propolis, a natural product generated by bees from the sap and buds of plants to protect their colonies from infection, has demonstrated different medicinal properties. Propolis contains over 500 active components, including cinnamic acid derivatives (e.g., artepillin C or p-coumaric acid) and flavonoids (e.g., kaempferol, chrysin, pinocembrin, or naringenin).4–6) It has been reported that such components have antibacterial, antitumor, and anti-inflammatory effects, thereby strengthening the immune system.7–9) Furthermore, compounds isolated from Brazilian propolis have been shown to prevent high-fat diet-induced obesity and metabolic syndromes in mice.10–14) Although it has been shown that propolis other than from Brazil can improve liver function,15–17) the possible effects of Brazilian propolis on hepatic functioning have not been studied in detail.
Oxidative stress, ER stress, and excessive free fatty acids are critical factors that exacerbate the transition from fatty liver to NASH.18) In a high-fat diet-induced liver injury model, it has been reported that reducing ER stress attenuates fatty liver, which is thought to lead to the prevention of NAFLD/NASH.19,20) However, the underlying mechanisms by which ameliorating ER stress reduces the progression of NASH remain unclear. In this study, we investigated the effects of Brazilian propolis on NAFLD using mice under a methionine-choline–deficient diet. Brazilian propolis has been reported to have an inhibitory effect on neuropathy mediated by ER stress, but its effect on hepatocellular injury is unclear.21) By focusing on oxidative and ER stresses, we analyzed the hepatoprotective properties of Brazilian propolis in hepatic HepG2 cells under different conditions.
Brazilian green propolis (Lot. No. 100305), standardized to contain 8.0% artepillin C and 0.14% culifolin, was provided by Yamada Bee Company, Inc. (Okayama, Japan).6) Kaempferol, artepillin C, and anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mouse monoclonal antibody were purchased from FUJIFILM Wako Pure Chemical Corporation (Osaka, Japan). Chlorogenic acid and p-coumaric acid were purchased from MP Biomedicals, Inc. (Irvine, CA, U.S.A.). Pinocembrin and kaempferide were purchased from ChromaDex, Inc. (Los Angeles, CA, U.S.A.). Palmitic acid (PA) and bovine serum albumin (BSA, fatty acid free) were purchased from Sigma-Aldrich (St. Louis, MO, U.S.A.). U0126 (MEK inhibitor), SB203580 (p38 mitogen-activated protein kinase (MAPK) inhibitor), LY294002 (phosphatidylinositol 3-kinase (PI3K) inhibitor), and SP600125 (c-Jun N-terminal kinase (JNK) inhibitor) were obtained from Abcam Plc (Cambridge, U.K.). Anti-phospho-eIF2α, anti-phospho-p44/42 MAPK (Erk1/2) (Thr202/Tyr204) rabbit monoclonal, anti-rabbit immunoglobulin G (IgG), anti-mouse IgG, and horseradish peroxidase (HRP)-linked antibodies were purchased from Cell Signaling Technology (Danvers, MA, U.S.A.). Anti-β-actin mouse monoclonal antibody was provided by Santa Cruz Biotechnology (Dallas, TX, U.S.A.).
AnimalsEight-week-old C57BL/6 male mice were purchased from Charles River Laboratories Japan, Inc. (Kanagawa, Japan). All mice were housed at a constant temperature and supplied with laboratory chow and water ad libitum. Protocol approval (KAEN-2022-001) was obtained from the Animal Research Committee of Kindai University. The mice were fed a standard diet (SD group, n = 6), a methionine-choline control diet (MCCD group, n = 6), and a methionine-choline–deficient diet (MCDD group, n = 6) for 8 weeks. Brazilian propolis was administered to the MCDD group at concentrations of 100 mg/kg (MCDD + PP100, n = 11) or 300 mg/kg (MCDD + PP300, n = 11).15,22) All mice were orally administered water or suspended Brazilian propolis in water daily for 8 weeks. The diets of SD, MCCD, and MCDD mice were purchased from Oriental Yeast Co., Ltd. (Tokyo, Japan). After 8 weeks, the mice were killed under anesthesia. Blood samples were collected from the inferior vena cava and centrifuged at 5000 × g for 10 min. The resulting serum was preserved at −80 °C until further use for biochemistry tests. A portion of the mice’s liver was excised, fixed for 24 h in 10% formalin, and then embedded in paraffin. Another liver portion was stored at −80 °C until used for total RNA extraction. The alanine aminotransferase (ALT) level was measured in the serum using a DRI-CHEM3500V instrument (FUJIFILM, Tokyo, Japan). The embedded liver was cut into 7-µm-thick sections. Next, liver sections were deparaffinized, washed, and stained with hematoxylin and eosin. Images of each section were obtained using a BA310 microscope (Shimadzu Corporation, Kyoto, Japan).
Cell CultureHuman hepatoma HepG2 cells provided by the RIKEN BRC CELL BANK (Ibaraki, Japan) were cultured in a Dulbecco’s Modified Eagle Medium (DMEM; FUJIFILM Wako Pure Chemical Corporation) containing 10% fetal bovine serum (FBS; BioSera, Nuaille, France), 100 units/mL penicillin and 100 mg/mL streptomycin (FUJIFILM Wako Pure Chemical Corporation) at 37 °C in a humidified air containing 5% CO2. Brazilian propolis and Brazilian propolis components such as kaempferol, artepillin C, chlorogenic acid, p-coumaric acid, pinocembrin, and kaempferide were dissolved in dimethyl sulfoxide (DMSO; Sigma-Aldrich). PA were dissolved in isopropyl alcohol (FUJIFILM Wako Pure Chemical Corporation). Brazilian propolis and Brazilian propolis components were treated 0–100 µg/mL and 0–30 µM, respectively. With them, PA were added 0–800 μΜ to DMEM containing 1% BSA. U0126, SB203580, LY294002, and SP600125 inhibitors were dissolved in DMSO and treated at an appropriate concentration for 24 h without or with 10 µM kaempferol.
Cell ProliferationCells (5.0 × 103 cells/well) were cultured into a 96-well microplate (Iwaki, Tokyo, Japan) overnight and then incubated with each reagent for 24 h. Next, the cells were incubated with 10 µL of Cell Counting Kit-8 reagent (CCK-8, Dojin Laboratories, Kumamoto, Japan) for 3 h and measured at 450 nm using an iMark™ microplate reader (Bio-Rad, Hercules, CA, U.S.A.).
Real-Time PCRCells (1.0 × 105 cells/well) were cultured into 24-well plates (Corning, Corning, NY, U.S.A.) overnight and incubated with each reagent for 8 h. Total RNA was extracted from liver tissues and cultured cells using the SV Total RNA Isolation System (Promega, Madison, WI, U.S.A.), and cDNA was synthesized using the ReverTra Ace® quantitative PCR (qPCR) RT Kit (Toyobo, Osaka, Japan). Quantitative real-time PCR was performed using the SYBR® Green Real-time PCR Master Mix (Toyobo) and gene-specific primers in an Eco™ Real-time PCR System (Illumina, San Diego, CA, U.S.A.). Primer sequences are described in Tables 1 and 2. The data were analyzed using the 2–ΔΔCT method and normalized using the mouse or human Gapdh mRNA as an endogenous control. The cDNAs were amplified using Xbp1 primers and EmeraldAmp® PCR master mix (TaKaRa Bio Inc., Shiga, Japan) and then incubated with the PstI-HF™ restriction enzyme (New England BioLabs, Inc., Ipswich, MA, U.S.A.) at 37 °C for 1 h. The activated spliced variant of Xbp1 generated a 473 bp amplification product, whereas unspliced Xbp1 gave two digested amplification products of 290 and 183 bp.23)
| Gene | Forward (5′→3′) | Reverse (5′→3′) |
|---|---|---|
| Tnf-α | CCTCACACTCAGATCTTCTCA | GCTGCTCCTCCACTTGGTG |
| Mcp-1 | CCAGCAAGATGATCCCAATGAGTA | CTCTCTCTTGAGCTTGGTGACAA |
| Acta2 | TCCCTGGAGAAGAGCTACGAACT | AAGCGTTCGTTTCCAATGGT |
| Col1α1 | GACATCCCTGAAGTCAGCTGC | TCCCTTGGGTCCCTCGAC |
| Chop | GCGACAGAGCCAGAATAACA | GATGCACTTCCTTCTGGAACA |
| Atf4 | ATGATGGCTTGGCCAGTG | CCATTTTCTCCAACATCCAATC |
| Ire1α | CTTGAGGAATTACTGGCTTCTCA | TCCAGCATCTTGGTGGATG |
| Gadd34 | ACGATCGCTTTTGGCAAC | GACATGCTGGGGTCTTGG |
| Ho-1 | GGTGATGGCTTCCTTGTACC | AGTGAGGCCCATACCAGAAG |
| Gapdh | GTCGTGGATCTGACGTGCC | TGCCTGCTTCACCACCTTCT |
| Gene | Forward (5′→3′) | Reverse (5′→3′) |
|---|---|---|
| Chop | CAGAGCTGGAACCTGAGGAG | TGGATCAGTCTGGAAAAGCA |
| Gadd34 | GCTTCTGGCAGACCGAAC | GTAGCCTGATGGGGTGCTT |
| Ire1α | GAAGCATGTGCTCAAACACC | TCTGTCGCTCACGTCCTG |
| Xbp1 | AAACAGAGTAGCAGCTCAGAC | TCCTTCTGGGTAGACCTCTGG |
| Ho-1 | GGCAGAGGGTGATAGAAGAGG | AGCTCCTGCAACTCCTCAAA |
| Gapdh | GCACCGTCAAGGCTGAGAAC | TGGTGAAGACGCCAGTGGA |
Cells (4.0 × 105 cells/well) were cultured into 6-well plates (Corning) overnight and incubated with each reagent for 6 and 24 h. Total protein was extracted from cells using RIPA buffer (FUJIFILM Wako Pure Chemical Corporation) with protease and phosphatase inhibitor cocktails (Thermo Fisher, Waltham, MA, U.S.A.). The protein mixture was subjected to sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) and then transferred to an Immobilon®-P polyvinylidene difluoride (PVDF) membrane (Merck, Darmstadt, Germany). Subsequently, the membrane was blocked with a PVDF Blocking Reagent for Can Get Signal® (Toyobo), and a primary antibody was applied. Next, a secondary antibody was added to recognize and bind to the primary antibody. The secondary antibody was visualized using the ImmunoStar® LD reagent (FUJIFILM Wako Pure Chemical Corporation) and analyzed in an ImageQuant LAS 500 digital imaging system (GE Healthcare, Chicago, IL, U.S.A.).
Statistical AnalysisAll results were expressed as mean ± standard deviation (S.D.). Statistical analysis was performed using Tukey’s test and Dunnett’s test as implemented in Pharmaco Basic software (Scientist Press Co., Ltd., Tokyo, Japan). Probability values of p < 0.05 and p < 0.01 were considered statistically significant.
The histochemical analysis showed numerous tiny lipid droplets and mild inflammation in the liver of MCDD mice (Figs. 1A–C). Moreover, the administration of Brazilian propolis in MCDD + PP100 and MCDD + PP300 mice decreased the number of observed lipid droplets compared to MCDD mice (Figs. 1D, E). The level of the alanine transaminase (ALT) liver damage marker was higher in MCDD mice (102.9 ± 30.9 U/L) than in SD and MCCD groups (Fig. 1F). The administration of Brazilian propolis in MCDD mice decreased ALT levels in a dose-dependent manner (MCDD + PP100 group: 57.8 ± 67.7 U/L; MCDD + PP300 group: 23.6 ± 10.3 U/L).
(A–C) Hematoxylin–eosin (H&E) staining in livers of SD (A), MCCD (B), and MCDD groups (C). (D, E) H&E staining in livers of the mice fed MCDD and administrated Brazilian propolis solution at a concentration of 100 mg/kg (D, MCDD + PP100 groups) and 300 mg/kg (E, MCDD + PP300 groups). (F) ALT values in sera of SD (n = 6), MCCD (n = 6), MCDD (n = 6), MCDD + PP100 (n = 11), and MCDD + PP300 (n = 11) groups (three independent experiments). Statistical analysis was performed by Tukey’s test. The level of statistical significance was shown in ** p < 0.05.
To compare the extent of hepatic inflammation and fibrosis stage among groups, gene expression patterns of liver inflammation- and fibrosis-related genes were assessed by real-time PCR (Fig. 2). The RT-PCR-based gene expression profiling revealed that the expression levels of tumor necrosis factor-alpha (Tnf-α, Fig. 2A) and monocyte chemoattractant protein-1 (Mcp-1, Fig. 2B) liver inflammation-related genes were upregulated by 1.9 ± 0.86- and 7.4 ± 3.5-fold, respectively, in the liver of MCDD mice. We observed that the administration of Brazilian propolis restored the gene expression of Tnf-α and Mcp-1 genes to normal (SD) levels in MCDD + PP100 (1.5 ± 0.98- and 5.4 ± 5.9-fold, respectively) and MCDD + PP300 (0.56 ± 0.23- and 1.2 ± 1.1-fold, respectively) mice. Furthermore, the expression levels of smooth muscle alpha-actin (Acta2, Fig. 2C) and collagen type I alpha 1 (Col1α1, Fig. 2D) liver fibrosis-related genes were upregulated by 2.4 ± 0.75- and 1.4 ± 0.91-fold, respectively, in MCDD mice. Moreover, we found that the administration of Brazilian propolis increased the levels of Acta2 and Col1α1 genes in a dose-dependent manner both in MCDD + PP100 (1.6 ± 0.86- and 1.0 ± 0.53-fold, respectively) and MCDD + PP300 (1.1 ± 0.44- and 0.58 ± 0.41-fold, respectively) groups.
(A, B) Expression of inflammation-related genes such as Tnf-α (A) and Mcp-1 (B). (C, D) Expression of fibrosis-related genes such as Acta2 (C) and Col1α1 (D). (E–H) Expression of ER stress-related genes such as Chop (E), Atf4 (F), Ire1α (G), and Gadd34 (H). The gene expression of livers of SD (n = 6), MCCD (n = 6), and MCDD (n = 6), MCDD + PP100 (n = 11), and MCDD + PP300 (n = 11) groups was measured by real-time PCR (three independent experiments). Statistical analysis was performed by Tukey’s test. The level of statistical significance was shown in * p < 0.05 and p** < 0.01.
ER stress has been associated with the development of NAFLD and an increased risk of hepatocellular carcinoma (HCC).24) Therefore, we also assessed gene expression profiles of ER stress-related genes by real-time PCR (Figs. 2E–H). The levels of C/EBP homologous protein (Chop), activating transcription factor 4 (Atf4), inositol-requiring enzyme 1α (Ire1α), and growth arrest and DNA damage-inducible protein (Gadd34) ER stress-related genes were upregulated by 1.1 ± 0.46-, 1.8 ± 0.38-, 2.1 ± 0.39-, and 1.6 ± 0.37-fold, respectively, in the MCDD group. In contrast, we found that the levels of Chop, Atf4, Ire1α, and Gadd34 genes were significantly downregulated in MCDD + PP300 (0.23 ± 0.080-, 0.64 ± 0.21-, 0.49 ± 0.23-, and 0.99 ± 0.11-fold, respectively) groups.
The Effect of Brazilian Propolis on Fatty Acid-Induced Cell ApoptosisNo cytotoxicity was observed in HepG2 cells after exposure to 2.5 and 10 µg/mL Brazilian propolis (1.1 ± 0.062- and 1.1 ± 0.017-fold, respectively, Fig. 3A) at any tested concentration ranging from 2.5 to 100 µg/mL. Conversely, the treatment with 200, 400, and 800 µM PA decreased cell viability by 0.44 ± 0.016-, 0.35 ± 0.0085-, and 0.21 ± 0.0061-fold, respectively. However, the cell viability was recovered in PA-treated HepG2 cells after administration of 10 µg/mL Brazilian propolis by 0.60 ± 0.020-, 0.40 ± 0.0096-, and 0.24 ± 0.016-fold, respectively (Fig. 3B). In liver cancer cells, saturated fatty acids such as PA can induce apoptosis through ER stress.25–27) In HepG2 cells, the treatment with 800 µM PA increased the expression levels of Chop, Ire1α, and Gadd34 ER stress-related genes by 2.6 ± 0.27-, 1.7 ± 0.20-, and 1.4 ± 0.35-fold, respectively, and PA-induced upregulation was inhibited after the administration of 2.5 µg/mL Brazilian propolis by 0.64 ± 0.35-, 0.23 ± 0.026-, and 0.18 ± 0.023-fold, respectively (Fig. 3C). Also, the ratio of unspliced Xbp1 (bands at 290 bp are shown in Fig. 3D) significantly decreased 0.075 ± 0.063-fold in PA-treated HepG2 cells, and significantly recovered in a dose-dependent manner by the administration of 0.5 and 2.5 µg/mL Brazilian propolis (0.40 ± 0.16- and 0.95 ± 0.057-fold, respectively, Fig. 3D). The Western blot analysis showed that the phosphorylation of the eukaryotic translation initiation factor 2A (eIF2α), which is a transcriptional regulator of Chop and Gadd34 genes, also was increased in a dose-dependent manner in 400 and 800 µM PA-treated HepG2 cells (4.6 ± 1.0- and 9.3 ± 2.1-fold, respectively), and inhibited by the administration of 10 µg/mL Brazilian propolis (2.0 ± 0.48- and 5.9 ± 0.98-fold, respectively, Fig. 3E).
(A) Cytotoxicity test of Brazilian propolis (2.5–100 µg/mL, n = 3, three independent experiments) in HepG2 cells by CCK-8. Statistical analysis was performed by Dunnett’s test. The level of statistical significance was shown in p** < 0.01 and p* < 0.05 vs. no treatment. (B) PA-induced cell apoptosis in HepG2 cells (PA200, 400, and 800, n = 3, three independent experiments) and its inhibitory effect by Brazilian propolis (10 µg/mL, PP10, n = 3) by CCK-8. Statistical analysis was performed by Tukey’s test. The level of statistical significance was shown in p** < 0.01 vs. PA0 + PP0 and p## < 0.01 vs. PA treatment only (white bar graph). (C) Expression of ER stress-related genes (Chop, Ire1α, and Gadd34) in PA-treated HepG2 cells (PA800, n = 4, three independent experiments) by real-time PCR and its inhibitory effect by Brazilian propolis (0.1–2.5 µg/mL, PP0.1–2.5, n = 4, three independent experiments). Statistical analysis was performed by Tukey’s test. The level of statistical significance was shown in p** < 0.01. (D) Xbp1 splicing through activation of IRE1α in PA-treated HepG2 cells (PA800, n = 4) and its inhibitory effect by Brazilian propolis (0.1–2.5 µg/mL, PP0.1–2.5, n = 4, three independent experiments). Statistical analysis was performed by Tukey’s test. The level of statistical significance was shown in p** < 0.01. (E) Phosphorylation of ER stress-related protein, eIF2α, in PA-treated HepG2 cells for 6 h by Western blot and its inhibitory effect by Brazilian propolis (2.5–10 µg/mL, PP0.1–2.5, n = 4, three independent experiments). β-Actin was used as endogenous control. Statistical analysis was performed by Tukey’s test. The level of statistical significance was shown in p** < 0.01 and p* < 0.05 vs. PA0 + PP0 and p# < 0.05 vs. PA treatment only (black bar graphs).
When some components of Brazilian propolis from Yamada Bee Company, Inc. were treated with HepG2 cells at a concentration of 10 and 30 µM, kaempferol showed the most proliferative effect (1.4 ± 0.059- and 1.3 ± 0.091-fold, respectively, Fig. 4A).
(A) Cytotoxicity test of Brazilian propolis components (10–30 µM, n = 4, three independent experiments) in HepG2 cells by CCK-8. Statistical analysis was performed by Dunnett’s test. The level of statistical significance was shown in p** < 0.01 and p* < 0.05 vs. no treatment. (B) PA-induced cell apoptosis in HepG2 cells by CCK-8 and its inhibitory effect by kaempferol (10–30 µM, Ka10–30, n = 3, three independent experiments). Statistical analysis was performed by Tukey’s test. The level of statistical significance was shown in p** < 0.01 vs. PA0 + Ka0 and p## < 0.01 vs. PA treatment only (black bar graphs). (C, D) Regulation of MAPK/ERK pathway by kaempferol in HepG2 cells. (C) Effect of U0126 (a MEK inhibitor, 0.05 µM), SB203580 (a p38 MAPK inhibitor, 0.5 µM), LY294002 (a PI3-kinase inhibitor, 1.25 µM), and SP600125 (a JNK inhibitor, 0.1 µM) in 10 µM kaempferol-treated HepG2 cells (Ka10, n = 4, three independent experiments) by CCK-8. “Ka10 + Inhibitor” was treated with each of inhibitors in 10 µM kaempferol-treated HepG2 cells, and “Inhibitor” was treated with each of inhibitors in HepG2 cells. Statistical analysis was performed by Tukey's test. The level of statistical significance was shown in p** < 0.01. (D) Phosphorylation of p44/42 in 10 µM kaempferol-treated HepG2 cells for 24 h, and the inhibitory effect of U0126 (n = 3, three independent experiments). GAPDH was used as endogenous control. “Ka10 + U0126” is treated with 0.05 µM U0126 in 10 µM kaempferol-treated HepG2 cells, and “U0126” is treated with 0.05 µM U0126 in HepG2 cells. Statistical analysis was performed by Tukey’s test. The level of statistical significance was shown in p** < 0.01.
Kaempferol is a flavonoid compound obtained from Brazilian propolis that has been reported to show antioxidant, anti-inflammatory, and tumor growth inhibition activity.28) In this study, we observed that the treatment of primary mouse hepatocytes as well as HepG2 cells with kaempferol at low concentrations (10 and 30 µM) stimulated cell growth (data not shown). Cell viability in HepG2 cells treated with 200 µM PA recovered after administration of 10 and 30 µM kaempferol by 2.4 ± 0.31- and 3.2 ± 0.18-fold, respectively, and it with 400 µM PA recovered after administration of 10 and 30 µM kaempferol by 1.3 ± 0.093- and 1.3 ± 0.14-fold, respectively (Fig. 4B). The cell viability in 10 µM kaempferol-treated HepG2 cells (1.3 ± 0.071-fold) was inhibited after administration of U0126 MEK inhibitor with 10 µM kaempferol by 1.0 ± 0.057-fold (Fig. 4C). The analysis of signaling pathways revealed that only the U0126 MEK inhibitor was able to abolish the effect of kaempferol in HepG2 cells. We found that HepG2 cells treated with 10 µM kaempferol showed increased phosphorylation of p44 and p42 MAPKs (1.7 ± 0.15-fold), and this effect was significantly inhibited 0.76 ± 0.17-fold by U0126 (Fig. 4D).
Heme oxygenase-1 (HO-1) is an oxidative stress marker associated with susceptibility to various disorders, including liver and heart diseases.29,30) The expression of the Ho-1 in the liver of MCCD and MCDD mice was 1.5 ± 0.48- and 2.5 ± 0.56-fold higher, respectively, than in the SD group (Fig. 5A). Administration of Brazilian propolis restored the normal expression level of Ho-1 (1.1 ± 0.33-fold) in the liver of MCDD + PP300 mice. Ho-1 expression was increased 1.8 ± 0.11-fold in HepG2 cells treated with 400 µM PA, and this effect was significantly inhibited 0.97 ± 0.25-fold by the administration of 10 µg/mL Brazilian propolis (Fig. 5B). In HepG2 cells, the treatment with 200 and 400 µM PA increased the expression levels of Ho-1 by 1.8 ± 0.14- and 2.4 ± 0.21-fold, respectively, and PA-induced upregulation was inhibited after the administration of 30 µM kaempferol by 1.3 ± 0.11- and 1.7 ± 0.062-fold, respectively (Fig. 5C).
(A) Gene expression of Ho-1 in the liver of Brazilian propolis-treated mice. The gene expression of livers of SD (n = 6), MCCD (n = 6), and MCDD (n = 6), MCDD + PP100 (n = 11), and MCDD + PP300 (n = 11) groups was measured by real-time PCR (three independent experiments). Statistical analysis was performed by Tukey’s test. The level of statistical significance was shown in p** < 0.01. (B, C) Gene expression of Ho-1 in PA-treated HepG2 cells by real-time PCR and its inhibition effect by Brazilian propolis (2.5–10 µg/mL, PP2.5–10, n = 3, three independent experiments, B) and kaempferol (10–30 µM, Ka10–30, n = 4, three independent experiments, C). Statistical analysis was performed by Tukey’s test. The level of statistical significance was shown in p** < 0.01 and p* < 0.05 vs. PA0 + PP0 or PA0 + Ka0, and p## < 0.01 and p# < 0.05 vs. PA treatment only (black bar graphs).
Oxidative and ER stresses are pathological states frequently associated with NAFLD and an increased risk of HCC.18,31,32) ER stress is induced by the accumulation of unfolded or misfolded proteins in the ER, which leads to cellular dysfunction. Cells have developed several mechanisms to face ER stress, maintain homeostasis and prevent damage. These mechanisms can reduce the ER protein folding load by decreasing translation, enhance protein folding by providing more molecular chaperones, and eliminate denatured proteins by bypassing ER stress.33) Mice-fed methionine- and choline-deficient diets are well-known to experience severe oxidative and ER stresses in the liver, resulting in abnormal hepatic lipid accumulation and inflammation and ultimately leading to NAFLD.24)
ER stress has been reported to be implicated in the induction of liver inflammation and fibrosis during NAFLD progression.32) We observed that Brazilian propolis inhibits ER stress, leading to a reduction in inflammation and fibrosis. The histological analysis revealed significant suppression of inflammation, while the gene expression analysis showed the downregulation of inflammation-related genes in the liver of NAFLD-induced mice. TNF-α, an inflammatory cytokine associated with alcohol- and hepatitis virus-induced liver damage, has been reported to be upregulated during NASH. TNF-α acts to suppress the insulin signaling pathway and adiponectin secretion by adipocytes. During NASH, adiponectin is produced in hypertrophied adipocytes of the visceral adipose tissue and hepatic Kupffer cells, reducing insulin resistance in adipose, skeletal muscle, and hepatic tissues.34) NASH pathogenesis involves the activity of numerous inflammatory cells in the liver lobule, including liver-resident macrophages (Kupffer cells) and monocyte-derived macrophages. One possible mechanism contributing to the infiltration of monocyte-derived macrophage is the upregulation of MCP-1, which recruits and activates monocytes to the site of inflammation and regulates gene expression of adhesion molecules and pro-inflammatory cytokines.35) Elevated serum MCP-1 levels have been associated with NASH severity and the risk of progression to cirrhosis.36) Although no direct effect of Brazilian propolis on inflammatory and activated stellate cells was confirmed in this study, it is worth noting that it contains numerous components, some of which might exhibit a direct effect on these cells.
Brazilian propolis consists of numerous chemical compounds that exhibit anti-inflammatory and antioxidant effects.8) The efficacy of Brazilian propolis in fatty liver- and alcohol-induced liver injury has already been confirmed in animal models15,37); however, its underlying mechanism of action remains to be elucidated. Therefore, we assessed the effects of Brazilian propolis on liver injury with a focus on its antioxidant effects and ER stress response. For this purpose, we used animal and cell line models exposed to abnormal levels of fatty acids. In PA-treated HepG2 cells, we observed upregulation of Chop and Gadd34 ER stress-related genes, which was dose-dependent and led to cell apoptosis. Previous in vitro and in vivo studies have shown that Chop and GADD34 act as master regulators of ER stress-induced apoptosis through the eIF2α phosphorylation pathway.38,39) We found that the administration of Brazilian propolis is associated with significant inhibition of eIF2α phosphorylation, resulting in the downregulation of Chop and Gadd34 expression in PA-treated HepG2 cells. Additionally, the accumulation of unfolded proteins in the ER leads to the activation of ER stress transducer proteins such as IRE1α, ATF6, and protein kinase RNA-like endoplasmic reticulum kinase (PERK), ultimately inducing ER stress.40) ATF6 can upregulate Xbp1, which in turn activates Chop, and IRE1α activation is required to process the unspliced Xbp1 mRNA and thus generate the active (spliced) Xbp1 variant, which enters into the cell nucleus and induces Chop expression.41) We observed that the treatment with Brazilian propolis significantly inhibits the expression of Ire1α and suppresses the splicing of Xbp1 in a dose-dependent manner, suggesting a role in diminishing the ER stress response both in vivo and in vitro. It has been reported that propolis from other countries also has a hepatoprotective effect.42,43) Although these propolis are derived from different plants, they have common features such as antibacterial and antioxidant effects, and it is very interesting that they have been confirmed to have similar physiological activities. Brazilian propolis contains more cinnamic acid derivatives, which are active ingredients, than propolis from other regions, and may have physiological activities unique to Brazilian propolis.
Kaempferol is one of the flavonoid compounds present in Brazilian propolis, which exhibits pharmacological activity, including anti-inflammatory, antioxidant, anti-cancer, and anti-diabetic activity.44) Guo et al. reported that kaempferol induces apoptosis in liver cancer HepG2 and Huh7 cells through the ER stress pathway.45,46) Mylonis et al. demonstrated that kaempferol suppresses the expression of the hypoxia-inducible factor 1 (HIF-1), causing a significant reduction of cell viability under hypoxic conditions.47) In this study, we found that low concentrations of kaempferol stimulate cell growth of PA-treated HepG2 cells via the activation of the MAPK/extracellular signal-regulated kinase (ERK) pathway. Furthermore, PA-treated HepG2 cells showed an increased expression of the ER stress-related gene Chop, and this effect was inhibited by kaempferol in a dose-dependent manner (data not shown). This effects of Brazilian propolis were not due to a single component, but were thought to be due to the synergistic effect of multiple components. Additionally, Brazilian propolis showed a potential hepatoprotective activity. The activation of Ho-1 is an adaptive response against oxidative damage induced by lipid peroxidation and exerts beneficial effects against oxidative injury in NASH. Our study showed that kaempferol suppresses the expression of the Ho-1, exhibiting hepatoprotective effects.
This work was supported by Yamada Research Grant under Grant [Numbers: 113 and 135]. We would like to thank Tani Kaito and Yuta Sadakiyo for their technical assistance.
The authors declare no conflict of interest.
