Suppression of the Epithelial–Mesenchymal Transition and Maintenance of the Liver Functions in Primary Hepatocytes through Dispersion Culture within a Dome-Shaped Collagen Matrix

Abstract

Primary hepatocytes are valuable for studying liver diseases, drug-induced liver injury, and drug metabolism. However, when cultured in a two-dimensional (2D) environment, primary hepatocytes undergo rapid dedifferentiation via an epithelial–mesenchymal transition (EMT) and lose their liver-specific functions. On the other hand, a three-dimensional (3D) culture of primary hepatocyte organoids presents challenges for analyzing cellular functions and molecular behaviors due to strong cell-cell adhesion among heterogeneous cells. In this study, we developed a novel dispersion culture method of hepatocytes within a dome-shaped collagen matrix, overcoming conventional limitations. The expression levels of EMT-related genes were lower in rat primary hepatocytes cultured using this method for 4 d than in cells cultured using the 2D method. Furthermore, albumin production, a marker of liver function, declined sharply in rat primary hepatocytes cultured in two dimensions from 6.40 µg/mL/48 h on day 4 to 1.35 µg/mL/48 h on day 8, and declined gradually from 4.92 µg/mL/48 h on day 8 to 3.89 µg/mL/48 h on day 14 in rat primary hepatocytes cultured using our new method. These findings indicate that the newly developed culture method can suppress EMT and maintain liver functions for 14 d in rat primary hepatocytes, potentially expanding the utility of primary hepatocyte cultured by using conventional 3D methods.

INTRODUCTION

The liver contributes to the maintenance of homeostasis in the body through performance of various functions, including metabolism, detoxification, bile production, and synthesis of serum proteins. The liver is primarily composed of hepatocytes, accounting for approximately 80% of its composition, with the remaining portion consisting of non-parenchymal cells such as liver sinusoidal endothelial cells, Kupffer cells, hepatic stellate cells, and bile duct epithelial cells.^1,2) The major functions of liver, such as bile production and metabolism of various substances, are carried out by hepatocytes.

Cultured cells used in liver research can be divided into two categories: liver cancer cell lines and primary hepatocytes. Liver cancer cell lines have excellent proliferative capacity but significantly lower expression and function of CYP enzymes and bile acid transporters compared to normal hepatocytes, making them unsuitable for drug-induced liver injury (DILI) and drug metabolism studies.^3,4) On the other hand, primary hepatocytes retain liver-specific functions and are valuable for studying liver diseases, DILI, drug metabolism, and transporter functions.^5–8) Typically, primary hepatocytes are cultured using a two-dimensional (2D) culture method, wherein the cells are cultivated as a monolayer for short-term use. However, when primary hepatocytes are cultured in two dimensions, signals such as transforming growth factor beta (TGFβ) and tyrosine kinase become activated and induce rapid epithelial–mesenchymal transition (EMT). On the second day of culture, primary hepatocytes lose their hepatocyte-like cell morphology and undergo a transition into flattened mesenchymal-like cells, resulting in the loss of liver-specific functions.^9,10)

Various culture techniques have been investigated to maintain liver function, including the use of medium components that suppress EMT,¹¹⁾ sandwich culture where primary hepatocytes are cultured between layers of collagen,^12–14) and microfluidic cell culture.¹⁵⁾ Primary hepatocytes cultured using a three-dimensional (3D) culture method that allows the formation of hepatocyte organoids within the medium or collagen have been able to maintain liver-specific functions for over five weeks.^16–19) In addition, primary hepatocyte spheroids made by mixing collagen microbeads with primary hepatocytes have demonstrated long-term preservation of liver-specific functions such as albumin secretion and ammonia clearance.²⁰⁾ However, analysis of cellular functions and molecular behavior in 3D-cultured primary hepatocyte organoids and spheroids is challenging due to the presence of cells with diverse characteristics and strong cell-cell adhesion with polarity.

Here, we developed a simple and specialized equipment-free method of dispersing and culturing hepatocytes within a dome-shaped collagen matrix. This method enables easy analysis of cellular functions and molecular behaviors, as well as long-term culture of fully functional hepatocytes. Our method has the potential to significantly expand hepatocyte availability, which was previously limited by culture using conventional methods.

MATERIALS AND METHODS

Animal Samples

All experiments were performed in accordance with The Guide for Animal Care and Use of Sumitomo Chemical Co., Ltd.

Cell Culture

Rat and mouse primary hepatocytes were obtained from male 10-week-old Sprague-Dawley rats and male 10-week-old Crl:CD1 mice (The Jackson Laboratory Japan, Inc., Kanagawa, Japan) by a modified two-step collagenase digestion method described previously.²¹⁾ Hepatocyte viability was determined using the trypan blue method, and only hepatocytes with a viability exceeding 80% were included in the study.

In the 2D culture method, rat primary hepatocytes were seeded onto type I collagen-coated culture plates at a density of 1.1 × 10⁴ cells/cm², while mouse primary hepatocytes were seeded at a density of 1.0 × 10⁵ cells/cm².²²⁾ The cells were then cultured at 37 °C in a CO₂ incubator. The culture medium was Hepatocyte Culture Medium (HCM), a component of the HCM BulletKit (Lonza, Basel, Switzerland), which did not contain epidermal growth factor. The medium was replaced every 1–2 d.

In dispersion culture within a dome-shaped collagen matrix, a hepatocyte suspension was prepared by mixing 8 × 10⁶ hepatocytes with 1 mL of 0.4% collagen solution (Native Collagen Acidic Solution (KOKEN Co., Ltd., Tokyo, Japan) 9.5 mL, 10× DMEM 1.19 mL, 1 M NaHCO₃ 238 µL, 1 M HEPES 119 µL, 100× penicillin–streptomycin 114 µL, and distilled water 242 µL). Using a pipette equipped with a wide bore tip, the hepatocyte suspension was dropped onto a culture plate, resulting in the formation of dome-shaped droplets with a volume of 10 µL. The droplets solidified when subjected to a 5-min incubation at 37 °C in a CO₂ incubator. Subsequently, medium warmed to 37 °C was added to the culture plate to ensure complete immersion of the solidified domes, and then the plates were incubated at 37 °C in a CO₂ incubator. The medium was refreshed every 1–2 d.

Cell Viability Assay

After treating dome-shaped collagen with collagenase and collecting the dissociated cells, the survival rate was measured by trypan blue staining.

Quantitative PCR (qPCR)

Samples were obtained at different time points, including before culture (day 0), days 1, 3, 5, and 7. To lyse the collected cells, 1 mL of ISOGEN II (Nippon Gene Co., Ltd., Tokyo, Japan) was added following directions in the ISOGEN II manual. Subsequently, RNA was isolated using RNeasy Kits (QIAGEN N.V., Limburg, the Netherlands). The concentration of the purified RNA was determined using a NanoDrop system (ThermoFisher Scientific Inc., Waltham, MA, U.S.A.), and cDNA synthesis was performed using the LunaScript RT Super Mix Kit (New England Biolabs, Inc. (NEB), Ipswich, MA, U.S.A.). The qPCR reactions for rat primary hepatocytes were performed using TaqMan Fast Advanced Master Mix (ThermoFisher Scientific Inc.) with the TaqMan probe shown in Table 1. The qPCR reactions for mouse primary hepatocytes were performed using Luna Universal qPCR Master Mix (NEB) with the primers shown in Table 2. QuantStudio 3 (ThermoFisher Scientific Inc.) was used for the measurements.

Table 1. TaqMan Assay ID Used for Arc Analyses of Rat Primary Hepatocytes

Gene	Gene name	TaqMan assay ID
rB2M	Rat Beta-2-Microglobulin	Rn00560865_m1
rTGFβ2	Rat Transforming Growth Factor Beta 2	Rn00676060_m1
rCOL1A1	Rat Collagen Type I Alpha 1 Chain	Rn01463848_m1
rVIM	Rat Vimentin	Rn00667825_m1
rACTA2	Rat Actin Alpha 2	Rn01759928_g1
rACTβ	Rat Actin Beta	Rn00667869_m1
rSNAIL2	Rat Snail Family Transcriptional Repressor 2	Rn01404476_m1
rNR1I3	Rat Nuclear Receptor Subfamily 1 Group I Member 3	Rn04339043_m1
rAHR	Rat Aryl Hydrocarbon Receptor	Rn00565750_m1
rNR1I2	Rat Nuclear Receptor Subfamily 1 Group I Member 2	Rn00441185_m1
rPPARα	Rat Peroxisome Proliferator Activated Receptor Alpha	Rn00566193_m1
rCYP2B1	Rat CYP Family 2 Subfamily B Member 1	Rn01457880_m1
rCYP2B2	Rat CYP Family 2 Subfamily B Member 2	Rn02786833_m1
rCYP3A23	Rat CYP Family 3 Subfamily A Member 23	Rn03062228_m1
rUGT1A1	Rat UDP Glucuronosyltransferase Family 1 Member A1	Rn00754947_m1

Table 2. Primer Sequences Used for qPCR Analysis of Mouse Primary Hepatocytes

Gene	Gene name	Primer sequence (5′-3′)
mB2M	Mouse Beta-2-Microglobulin	CGAGACCGATGTATATGCTTGC
		GTCCAGATGATTCAGAGCTCCA
mTGFβ2	Mouse Transforming Growth Factor Beta 2	TCGACATGGATCAGTTTATGCG
		CCCTGGTACTGTTGTAGATGGA
mCOL1A1	Mouse Collagen Type I Alpha 1 Chain	GCTCCTCTTAGGGGCCACT
		CCACGTCTCACCATTGGGG
mVIM	Mouse Vimentin	CGTCCACACGCACCTACAG
		GGGGGATGAGGAATAGAGGCT
mACTA2	Mouse Actin Alpha 2	GTCCCAGACATCAGGGAGTAA
		TCGGATACTTCAGCGTCAGGA
mACTβ	Mouse Actin Beta	GGCTGTATTCCCCTCCATCG
		CCAGTTGGTAACAATGCCATGT
mSNAIL2	Mouse Snail Family Transcriptional Repressor 2	TGGTCAAGAAACATTTCAACGCC
		GGTGAGGATCTCTGGTTTTGGTA
mNR1I3	Mouse Nuclear Receptor Subfamily 1 Group I Member 3	CACAGGCTATCATTTCCACGCC
		CTCACACCTTCCAGCAAACGGA
mAHR	Mouse Aryl Hydrocarbon Receptor	AGCCGGTGCAGAAAACAGTAA
		AGGCGGTCTAACTCTGTGTTC
mNR1I2	Mouse Nuclear Receptor Subfamily 1 Group I Member 2	GCGTCATCAACTTCGCCAAAGTC
		CGTGTTGAACCTCAGGATGCAC
mPPARα	Mouse Peroxisome Proliferator Activated Receptor Alpha	ACCACTACGGAGTTCACGCATG
		GAATCTTGCAGCTCCGATCACAC
mCYP2B10	Mouse CYP Family 2 Subfamily B Member 10	CAGTGTTCCACGAGACTTCA
		GGTACACCTCAGTGTTCTT
mCYP3A11	Mouse CYP Family 3 Subfamily A Member 11	TGCAGAACTTCTCCTTCCAGC
		CCCGTGGCACAACCTTTAGA
mUGT1A1	Mouse UDP Glucuronosyltransferase Family 1 Member A1	GCTTCTTCCGTACCTTCTGTTG
		GCTGCTGAATAACTCCAAGCAT

Enzyme-Linked Immunosorbent Assay (ELISA)

Rat primary hepatocytes were cultured for 14 d. Throughout this time, the culture supernatant was collected at 2-d intervals. The albumin concentration in culture supernatants was then analyzed using the Rat Albumin Assay ELISA Kit (Bethyl Laboratories Inc., Montgomery, TX, U.S.A.) according to the manufacturer’s instructions. The absorbance readings were obtained using the TECAN Infinite M200 Pro plate reader (Tecan Group Ltd., Zurich, Switzerland).

Phalloidin Staining

Rat primary hepatocytes cultured on days 1 and 4 were subjected to fixation using a 4% paraformaldehyde solution for a duration of 20 min. Following fixation, permeabilization was carried out using a 0.2% Triton X-100 solution in Tris buffered saline. Subsequently, the cells were stained with Alexa Fluor Phalloidin (ThermoFisher Scientific Inc.) and Hoechst dye. The resulting samples were observed and imaged using a fluorescence microscope EZ-900 (Keyence Corporation, Osaka, Japan).

Metabolic Enzyme Induction

Two days after seeding the rat primary hepatocytes, phenobarbital (PB) 100 µM, the concentration previously shown to induce CYP2B dependent enzyme activity in cultured rat hepatocytes, was added to the medium.²³⁾ The medium was replaced every 1–2 d. Cells exposed to PB for 3 d were collected. Following the qPCR section of the Materials and Methods, the mRNA level of CYPs was quantified.

Statistical Analysis

Statistical analyses were performed with GraphPad Prism software (version 10.0.3; GraphPad Software, San Diego, CA, U.S.A.). The data were initially tested for homogeneity using an F-test. For the data found to be homogeneous (p > 0.05), unpaired Student t-test was performed. If the data were not homogeneous (p ≤ 0.05), Welch’s t-test was performed.

RESULTS AND DISCUSSION

Method of Dispersion Culture Used to Grow Hepatocytes within a Dome-Shaped Collagen Matrix

In order to utilize primary hepatocytes for drug screening and analysis of hepatotoxicity mechanisms, it is necessary to prevent superfluous cell-cell interactions and maintain a homogeneous population of cells during culture.^24–26) Therefore, a 3D dispersion culture method was developed to grow primary hepatocytes by suspending them in a collagen gel and forming the gel into a dome shape (Fig. 1A). A large volume of collagen gel containing suspended hepatocytes has the potential to decrease the accessibility of cells to nutrients and oxygen within the gel, leading to cell death. Therefore, the volume of collagen gel was at most 10 µL, which is a small volume in terms of cell culture scale. To identify the appropriate cell density for this culture method, cell survival rates were measured. It was found that higher cell densities corresponded to lower survival rates, yet there was a greater total number of live cells per dome (Fig. 1B). A cell density of 8 × 10⁶ cells/mL allows for dispersion culture without cell aggregation and yields a higher total number of live cells, thereby enabling various analyses after culture.

Fig. 1. Procedure and Schematic Diagram of Dispersion Culture within a Dome-Shaped Collagen Matrix

Because the dispersion of primary hepatocytes within the gel minimizes cell–cell interactions, it becomes challenging to analyze tissue-level functions. However, because it allows easy separation of cells after culture, this system is suitable for analyzing cellular and molecular behaviors. Additionally, primary hepatocytes can be cultured as a homogeneous population using this system, which allows for easy control of the cellular microenvironment due to the cells’ ability to interact readily with the extracellular fluid.

Characterization of This 3D Dispersion Method of Culturing Rat Hepatocytes

Primary hepatocytes undergo EMT and experience a decline in liver-specific functions as the culture period progresses. In order to enable the maintenance of liver functions during the culture process, prevention of EMT is crucial. Therefore, to ascertain whether EMT is suppressed by the culture method, we quantified the expression levels of EMT-associated genes in rat primary hepatocytes cultured on collagen-coated plates using both the 3D dispersion culture method and 2D culture method. These genes include TGFβ2,²⁷⁾ which regulates the EMT upstream, vimentin (VIM),²⁸⁾ involved in the promotion and stabilization of EMT, COL1A1, which constitutes type I collagen, ACTA2 and ACTβ,²⁸⁾ associated with actin remodeling during EMT, and SNAIL2,²⁸⁾ involved in the upregulation of mesenchymal markers. Although primary hepatocytes cultured using the 3D method exhibit higher expression of EMT-related genes compared to day 0, they show lower expression of EMT-related genes when compared to cells cultured using the 2D method (Fig. 2A). This suggests that the 3D method may reduce EMT induction compared to the 2D method. In addition, to visualize the expression of actin, one of the EMT-associated genes, rat primary hepatocytes were cultured using both methods and stained on day 1 and day 4 with phalloidin. While actin expression was observed throughout cells cultured via the 2D method, it was only expressed in certain regions of cell adhesion in cells cultured using the 3D method (Fig. 2B).

Fig. 2. Characterization of Rat Primary Hepatocytes Cultured Using Three-Dimensional (3D) Dispersion Culture

(A) Heatmap of the expression levels of EMT-related genes. The gene expression levels, measured by qPCR, are displayed on a logarithmic scale and calculated using the ddCt method with Day 0 set as 1. A comparison was made between freshly isolated hepatocytes (Day 0) and hepatocytes cultured for 4 d using 3D dispersion culture and two-dimensional (2D) culture. (B) Fluorescence microscopy image of cells stained with phalloidin to visualize actin filaments. Scale bar = 10 µm. (C) Gene expression changes in liver function genes. ○ represents 2D culture, and ● represents 3D dispersion culture. Data are presented as mean ±95% CI. (n = 3). On day 7, t-test was performed for 3D and 2D. * p < 0.05, ** p < 0.01. (D) Time-dependent changes in albumin secretion measured by ELISA. ○ represents 2D culture, and ● represents 3D dispersion culture. Data are presented as mean ±95% CI. (n = 3). On day 14, Welch’s t-test was performed for 3D and 2D. * p < 0.05.

To assess the long-term maintenance of liver functions in primary hepatocytes cultured using the 3D method, the expression levels of nuclear receptors (NRs) and drug-metabolizing enzyme genes, as well as the secretion of albumin, were quantified. On day 7 of 3D dispersion culture, the hepatocytes exhibited sustained expression levels of NRs (NR1I3, NR1I2, peroxisome proliferator-activated receptor α (PPARα)) and metabolic enzymes (CYP2B1, CYP3A23, UGT1A1) in comparison to cells in 2D culture (Fig. 2C). The expression levels of CYP2B1 and CYP3A23 in primary hepatocytes cultured in 3D increased starting from day 3. It has been reported that CYP expression levels rise when primary rat hepatocytes are cultured in parallel microfluidic biochips.²⁹⁾ It is possible that similar changes in hepatocyte behavior are occurring as observed in parallel microfluidic biochips culture. Furthermore, consistent results were obtained when measuring albumin secretion on days 8 and 14, aligning with the expression levels of NRs and metabolic enzymes (Fig. 2D).

Furthermore, to investigate the responsiveness of primary hepatocytes in 3D culture towards rodent enzyme inducers, metabolic enzyme induction experiments were conducted using PB. Primary hepatocytes were exposed to PB, a known activator of rat NR1I3, for a duration of 3 d, and the expression levels of PB-induced metabolic enzyme genes (CYP2B1, CYP2B2) were quantified. Notably, primary hepatocytes cultured using the 3D dispersion method exhibited a significant increase in the expression levels of CYP2B1 and CYP2B2 in the PB-exposed group in comparison to the unexposed group (Fig. 3). In primary hepatocytes cultured using the 3D method, the expression of NR1I3 is maintained after Day 3 (Fig. 2C), which suggests that PB activation of NR1I3 leads to the induction of CYP2B expression.

Fig. 3. Expression Levels of Metabolic Enzyme Genes in Rat Primary Hepatocytes Were Evaluated

The gene expression levels were quantified using qPCR and calculated using the ddCt method, with the phenobarbital negative (PB(−)) condition set as the reference point at 1. The hepatocytes were cultured for 4 d using 2D culture or 3D dispersion culture under the PB(−) condition, and were also exposed to PB 100 µM (PB(+)). Data are presented as mean ±95% CI. (n = 3, ** p < 0.01).

These findings suggest that 3D dispersion culture method effectively suppresses EMT in primary hepatocytes isolated from rats, maintains liver functions over an extended culture period, and exhibits heightened responsiveness to enzyme inducers.

Characterization of the 3D Dispersion Method of Mouse Hepatocytes Culture

In order to assess the suppression of EMT, we cultured mouse primary hepatocytes on collagen-coated plates using both the 3D and 2D methods, and quantified the expression levels of EMT-associated genes. Mouse hepatocytes cultured in 3D showed weaker suppression of EMT compared to rat hepatocytes (Fig. 4A).

Fig. 4. Characterization of Mouse Primary Hepatocytes Cultured Using the 3D Dispersion Culture

(A) Heatmap of the expression levels of EMT-related genes. The gene expression levels, measured by qPCR, are displayed on a logarithmic scale and calculated using the ddCt method with Day 0 set as 1. A comparison was made between freshly isolated hepatocytes (Day 0) and hepatocytes cultured for 5 d using 2D culture or 3D dispersion culture. (B) Gene expression changes in liver function genes. ○ represents 2D culture, and ● represents 3D dispersion culture. Data are presented as mean ±95% CI. (n = 3). On day 7, t-test was performed for 3D and 2D. * p < 0.05, ** p < 0.01.

Furthermore, to evaluate the long-term maintenance of liver function in mouse primary hepatocytes cultured using the 3D dispersion culture method, the expression levels of NRs and drug-metabolizing enzyme genes were measured (Fig. 4B). While there were no significant differences in the expression levels of NRs (NR1I3, AHR, NR1I2, PPARα) between the two methods of culture, the expression levels of metabolic enzymes (CYP2B10, CYP3A11, UGT1A1) were maintained in hepatocytes on day 7 of 3D culture, in contrast to day 7 of 2D culture.

The ability of the 3D method to inhibit EMT was weaker in mouse hepatocytes than in rat hepatocytes, and the expression levels of NR1I3 and PPARα were not maintained (Figs. 2A, 4A). This could be attributed to the inappropriate density of the mouse primary hepatocytes. It is known that the optimal cell density for primary hepatocytes differs between rats and mice.^30,31) Additionally, it has been demonstrated that cell density in 2D culture of mouse primary hepatocytes influences the basal cellular activity level.³²⁾ In this study, cells from both rats and mice were cultured at the same cell density, so further investigation into the cell density suitable for mouse cell culture may lead to improvements.

EMT is involved in the early stages of cancer cell metastasis.²⁷⁾ Additionally, there is a positive correlation between liver stiffness measurement and hepatocellular carcinoma (HCC),³³⁾ suggesting that the high stiffness of the extracellular matrix (ECM) promotes EMT. Research using spheroids of the HCC cell line huh-7 demonstrated that increasing the stiffness of the embedded collagen gel enhances both proliferation and dedifferentiation.³⁴⁾ Furthermore, research using primary human hepatocytes revealed that culturing on collagen gel induces a highly differentiated and growth-arrested phenotype, while culturing on collagen films with higher stiffness than collagen gel promotes cell cycle progression and EMT.³⁵⁾ From these findings, it can be inferred that embedding primary hepatocytes in soft collagen, as is done in the 3D method, imposes less mechanical stress on the cells compared to the 2D method, thereby suppressing EMT and maintaining liver functions over the long term. Further improvements are expected to result from optimizing the stiffness of the matrix used to embed primary hepatocytes.

CONCLUSION

In this study, a novel dispersion method of culturing hepatocytes within a dome-shaped collagen matrix was developed to maintain the functionality of hepatocytes over an extended period. This method enabled the preservation of liver functions for more than 14 d by suppressing EMT in rat primary hepatocytes, enabling their potential utilization in relatively long-term experiments, which was not possible with conventional culture methods.

Acknowledgments

The authors deeply appreciate Mr. Souichiro Nakamae for the expert technical assistance and Dr. Hiroyuki Asano, Dr. Satoki Fukunaga, and Mr. Kensuke Kawamoto for providing expert advice. We also thank the other contributors to this research project from Sumitomo Chemical Company Ltd. and Sumika Technoservice Corporation.

Conflict of Interest

The authors declare no conflict of interest.

REFERENCES

• 1) Thompson WL, Takebe T. Human liver model systems in a dish. Dev. Growth Differ., 63, 47–58 (2021).
• 2) Godoy P, Hewitt NJ, Albrecht U, et al. Recent advances in 2D and 3D in vitro systems using primary hepatocytes, alternative hepatocyte sources and non-parenchymal liver cells and their use in investigating mechanisms of hepatotoxicity, cell signaling and ADME. Arch. Toxicol., 87, 1315–1530 (2013).
• 3) Arzumanian VA, Kiseleva OI, Poverennaya EV. The curious case of the HepG2 cell line: 40 years of expertise. Int. J. Mol. Sci., 22, 13135 (2021).
• 4) Gerets HH, Tilmant K, Gerin B, Chanteux H, Depelchin BO, Dhalluin S, Atienzar FA. Characterization of primary human hepatocytes, HepG2 cells, and HepaRG cells at the mRNA level and CYP activity in response to inducers and their predictivity for the detection of human hepatotoxins. Cell Biol. Toxicol., 28, 69–87 (2012).
• 5) Plummer S, Beaumont B, Wallace S, Ball G, Wright J, McInnes L, Currie R, Peffer R, Cowie D. Cross-species comparison of CAR-mediated procarcinogenic key events in a 3D liver microtissue model. Toxicol. Rep., 6, 998–1005 (2019).
• 6) Novik EI, Dwyer J, Morelli JK, Parekh A, Cho C, Pludwinski E, Shrirao A, Freedman RM, MacDonald JS, Jayyosi Z. Long-enduring primary hepatocyte-based co-cultures improve prediction of hepatotoxicity. Toxicol. Appl. Pharmacol., 336, 20–30 (2017).
• 7) Smutny T, Bernhauerova V, Smutna L, Tebbens JD, Pavek P. Expression dynamics of pregnane X receptor-controlled genes in 3D primary human hepatocyte spheroids. Arch. Toxicol., 96, 195–210 (2022).
• 8) Tátrai P, Erdő F, Krajcsi P. Role of hepatocyte transporters in drug-induced liver injury (DILI)—in vitro testing. Pharmaceutics, 15, 1–16 (2023).
• 9) Cicchini C, Amicone L, Alonzi T, Marchetti A, Mancone C, Tripodi M. Molecular mechanisms controlling the phenotype and the EMT/MET dynamics of hepatocyte. Liver Int., 35, 302–310 (2015).
• 10) Godoy P, Hengstler JG, Ilkavets I, Meyer C, Bachmann A, Müller A, Tuschl G, Mueller SO, Dooley S. Extracellular matrix modulates sensitivity of hepatocytes to fibroblastoid dedifferentiation and transforming growth factor β-induced apoptosis. Hepatology, 49, 2031–2043 (2009).
• 11) Xiang C, Du Y, Meng G, et al. Long-term functional maintenance of primary human hepatocytes in vitro. Science, 364, 399–402 (2019).
• 12) Choi HJ, Choi D. Successful mouse hepatocyte culture with sandwich collagen gel formation. J. Korean Surg. Soc., 84, 202–208 (2013).
• 13) Tuschl G, Hrach J, Walter Y, Hewitt PG, Mueller SO. Serum-free collagen sandwich cultures of adult rat hepatocytes maintain liver-like properties long term: a valuable model for in vitro toxicity and drug-drug interaction studies. Chem. Biol. Interact., 181, 124–137 (2009).
• 14) Turpeinen M, Tolonen A, Chesne C, Guillouzo A, Uusitalo J, Pelkonen O. Functional expression, inhibition and induction of CYP enzymes in HepaRG cells. Toxicol. In Vitro, 23, 748–753 (2009).
• 15) Lauschke VM, Hendriks DFG, Bell CC, Andersson TB, Ingelman-Sundberg M. Novel 3D culture systems for studies of human liver function and assessments of the hepatotoxicity of drugs and drug candidates. Chem. Res. Toxicol., 29, 1936–1955 (2016).
• 16) Hu H, Gehart H, Artigiani B, LÖpez-Iglesias C, Dekkers F, Basak O, van Es J, Chuva de Sousa Lopes SM, Begthel H, Korving J, van den Born M, Zou C, Quirk C, Chiriboga L, Rice CM, Ma S, Rios A, Peters PJ, de Jong YP, Clevers H. Long-term expansion of functional mouse and human hepatocytes as 3D organoids. Cell, 175, 1591–1606.e19 (2018).
• 17) Hendriks D, Artigiani B, Hu H, Chuva de Sousa Lopes S, Clevers H. Establishment of human fetal hepatocyte organoids and CRISPR–Cas9-based gene knockin and knockout in organoid cultures from human liver. Nat. Protoc., 16, 182–217 (2021).
• 18) Rose S, Ezan F, Cuvalier M, Bruyère A, Legagneux V, Langouët S, Baffet G. Generation of proliferating human adult hepatocytes using optimized 3D culture conditions. Sci. Rep., 11, 515 (2021).
• 19) Bell CC, Chouhan B, Andersson LC, Andersson H, Dear JAW, Williams DP, Söderberg M. Functionality of primary hepatic non-parenchymal cells in a 3D spheroid model and contribution to acetaminophen hepatotoxicity. Arch. Toxicol., 94, 1251–1263 (2020).
• 20) Kaur I, Vasudevan A, Rawal P, Tripathi DM, Ramakrishna S, Kaur S, Sarin SK. Primary hepatocyte isolation and cultures: technical aspects, challenges and advancements. Bioengineering (Basel), 10, 131 (2023).
• 21) Seglen PO. Preparation of isolated rat liver cells. Methods Cell Biol., 13, 29–83 (1976).
• 22) Hirose Y, Nagahori H, Yamada T, Deguchi Y, Tomigahara Y, Nishioka K, Uwagawa S, Kawamura S, Isobe N, Lake BG, Okuno Y. Comparison of the effects of the synthetic pyrethroid Metofluthrin and phenobarbital on CYP2B form induction and replicative DNA synthesis in cultured rat and human hepatocytes. Toxicology, 258, 64–69 (2009).
• 23) Madan A, DeHaan R, Mudra D, Carroll K, LeCluyse E, Parkinson A. Effect of cryopreservation on cytochrome P-450 enzyme induction in cultured rat hepatocytes. Drug Metab. Dispos., 27, 327–335 (1999).
• 24) Tasnim F, Singh NH, Tan EKF, Xing J, Li H, Lissette S, Manesh S, Fulwood J, Gupta K, Ng CW, Xu S, Hill J, Yu H. Tethered primary hepatocyte spheroids on polystyrene multi-well plates for high-throughput drug safety testing. Sci. Rep., 10, 4768 (2020).
• 25) Yamashita T, Takayama K, Sakurai F, Mizuguchi H. Billion-scale production of hepatocyte-like cells from human induced pluripotent stem cells. Biochem. Biophys. Res. Commun., 496, 1269–1275 (2018).
• 26) Novik EI, Barminko J, Maguire TJ, Sharma N, Wallenstein EY, Schloss RS, Yarmush ML. Augmentation of EB-directed hepatocyte-specific function via collagen sandwich and SNAP. Biotechnol. Prog., 24, 1132–1141 (2008).
• 27) Lamouille S, Xu J, Derynck R. Molecular mechanisms of epithelial-mesenchymal transition. Nat. Rev. Mol. Cell Biol., 15, 178–196 (2014).
• 28) Zhang L, Hu J, Meshkat BI, Liechty KW, Xu J. LncRNA MALAT1 modulates TGF-β1-induced EMT in keratinocyte. Int. J. Mol. Sci., 22, 11816 (2021).
• 29) Legendre A, Baudoin R, Alberto G, Paullier P, Naudot M, Bricks T, Brocheton J, Jacques S, Cotton J, Leclerc E. Metabolic characterization of primary rat hepatocytes cultivated in parallel microfluidic biochips. J. Pharm. Sci., 102, 3264–3276 (2013).
• 30) Schug M, Heise T, Bauer A, Storm D, Blaszkewicz M, Bedawy E, Brulport M, Geppert B, Hermes M, Föllmann W, Rapp K, Maccoux L, Schormann W, Appel KE, Overeem A, Gundert-Remy U, Hengstler JG. Primary rat hepatocytes as in vitro system for gene expression studies: comparison of sandwich, Matrigel and 2D cultures. Arch. Toxicol., 82, 923–931 (2008).
• 31) Guo R, Jiang M, Wang G, Li B, Jia X, Ai Y, Chen S, Tang P, Liu A, Yuan Q, Xie X. IL6 supports long-term expansion of hepatocytes in vitro. Nat. Commun., 13, 7345 (2022).
• 32) Soldatow V, Peffer RC, Trask OJ, Cowie DE, Andersen ME, LeCluyse E, Deisenroth C. Development of an in vitro high content imaging assay for quantitative assessment of CAR-dependent mouse, rat, and human primary hepatocyte proliferation. Toxicol. In Vitro, 36, 224–237 (2016).
• 33) Masuzaki R, Tateishi R, Yoshida H, Goto E, Sato T, Ohki T, Imamura J, Goto T, Kanai F, Kato N, Ikeda H, Shiina S, Kawabe T, Omata M. Prospective risk assessment for hepatocellular carcinoma development in patients with chronic hepatitis C by transient elastography. Hepatology, 49, 1954–1961 (2009).
• 34) Bomo J, Ezan F, Tiaho F, Bellamri M, Langouët S, Theret N, Baffet G. Increasing 3D matrix rigidity strengthens proliferation and spheroid development of human liver cells in a constant growth factor environment. J. Cell. Biochem., 117, 708–720 (2016).
• 35) Hansen LK, Wilhelm J, Fassett JT. Regulation of hepatocyte cell cycle progression and differentiation by type I collagen structure. Curr. Top. Dev. Biol., 72, 205–236 (2006).