The Atypical Dual Specificity Phosphatase DUSP15 Regulates Jak1-Mediated STAT3 Activation

Abstract

The signal transducer and activator of transcription 3 (STAT3) protein is a key regulator of cell differentiation, proliferation, and survival in hematopoiesis, immune responses, and other biological systems. STAT3 transcriptional activity is strictly regulated through various mechanisms, such as phosphorylation and dephosphorylation. In this study, we attempted to identify novel phosphatases which regulate STAT3 activity in response to cytokine stimulations. To this end, leukemia inhibitory factor (LIF)/STAT3 dependent phosphatase induction was evaluated in the mouse hepatoma cell line Hepa1–6. After LIF stimulation, the expression of several atypical dual specific phosphatases (aDUSPs) was upregulated in Hepa1–6 cells. Among the LIF-induced aDUSPs, we focused on DUSP15 and clarified its functions in LIF/STAT3 signaling using RNA interference. DUSP15 knockdown decreased LIF-induced Socs3 mRNA expression and STAT3 translocation. Furthermore, loss of DUSP15 reduced the phosphorylation of STAT3 at Tyr705 and Janus family tyrosine kinase 1 (Jak1) at Tyr1034/1035 in response to LIF. The interaction between Jak1 and DUSP15 was observed in LIF-stimulated Hepa1–6 cells. We also demonstrated the suppression of granulocyte colony-stimulating factor (G-CSF)-mediated gp130/STAT3-dependent cell growth of Ba/F-G133 cells via DUSP15 knockdown. Therefore, DUSP15 functions as a positive feedback regulator in the Jak1/STAT3 signaling cascade.

INTRODUCTION

Janus family tyrosine kinases (Jaks) are constitutively associated with cytokine receptors in cytokine signaling pathways. Upon cytokine stimulation, Jak is activated and is essential for conveying cytokine signals to downstream molecules, such as signal transducers and activators of transcription (STATs) and mitogen-activated protein kinase (MAPK).^1–3) Not only immune systems, but also embryogenesis and oncogenesis, were regulated by the Jak/STAT signaling pathway.^4–7) The interleukin (IL)-6 family of cytokines, including leukemia inhibitory factor (LIF) and leptin, requires gp130 as a co-receptor and predominantly activate Jak1 kinase.⁸⁾ STAT3, a STAT family protein, is phosphorylated and activated by Jak1 after cytokine stimulation, and functions as a signal transducing molecule. In the Jak1/STAT3 pathway, phosphorylation of the tyrosine residue at position 705 of STAT3 is crucial for transducing signals from receptors. Phosphorylated STAT3 dimerizes and is translocated into the nucleus, where it activates target gene expressions such Socs3 and Cebpδ. Several phosphatases inactivate phosphorylated STAT3 in the cytoplasm via SH2-containing phosphatase 1 (SHP1), SHP2, and protein tyrosine phosphatase 1B, and in the nucleus via TC45 and TC-PTP.^9,10)

Dual specificity phosphatases (DUSPs)/MAP kinase phosphatases (MKPs) are known to inactivate the MAP kinases-mediated signaling pathways via dephosphorylating both serine/threonine and tyrosine residues in MAPKs.¹¹⁾ Classical DUSPs contain the MAP kinase-binding (MKB) domain, also known as the Cdc25 homology domain, whereas atypical DUSPs (aDUSPs) lack the MKB domain, suggesting that their targets are MAPKs and also other molecules. In this study, we focused on DUSP15 (also known as VHY¹²⁾), an atypical DUSP, and examined its functions in the LIF-mediated signaling pathway. DUSP15 has been reported to affect the phosphorylation of Erk1/2, activating transcription factor 2, p38MAPK-delta (MK13), platelet-derived growth factor receptor type β, and sorting nexin 6.^13–15) DUSP15 mRNA was upregulated in response to transforming growth factor in the non-small cell lung cancer A549 and pancreatic adenocarcinoma PANC1 cells.¹⁶⁾ However, the functions of DUSP15 in cytokine signaling remain unclear. Some atypical DUSPs target STAT proteins as substrates. VH1, the first atypical DUSP to be cloned from a vaccinia virus,¹⁷⁾ has been reported to dephosphorylate both MAP kinases and STAT1.¹⁸⁾ DUSP3, another atypical DUSP family protein, regulates Tyk2-mediated STAT5 activation.¹⁹⁾ Previously, we reported that an atypical DUSP member, DUSP22, regulated IL-6/LIF-mediated signaling via dephosphorylating STAT3.²⁰⁾

Here, we found that DUSP15 was an LIF-inducible aDUSP in Hepa1–6 cells and investigated its function in the STAT3 signaling pathway. A loss-of-function study using small interfering RNA (siRNA) revealed that the DUSP15 knockdown suppressed STAT3 transcriptional activity. STAT3 translocation and phosphorylation were also affected via siRNA-mediated reduction of DUSP15 expression. Furthermore, the phosphorylation of Jak1 Tyr1034/1035 was diminished because of DUSP15 knockdown. Thus, our study shows that DUSP15 acts as a positive regulator of Jak1-mediated STAT3 signaling.

MATERIALS AND METHODS

Reagents, Antibodies and Expression Plasmids

Recombinant human LIF and granulocyte colony-stimulating factor (G-CSF) were purchased from FUJIFILM Wako Pure Chemical Corporation (Osaka, Japan). LIF was also obtained from human LIF expression vector transfected BMT-10 cells supernatant. Anti-phospho-STAT3 (Tyr705) (D3A7), anti-phospho-Jak1(Tyr1034/1035) (D7N4Z), anti-Jak2 (D2E12) and anti-phospho-Jak2(Tyr1007/1008) (C80C3) antibodies were purchased from Cell Signaling Technologies (Beverly, MA, U.S.A.). Anti-STAT3, anti-Jak1, and anti-actin antibodies were obtained from Santa Cruz Biotechnology (Santa Cruz, CA, U.S.A.). DUSP15-FLAG construct was kindly provided by Yung-Feng Liao (Academia Sinica).¹⁵⁾

Cell Culture and Transfection

Mouse hepatoma cell line Heppa1-6 cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM) containing 10% fetal bovine serum (FBS), 100 U/mL penicillin and 100 µg/mL streptomycin. Ba/F-G133 cells were maintained in RPMI 1640 medium supplemented with 10% FBS, 10% conditioned medium from WEHI-3B cells as a source of IL-3, 100 U/mL penicillin and 100 µg/mL streptomycin. Transfection of siRNA was described as previously.^21,22) Hepa1–6 cells were transfected with each siRNA using Lipofectamine RNAiMAX (Invitrogen, Waltham, MA, U.S.A.), and Ba/F-G133 cells were using the Cell Line Nucleofector Kit V (Lonza, Basel, Switzerland). The sequences of siRNA were as follows, NC; rUrUrCrUrCrCrGrArArCrGrUrGrUrCrArCrGrUTT (sense) and rArCrGrUrGrArCrArCrGrUrUrCrGrGrArGrArATT (antisense), mDUSP15 #1; rGrGrArArUrArArGrArUrCrArCrArCrArUrArUTT (sense) and rArUrArUrGrUrGrUrGrArUrCrUrUrArUrUrCrCrGrGTT (antisense), mDUSP15 #2; rArArArGrArArUrGrCrGrUrCrCrArCrUrUrUrATT (sense) and rUrArArArGrUrGrGrArCrGrCrArUrUrCrUrUrUrGrATT (antisense).

RT-PCR and Quantitative PCR (qPCR)

Total RNA was prepared using RNAiso Plus (TaKaRa Bio, Shiga, Japan) and subjected to reverse transcriptase (RT)-PCR using ReverTra Ace qPCR RT Kit (Toyobo, Osaka, Japan). Quantitative real-time PCR analyses was conducted using a THUNDERBIRD Next SYBR qPCR Mix (Toyobo) on a CFX Connect Real-Time System (Bio-Rad, Hercules, CA, U.S.A.) with standard cycles. Following primers were used; mDUSP3 (NM_028207.3), F-TGCGCCATGGTCACCCACAGCAAGTTT, R- GCACCTTAAAGTGGAGCATCATACTGA; mDUSP11 (NM_028099), F-AACCAGCATTATGGCCGACA, R-TGAAACGAGTCCCAGGCATC; mDUSP12 (NM_001356485), F-TGGTGAACAGTGCTCCTGTG, R-CAACGGGGAAGTGCCTTTCA; mDUSP13A (NM_001007268.1), F-GTGGACGCCCAGAAGATGAA, R-CTGACCGGGCTGTAGTCTTC; mDUSP13B (NM_013849.3), F-CTAGCCCCACTTGGTCTGTG, R-TCTTTGGCCTCCGAAGTTCC mDUSP14 (XM_006533796.5), F-AGTACCAGCATCTGCCACAC, R-CAGGCAACGCACGTATTTCC; mDUSP15 (NM_145744), F-GGTAACTGCCTTGTGCACTG, R-GCCAGAACGCTTGGTGAGAT; mDUSP18 (NM_173745), F-CCTTCCTTCTCGCCGAACTT, R-ACACAACGCCTTACTAGCCC; mDUSP19 (NM_024438), F-CTGAAGGATGGCGTGGTTCT, R-GTAGGTGCGGAGTTGTTCCA; mDUSP21 (NM_028568), F-TCACCGTGATGACAACAGCA, R-TGTCGTTAGCTACCGCAGAG; mDUSP22 (NM_001037955), F-TTGTTCCTTGGACCTGACCG, R-AGGCTTCCTCCTTGGGTAGT; mDUSP23 (NM_026725), F-TCATCACCGCTGCATAGCAT, R-CTGGAGTCCTGGCCTATCCT; mDUSP24 (NM_001289554), F-AGGCAATGCAGACAAGCTCT, R-ATGAGTAAGGCCACCACAGC; mDUSP26 (NM_001357223), F-GTTGGGCAGTGTGATGGGTA, R-CACACCCTGCTCTAACCCAG; mDUSP27 (NM_001033344), F-ACGAAGAACTCAAGCCTCGG, R-TCTTCTCACGGACACGGTTG; mDUSP28 (NM_175118), F-CCTGGGCTCCGTGTGTAAAT, R-CTCAGGCTCCACAGGAACAG; glyceraldehyde-3-phosphate dehydrogenase (Gapdh), F-GAAATCCCATCACCATCTTCCAGG, R-CAGTAGAGGCAGGGATGATGTTC; mSocs3 (NM_007707.3), F-TGCGCCATGGTCACCCACAGCAAGTTT, R-GCACCTTAAAGTGGAGCATCATACTGA.

Indirect Immunofluorescence Confocal Microscopy

Hepa1–6 cells were transfected with control or DUSP15 siRNA by Lipofectamine RNA interference (RNAi) Max, or transfected with FLAG-DUSP5 by polyethylenimine. Thirty-six hours after transfection, cells were serum starved for 12 h and stimulated with LIF for 5 min. Indirect immunofluorescence staining was performed previously.²³⁾ The cells were fixed with 4% paraformaldehyde for 15 min, and permeabilized with 0.1% Triton X-100 in phosphate buffered saline (PBS) for 15 min. The samples were incubated overnight at 4 °C with anti-STAT3 (1 : 1000), Jak1 (1 : 200), or FLAG (1 : 1000) antibody. Then, Alexa 488–conjugated donkey anti-mouse immunoglobulin G or Alexa 568-conjugated donkey anti-rabbit immunoglobulin G was used to detect primary antibody. Samples were mounted with mounting solution containing 4′-6-diamidino-2-phenylindole (DAPI) and observed using an LSM800 confocal microscope.

Immunoprecipitation and Immunoblotting

The immunoprecipitation and immunoblotting assays were performed as described previously.²⁴⁾

In brief, Hepa1–6 cells were harvested and lysed in a lysis buffer (50 mM Tris–HCl, pH 7.4, 0.15 M NaCl, containing 1% NP-40). Then they were centrifuged at 20000 × g for 20 min at 4 °C. For immunoprecipitation assay, lysates were added antibody and protein G-sepharose and incubated for 2h at 4 °C. The beads were washed and resolved by sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE). Then the proteins were transferred to the polyvinylidene difluoride (PVDF) membranes and immunoblotted with the appropriate primary antibodies for 16 h at 4 °C. Proteins reactive with the primary antibodies were visualized using HRP-conjugated secondary antibodies by enhanced chemiluminescence detection system (Cytiva, Marlborough, MA, U.S.A.).

Cell Proliferation Assay

Cell proliferation was determined by Cell Count Reagent SF (Nacalai Tesque, Kyoto, Japan) according to the manufacturer’s instructions. Ba/F-G133 cells were cultured in 96-well plate with the increasing amounts of G-CSF. The cells were cultured for 72 h and then added the WST-8 for 1 h. The absorbance was measured at a test wavelength of 450 nm (OD450) and a reference wavelength of 590 nm (OD590) using a microplate reader (Tecan, Maennedorf, Switzerland).

Statistics

Statistical analyses were performed with GraphPad Prism software or Excel, and statistical significance was set at p < 0.05. All data are presented as the mean with ± standard deviation (S.D.).

RESULTS

Identification of LIF-Inducible Atypical DUSPs

We previously reported that DUSP22 was induced by the IL-6 cytokine family and functioned as a negative feedback regulator of the STAT3-mediated signaling pathway.²⁰⁾ To further investigate the mechanisms of STAT3 regulation by aDUSPs, we identified novel STAT3 signaling regulators in the aDUSP family. We evaluated the mRNA expression levels of aDUSPs in the LIF-stimulated mouse hepatoma cell line, Hepa1–6. Thirty minutes after LIF stimulation, cells were harvested, and total RNA was isolated to monitor aDUSP expression. The expression levels of each aDUSP mRNA were normalized to those of untreated controls. Among the aDUSPs examined, Dusp15, 18, 21, 26, 27, and 28 mRNA levels were increased after LIF stimulation (Fig. 1A). We focused on DUSP15 for further experiments because of its high expression level. To confirm Dusp15 mRNA induction, Hepa1–6 cells were stimulated with LIF for the indicated periods. Induction of Socs3, a STAT3 targeting gene, was robustly increased via LIF stimulation (Fig. 1B). In the same RNA samples, Dusp15 mRNA was also upregulated 3–4 times 30 min after LIF stimulation compared to that in non-stimulated cells (0 min). These data show that DUSP15 was induced via LIF stimulation in Hepa1–6 cells.

Fig. 1. Expression of DUSPs in LIF-Stimulated Hepa1–6 Cells

(A) Hepa1–6 cells in a 6-well plate were serum starved for 16 h. The cells were treated with LIF for 30 min, then total RNA samples isolated from these cells were subjected to RT-PCR with the indicated primers. The result is indicated as fold induction of each mRNA expression to no-stimulated cells. Independent experiments from 2 replicates are summarized and presented as mean ± S.D. (B) Hepa1–6 cells in a 6-well plate were serum starved for 16 h. The cells were treated with LIF for the indicated periods, then total RNA samples isolated from these cells were subjected to RT-PCR. Data are Socs3 and Dusp15 mRNA levels normalized to those of a Gapdh internal control with ± S.D. n = 12 independent experiments. * p < 0.05, ** p < 0.001, *** p < 0.005, one-way ANOVA followed by Dunnett’s test (0 min).

Effect of DUSP15 Knockdown on LIF-Mediated Socs3 Induction and STAT3 Translocation

We then sought to elucidate the function of DUSP15 in LIF-mediated STAT3 transcriptional activity. We assessed the effect of DUSP15 on LIF-induced Socs3 mRNA expression using siRNAs targeting DUSP15 in Hepa1–6 cells. DUSP15 knockdown with two unrelated siRNAs (siDUSP15 #1 and #2) significantly reduced LIF-induced Socs3 mRNA expression 30 and 60 min after stimulation compared to control siRNA (siNC) (Fig. 2A). DUSP15 knockdown was confirmed using quantitative PCR (Fig. 2B). These data suggested that DUSP15 enhanced LIF-induced STAT3 transcriptional activity in Hepa1–6 cells.

Fig. 2. Effect of DUSP15 Knockdown on LIF-Mediated Socs3 Induction and STAT3 Translocation

(A) Hepa1–6 cells in a 12-well plate were transfected with siControl (NC) or siDUSP15 (#1 and #2) (20 pmol), and the cells were cultured for 36 h. At 16 h after serum starvation, the cells were treated with LIF for the indicated periods, then total RNA samples isolated from these cells were subjected to RT-PCR. Data are Socs3 mRNA levels normalized to those of a Gapdh internal control with ±S.D. n = 8 independent experiments. * p < 0.05, ** p < 0.001, one-way ANOVA followed by Dunnett’s test (siNC). (B) Hepa1–6 cells in a 12-well plate were transfected with siControl (NC) or siDUSP15 (#1 and #2) (20 pmol), and the cells were cultured for 24 h, then total RNA were subjected to RT-PCR. Data are Dusp15 mRNA levels normalized to those of a Gapdh internal control with ± S.D. n = 3 independent experiments. ** p < 0.001, one-way ANOVA followed by Dunnett’s test (siNC). (C, D) Hepa1–6 cells on a cover glass in a 12-well plate were transfected with siControl or siDUSP15 (25 pmol). At 36 h after transfection, the cells were serum starved for 16 h and then stimulated with LIF for 5 min. The cells were fixed and stained with anti-STAT3 antibody and DAPI. Scale bars represent 20 µm (C). The nuclear localization of STAT3 in siNC and siDUSP15 transfected cells after LIF treatment was quantified. Approximately 100 cells were classified according to fluorescein signals in the nucleus. Similar results were observed in three independent experiments (D).

Because LIF-mediated STAT3 transcriptional activity was suppressed via DUSP15 knockdown, the effect of DUSP15 on STAT3 translocation was evaluated. We used siDUSP15 #2 for further studies because its knockdown efficiency was higher than that of siDUSP15 #1 in Hepa1–6 cells (Fig. 2B). In the absence of LIF stimulation, STAT3 proteins were not detected using the anti-STAT3 antibody because they diffused throughout the cells (Fig. 2C). At 5 min after LIF treatment, approximately 90% of STAT3 was accumulated in the nucleus from the cytoplasm of control siRNA-transfected Hepa1–6 cells (Fig. 2D). Conversely, STAT3 translocation to the nucleus was significantly suppressed in DUSP15 knockdown Hepa1–6 cells. Thus, DUSP15 increased STAT3 accumulation in the nucleus and facilitated the expression of STAT3-targeting genes.

Suppressed Phosphorylation of STAT3 Tyr705 and Jak1 Tyr1034/1035 in DUSP15 Knockdown Hepa1–6 Cells

Phosphorylated STAT3 forms a homodimer and translocates to the nucleus to bind to target genes. As translocation and transcriptional activity were suppressed via DUSP15 knockdown, we examined LIF-mediated STAT3 phosphorylation in DUSP15 knockdown Hepa1–6 cells. LIF-induced phosphorylation of STAT3 Tyr705 was observed after LIF stimulation (Fig. 3A), and phosphorylated STAT3 levels significantly decreased over time in DUSP15 knockdown cells compared to those in control cells (Fig. 3B). As STAT3 phosphorylation is affected by DUSP15 expression, we examined the phosphorylation of Jak1, which was the predominant upstream kinase of STAT3 signaling.⁸⁾ LIF stimulation increased the phosphorylation of Jak1 Tyr1034/1035 in Hepa1–6 cells (Fig. 3C), and this phosphorylation was significantly suppressed in DUSP15 knockdown cells compared to the control (Fig. 3D). The same lysates were subjected to evaluate the phosphorylation of Jak2 Tyr1007/1008 (Supplementary Fig. 1). Jak2 phosphorylation levels after LIF stimulation were comparable in control and DUSP15 knockdown cells. In contrast to knockdown of DUSP15, we evaluated the effect of overexpression of DUSP15 on Jak1 phosphorylation. Consistent with the decreased expression of DUSP15, overexpressed DUSP15 enhanced the phosphorylation of Jak1 (Figs. 3E, 3F). Evidence that DUSP15 regulates Jak1 phosphorylation suggests that DUSP15 may interact with Jak1. To examine their interaction, Hepa1–6 cells were transfected with FLAG-DUSP15 and then lysed and immunoprecipitated with FLAG antibody. The interaction between DUSP15 and endogenous Jak1 was observed in LIF stimulated cells (Fig. 3G). we also investigated the subcellular localization of these proteins. In Hepa1–6 cells, endogenous Jak1 and over expressed FLAG-DUSP15 were strongly colocalized in cytosol after LIF stimulation (Fig. 3H). Taken together, these data suggested that DUSP15 regulated LIF-induced STAT3 signaling via controlling Jak1 phosphorylation.

Fig. 3. Effect of DUSP15 on LIF-Mediated Phosphorylation of STAT3 and Jak1

(A) Hepa1–6 cells in a 24-well plate were transfected with siControl (NC) or siDUSP15 (15 pmol), and the cells were cultured for 36 h. At 16 h after serum starvation, the cells were treated with LIF for the indicated periods, then lysed for immunoblotting. (B) The graphs show the quantification of phospho-STAT3 levels normalized to STAT3. Independent experiments from 4 replicates are summarized and presented as mean ± S.D. * p < 0.05, ** p < 0.01, *** p < 0.005, Student’s two-tailed t test. (C) Hepa1–6 cells in a 24-well plate were transfected with siControl (NC) or siDUSP15 (15 pmol), and the cells were cultured for 36 h. At 16 h after serum starvation, the cells were treated with LIF for the indicated periods, then lysed for immunoblotting. (D) The graphs show the quantification of phospho-Jak1 levels normalized to Jak1. Independent experiments from 4 replicates are summarized and presented as mean ± S.D. * p < 0.05, *** p < 0.005, Student’s two-tailed t test. (E) Hepa1–6 cells in a 24-well plate were transfected with empty vector or FLAG-DUSP15, and the cells were cultured for 36 h. At 16 h after serum starvation, the cells were treated with LIF for the indicated periods, then lysed for immunoblotting. (F) The graphs show the quantification of phospho-Jak1 levels normalized to Jak1. Independent experiments from 3 replicates are summarized and presented as mean ± S.D. *** p < 0.005, Student’s two-tailed t test. (G) Hepa1–6 cells were transfected with Vector or FLAG-DUSP15 plasmid. At 36 h after transfection, cells were stimulated with LIF for 5 min, then lysed and immunoprecipitated with anti-FLAG antibody, and immunoblotted with anti-Jak1 and anti-FLAG antibodies. (H) Hepa1–6 cells were transfected with FLAG-DUSP15 plasmid. At 24 h after transfection, cells were stimulated with LIF for 5 min, then fixed and stained with the indicated antibodies. Scale bars represent 20 µm.

Regulation of STAT3-Mediated Cell Growth by DUSP15 in Ba/F-G133 Cells

We evaluated the physiological roles of DUSP15 in cell culture. We examined the effect of DUSP15 knockdown on STAT3-mediated cell growth using an IL-3-dependent pro-B cell line, Ba/F-G133, which expressed a chimeric receptor composed of the extracellular domain of G-CSF receptor and the cytoplasmic domain of gp130. In Ba/F-G133 cells, G-CSF stimulates gp130/STAT3-dependent cell growth in the absence of IL-3.²⁵⁾ Therefore, we assessed the role of DUSP15 in gp130/STAT3-mediated cell proliferation using this cell line. At first, Dusp15 mRNA expression was analyzed in this cell. Induction of Socs3 and Dusp15 mRNA were increased at 30 and 60 min after G-CSF stimulation compared to that in non-stimulated cells (0 min). We also examined the phosphorylation of Jak1 with G-CSF stimulation (Supplementary Fig. 2). Then, we evaluated the efficiency of siDUSP15 knockdown in Ba/F-G133 cells. Endogenous expression of DUSP15 was observed to be strongly reduced via transfection with either siDUSP15 #1 (68% knockdown) or #2 (41% knockdown) in Ba/F-G133 cells (Fig. 4A). Ba/F-G133 cells were subjected to a proliferation assay. Cells were transfected with siNC, siDUSP15 #1 or #2 and incubated with the indicated amount of G-CSF for three days without IL-3. DUSP15 knockdown suppressed G-CSF-mediated gp130/STAT3-dependent Ba/F-G133 cell growth (Fig. 4B). Therefore, DUSP15 may be a functional regulator of STAT3-dependent cell proliferation.

Fig. 4. DUSP15 Regulates STAT3-Dependent Cell Growth

(A) Ba/F-G133 cells were treated with G-CSF (10 ng/mL) for the indicated periods, then total RNA samples isolated from these cells were subjected to RT-PCR. Data are Socs3 and Dusp15 mRNA levels normalized to those of a Gapdh internal control with ± S.D. n = 3 independent experiments. * p < 0.05, *** p < 0.005, one-way ANOVA followed by Dunnett’s test (0 min). (B) Ba/F-G133 cells were transfected with siNC or siDUSP15 (#1 or #2) (200 pmol). At 3 d after transfection, total RNA samples were subjected to RT-PCR. Data are Dusp15 mRNA levels normalized to those of a Gapdh internal control with ± S.D. n = 3 independent experiments. ** p < 0.001, one-way ANOVA followed by Dunnett’s test (siNC). (C) G-CSF-induced cell proliferation of siRNA transfected Ba/F-G133 cells was measured with WST8 assay. Data show mean ± S.D. of duplicate samples and representative of three independent experiments. * p < 0.05, ** p < 0.001, one-way ANOVA followed by Dunnett’s test (siNC).

DISCUSSION

Classical DUSPs target MAPKs as substrates for dephosphorylation, and their MKB domain is utilized to recognize targets, whereas atypical DUSPs lack this domain, suggesting that they can target other MAPKs.¹¹⁾ The STAT family molecules may be targets of aDUSPs. VH1 reportedly dephosphorylates MAP kinases and STAT1,¹⁸⁾ and DUSP3/VHR dephosphorylates both MAP kinases and STAT5.¹⁹⁾ Most DUSPs are inducible genes and basal levels of DUSPs are largely low in non-stressed or unstimulated cells.^26,27) We previously reported that DUSP22 was induced by the IL-6 cytokine family and negatively regulated STAT3 signaling as a feedback inhibitor via binding to and dephosphorylating STAT3.²⁰⁾ DUSP22 is also induced by β-estradiol in breast cancer cells and suppresses estrogen receptor α-mediated gene expressions following its dephosphorylation.²⁸⁾ In this study, we screened LIF-induced genes and identified DUSP15 as a protein that was strongly induced via LIF stimulation in the mouse hepatoma cell line Hepa1–6. As the functions of DUSP15 in IL-6 cytokine family signaling have not been reported, we attempted to evaluate and reveal novel roles of DUSP15 in the Jak/STAT3 signaling cascade. Originally, DUSP15 was reported to be a myristoylated protein that was highly expressed in the testes of humans and mice. In humans, DUSP15 mRNA is also expressed at extremely low levels in the brain, spinal cord, and thyroid gland.¹²⁾ DUSP15 expression is induced throughout Schwann cell and oligodendrocyte differentiation and DUSP15 plays a role in regulating myelin development.^13,14) Here, we showed that DUSP15 was induced by LIF in Hepa1–6 cells and gp130-mediated stimulation in Ba/F-G133, and regulated Jak1/STAT3 signal as a feedback regulator. Loss of DUSP15 suppressed gp130/STAT3-dependent cell growth in Ba/F-G133 cells. DUSP15 is a functional positive feedback regulator of the STAT3 signaling pathway.

DUSP15 has been reported to have phosphatase activity,^12,14) whereas DUSP15 positively regulates Erk signaling. However, direct targets of DUSP15 in Erk signaling have not been identified.^13,15) The siRNA-mediated reduction of DUSP15 resulted in suppression of Erk phosphorylation in LIF-stimulated Hepa1–6 cells (data not shown). Therefore, DUSP15 positively regulates the Erk pathway via LIF stimulation. As MAPK signaling is activated by Jak kinase,¹⁾ the suppressed phosphorylation of Erk in DUSP15 knockdown cells may be caused by Jak1 inactivation. Several phosphorylation sites are present in Jak kinases to regulate their enzymatic activities.^29,30) Two adjacent tyrosines, Y1034 and Y1035, of human Jak1 in the activation loop of the kinase domain are transphosphorylated by the Jak1 dimer, resulting in catalytic activity.³¹⁾ AMPK-mediated phosphorylation of S515 and S518 in human Jak1 abolishes IL-6-induced STAT3 phosphorylation.³²⁾ Therefore, S515 and S518 residues presumably act as negative regulators of Jak1 kinase activity. In this study, we showed that LIF-induced phosphorylation of Jak1 Y1034/1035 was decreased in DUSP15 knockdown Hepa1–6 cells. DUSP15 may dephosphorylate Jak1 S515/S518 and suppress Jak1 autophosphorylation activity, although we could not determine the phosphorylation levels of S515/S518 because of the unavailability of antibodies to monitor their phosphorylation. As Jak1 interacts and colocalizes with DUSP15 after LIF stimulation, Jak1 could be a direct target of DUSP15 after cytokine binding to the receptor. Our data may suggest a novel regulation of Jak1/STAT3 signaling via DUSP15-mediated mechanisms, which will be the focus of future research.

Acknowledgments

This work was supported by Grants from JSPS KAKENHI Grant Number 22H03544, the Shimizu Foundation for Immunology and Neuroscience Grant for 2020, and Kyoto Pharmaceutical University Fund for the Promotion of Scientific Research to Y.S.

Conflict of Interest

The authors declare no conflict of interest.

Supplementary Materials

This article contains supplementary materials.

REFERENCES

• 1) Matsuda T. The physiological and pathophysiological role of IL-6/STAT3-mediated signal transduction and STAT3 binding partners in therapeutic applications. Biol. Pharm. Bull., 46, 364–378 (2023).
• 2) Levy DE, Darnell JE Jr. Stats: transcriptional control and biological impact. Nat. Rev. Mol. Cell Biol., 3, 651–662 (2002).
• 3) Shuai K, Liu B. Regulation of JAK-STAT signalling in the immune system. Nat. Rev. Immunol., 3, 900–911 (2003).
• 4) Kiu H, Nicholson SE. Biology and significance of the JAK/STAT signalling pathways. Growth Factors, 30, 88–106 (2012).
• 5) O’Shea JJ, Pesu M, Borie DC, Changelian PS. A new modality for immunosuppression: targeting the JAK/STAT pathway. Nat. Rev. Drug Discov., 3, 555–564 (2004).
• 6) Villarino AV, Kanno Y, O’Shea JJ. Mechanisms and consequences of Jak-STAT signaling in the immune system. Nat. Immunol., 18, 374–384 (2017).
• 7) O’Shea JJ, Schwartz DM, Villarino AV, Gadina M, McInnes IB, Laurence A. The JAK-STAT pathway: impact on human disease and therapeutic intervention. Annu. Rev. Med., 66, 311–328 (2015).
• 8) Sims NA. The JAK1/STAT3/SOCS3 axis in bone development, physiology, and pathology. Exp. Mol. Med., 52, 1185–1197 (2020).
• 9) Yamamoto T, Sekine Y, Kashima K, Kubota A, Sato N, Aoki N, Matsuda T. The nuclear isoform of protein-tyrosine phosphatase TC-PTP regulates interleukin-6-mediated signaling pathway through STAT3 dephosphorylation. Biochem. Biophys. Res. Commun., 297, 811–817 (2002).
• 10) Böhmer FD, Friedrich K. Protein tyrosine phosphatases as wardens of STAT signaling. JAK-STAT, 3, e28087 (2014).
• 11) Alonso A, Sasin J, Bottini N, Friedberg I, Friedberg I, Osterman A, Godzik A, Hunter T, Dixon J, Mustelin T. Protein tyrosine phosphatases in the human genome. Cell, 117, 699–711 (2004).
• 12) Alonso A, Narisawa S, Bogetz J, Tautz L, Hadzic R, Huynh H, Williams S, Gjörloff-Wingren A, Bremer MC, Holsinger LJ, Millan JL, Mustelin T. VHY, a novel myristoylated testis-restricted dual specificity protein phosphatase related to VHX. J. Biol. Chem., 279, 32586–32591 (2004).
• 13) Rodríguez-Molina JF, Lopez-Anido C, Ma KH, Zhang C, Olson T, Muth KN, Weider M, Svaren J. Dual specificity phosphatase 15 regulates Erk activation in Schwann cells. J. Neurochem., 140, 368–382 (2017).
• 14) Schmidt F, van den Eijnden M, Pescini Gobert R, Saborio GP, Carboni S, Alliod C, Pouly S, Staugaitis SM, Dutta R, Trapp B, Hooft van Huijsduijnen R. Identification of VHY/Dusp15 as a regulator of oligodendrocyte differentiation through a systematic genomics approach. PLOS ONE, 7, e40457 (2012).
• 15) Bhore N, Wang BJ, Wu PF, Lee YL, Chen YW, Hsu WM, Lee H, Huang YS, Yang DI, Liao YF. Dual-specificity phosphatase 15 (DUSP15) modulates notch signaling by enhancing the stability of notch protein. Mol. Neurobiol., 58, 2204–2214 (2021).
• 16) Guler S, Zik B, Yalcin A. Upregulation of dual-specificity phosphatase-26 is required for transforming growth factor β1(TGFβ1)-induced epithelial-mesenchymal transition in A549 and PANC1 cells. Mol. Biol. Rep., 49, 10195–10204 (2022).
• 17) Guan KL, Broyles SS, Dixon JEA. Tyr/Ser protein phosphatase encoded by vaccinia virus. Nature, 350, 359–362 (1991).
• 18) Najarro P, Traktman P, Lewis JA. Vaccinia virus blocks gamma interferon signal transduction: viral VH1 phosphatase reverses Stat1 activation. J. Virol., 75, 3185–3196 (2001).
• 19) Hoyt R, Zhu W, Cerignoli F, Alonso A, Mustelin T, David M. Cutting edge: selective tyrosine dephosphorylation of interferon-activated nuclear STAT5 by the VHR phosphatase. J. Immunol., 179, 3402–3406 (2007).
• 20) Sekine Y, Tsuji S, Ikeda O, Sato N, Aoki N, Aoyama K, Sugiyama K, Matsuda T. Regulation of STAT3-mediated signaling by LMW-DSP2. Oncogene, 25, 5801–5806 (2006).
• 21) Sekine Y, Siegel CS, Sekine-Konno T, Cafferty WBJ, Strittmatter SM. The nociceptin receptor inhibits axonal regeneration and recovery from spinal cord injury. Sci. Signal., 11, eaao4180 (2018).
• 22) Sekine Y, Yamamoto C, Kakisaka M, Muromoto R, Kon S, Ashitomi D, Fujita N, Yoshimura A, Oritani K, Matsuda T. Signal-transducing adaptor protein-2 modulates Fas-mediated T cell apoptosis by interacting with caspase-8. J. Immunol., 188, 6194–6204 (2012).
• 23) Oonishi T, Nishimura K, Takata K, Fujimuro M, Sekine Y. Scraping assay as a novel strategy to evaluate axonal regeneration using human-induced pluripotent stem cell-derived neurons. Biol. Pharm. Bull., 47, 366–372 (2024).
• 24) Sekine Y, Kikkawa K, Witthuhn BA, Kashiwakura JI, Muromoto R, Kitai Y, Fujimuro M, Oritani K, Matsuda T. A novel intramolecular negative regulation of mouse Jak3 activity by tyrosine 820. Int. Immunol., 34, 303–312 (2022).
• 25) Fukada T, Hibi M, Yamanaka Y, Takahashi-Tezuka M, Fujitani Y, Yamaguchi T, Nakajima K, Hirano T. Two signals are necessary for cell proliferation induced by a cytokine receptor gp130: involvement of STAT3 in anti-apoptosis. Immunity, 5, 449–460 (1996).
• 26) Keyse SM. Protein phosphatases and the regulation of mitogen-activated protein kinase signalling. Curr. Opin. Cell Biol., 12, 186–192 (2000).
• 27) Jeffrey KL, Camps M, Rommel C, Mackay CR. Targeting dual-specificity phosphatases: manipulating MAP kinase signalling and immune responses. Nat. Rev. Drug Discov., 6, 391–403 (2007).
• 28) Sekine Y, Ikeda O, Hayakawa Y, Tsuji S, Imoto S, Aoki N, Sugiyama K, Matsuda T. DUSP22/LMW-DSP2 regulates estrogen receptor-alpha-mediated signaling through dephosphorylation of Ser-118. Oncogene, 26, 6038–6049 (2007).
• 29) Raivola J, Haikarainen T, Abraham BG, Silvennoinen O. Janus kinases in leukemia. Cancers (Basel), 13, 800 (2021).
• 30) Matsuda T, Feng J, Witthuhn BA, Sekine Y, Ihle JN. Determination of the transphosphorylation sites of Jak2 kinase. Biochem. Biophys. Res. Commun., 325, 586–594 (2004).
• 31) Feng J, Witthuhn BA, Matsuda T, Kohlhuber F, Kerr IM, Ihle JN. Activation of Jak2 catalytic activity requires phosphorylation of Y1007 in the kinase activation loop. Mol. Cell. Biol., 17, 2497–2501 (1997).
• 32) Rutherford C, Speirs C, Williams JJ, Ewart MA, Mancini SJ, Hawley SA, Delles C, Viollet B, Costa-Pereira AP, Baillie GS, Salt IP, Palmer TM. Phosphorylation of Janus kinase 1 (JAK1) by AMP-activated protein kinase (AMPK) links energy sensing to anti-inflammatory signaling. Sci. Signal., 9, ra109 (2016).