Pentadecyl, an Active Component of Microalgae, Ameliorates Endoplasmic Reticulum Stress and Blue Light-Induced Cell Death in Mouse Retina-Derived 661W Cells

Abstract

Light stress is a risk factor leading to retinal diseases such as age-related macular degeneration. However, the mechanism underlying the stress response to light in the retina has yet to be elucidated. We have reported that exposure to blue light-emitting diode light induces excessive production of reactive oxygen species and activates the unfolded protein response, robustly increasing activating transcription factor 4 (ATF4) expression. These processes result in photoreceptor cell death. This study investigates the effects of Pentadecyl, a bioactive product obtained from Aurantiochytrium limacinum, on either chemical-induced or blue light-induced endoplasmic reticulum (ER) stress. Pentadecyl suppressed cell death induced by either thapsigargin or tunicamycin in a concentration-dependent manner. Pentadecyl also suppressed the expression of unfolded protein response target genes, including Atf4 and ER chaperones. Consistently, immunoblotting revealed that Pentadecyl suppressed the increased expression of ATF4 at the protein level. Pentadecyl also protected 661W cells from blue light-induced damage but did not protect against hydrogen peroxide (H₂O₂)-induced oxidative stress. These results indicated that Pentadecyl has a novel function that protects against ER stress induced by photodamage.

INTRODUCTION

With remarkable advances in science and technology, we are surrounded by many electronic devices, such as smartphones and tablets equipped with light-emitting diode (LED) displays. While electronic devices have made our society more information-rich, there is concern about the effects of light on the eyes. Light stress is a risk factor for retinal diseases such as age-related macular degeneration.¹⁾ The mechanism underlying the light injury-induced stress response in the retina remains unknown. We have reported that exposure to blue LED light induces excessive production of reactive oxygen species and activates the unfolded protein response (UPR),²⁾ robustly increasing activating transcription factor (ATF)4 expression.³⁾ The endoplasmic reticulum (ER) is an organelle that functions as a site for the translation and modification of membrane and secretory proteins. When abnormalities occur in the higher-order structure formation process during protein translation, unfolded proteins accumulate in the ER, resulting in ER stress. In mammalian cells exposed to ER stress, the UPR is triggered via three principal ER stress sensors: inositol-requiring enzyme 1α (IRE1α), ATF6, and protein kinase R-like ER kinase (PERK).⁴⁾ In response to ER stress, ATF4, a downstream factor of the PERK pathway, regulates the transcription of genes involved in protein refolding, translational repression, and apoptosis. One of the pro-apoptotic genes that ATF4 induces is C/EBP homologous protein (CHOP).⁵⁾ Therefore, daily use of ingredient(s) that ameliorate ER stress may benefit eye health by protecting photoreceptors from photodamage induced by artificial light sources.

Aurantiochytrium, an oleaginous microorganism of the Thraustochytrids family, contains many bioactive lipid components such as squalene, docosahexaenoic acid, and odd-chain saturated fatty acids.⁶⁾ Dietary intake of odd-chain saturated fatty acids, such as pentadecanoic acid [C15:0], and heptadecanoic acid [C17:0], has been associated with lower risks of several diseases, including type 2 diabetes.⁷⁾ Pentadecyl is a bioactive product extracted from Aurantiochytrium limacinum. Recently, Pentadecyl has been shown to improve glucose intolerance and decrease the expression of ER stress-related genes in pancreatic beta cell-specific CDKAL1-deficient mice, a model of Asian-type type 2 diabetes.⁸⁾ These findings indicate that in ocular tissues, Pentadecyl may relieve ER stress induced by excess exposure to light.

This study aims to investigate the effects of Pentadecyl on either chemical-induced or blue light-induced ER stress. First, we treated 661W cells with Pentadecyl and investigated the lipid storage organelle, the lipid droplet. Next, we evaluated the effects of Pentadecyl on cell death induced by either thapsigargin or tunicamycin. Finally, we carried out quantitative (q)RT-PCR and immunoblotting to examine the impact of Pentadecyl on the UPR.

MATERIALS AND METHODS

Reagents

Pentadecyl was gifted from Sea Act Co., Ltd. (Tokyo, Japan). The following primary antibodies were used in this study: Perilipin 2 (PLIN2; rabbit, Proteintech, 15294-1-AP, Rosemont, IL, U.S.A., 1 : 200 for IF, 1 : 1000 for IB), β-Actin (mouse, Sigma-Aldrich, A2228, St. Louis, MO, U.S.A., 1 : 100000 for IB), ATF4 (rabbit, Cell Signaling Technology, 11815, Beverly, MA, U.S.A., 1 : 1000 for IB), CHOP (rabbit, Proteintech, 15204-1-AP, 1 : 1000 for IB), and Heme oxygenase-1 (HO-1; rabbit, Santa Cruz, H-105, sc-10789, Dallas, TX, U.S.A., 1 : 1000 for IB). The following secondary antibodies were used in this study: Alexa Fluor 488 goat anti-rabbit antibody (1 : 400 for IF) and horseradish peroxidase (HRP)-conjugated antibody (goat anti-rabbit or goat anti-mouse, 1 : 10000 for IB). The secondary antibodies were purchased from Thermo Fisher Scientific (Waltham, MA, U.S.A.). Tunicamycin, thapsigargin, and N-acetylcysteine (NAC) were purchased from FUJIFILM-Wako Pure Chemical Corporation (Osaka, Japan). Tauroursodeoxycholic acid (TUDCA) and 3-methyl-1-phenyl-2-pyrazolin-5-one (edaravone) were purchased from Tokyo Chemical Industry Co. Ltd. (Tokyo, Japan).

Cell Culture and Plasmid DNA Transfection

Mouse retina-derived 661W cells (gifted by M. R. Al-Ubaidi, University of Houston, TX, U.S.A.)⁹⁾ were maintained as described previously.¹⁰⁾ 661W cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM; Nacalai Tesque, Kyoto, Japan) with 10% fetal bovine serum (FBS; VALEANT, Costa Mesa, CA, U.S.A.) at 37 °C in a humidified atmosphere of 5% CO₂. The cells were passaged by trypsinization every 2 or 3 d. Transfection using the Neon NxT Electroporation System was carried out following manufacturer protocols (1350 V, 30 ms, 2 pulses). pCX-HO1-2A-EGFP was a gift from Roberto Giovannoni (Addgene plasmid # 74672; http://n2t.net/addgene:74672; RRID: Addgene_74672).¹¹⁾ pCAGIG was a gift from Connie Cepko.¹²⁾ 0.2 and 2.0 µg of plasmid DNAs were transfected into 1.0 × 10⁵ cells for low and high expression, respectively.

Immunostaining

Immunostaining was conducted as described previously.¹⁰⁾ Briefly, 661W cells were seeded on 12-mm glass coverslips (No. 1-S, Matsunami Glass Industry, Osaka, Japan) coated with 0.2% porcine skin gelatin (Sigma-Aldrich) at 1.5 × 10⁴ cells/well in a 6-well plate (Corning, Corning, NY, U.S.A.), and cultured overnight at 37°C, 5% CO₂. After the medium was exchanged to DMEM supplemented with 1% FBS, Pentadecyl was added to the culture at a final concentration of either 1 or 10 µg/mL, followed by an additional incubation for 8 h. The cells on the coverslips were rinsed once with phosphate-buffered saline (PBS) containing 0.2 mM CaCl₂ and 2 mM MgCl₂ (PBS-C/M) and then subjected to fixation with 4% paraformaldehyde (Electron Microscopy Sciences, Fort Washington, PA, U.S.A.) in PBS-C/M for 10 min at room temperature. The fixed samples were then incubated with a blocking buffer (PBS-C/M containing 0.5% BSA, 0.5% saponin, 0.2 mg/mL sodium azide, and 0.2 µg/mL DAPI) for 30 min. Next, the samples were incubated with anti-PLIN2 antibody in the blocking buffer for 1 h and further incubated with Alexa 488 conjugated anti-rabbit antibody in PBS-C/M for 30 min. After washing three times with PBS-C/M, the coverslips were mounted on a slide with ProLong Diamond Antifade Mountant (Thermo Fisher Scientific). The images were captured using a 60× objective lens on an Olympus FLUOVIEW FV3000 confocal laser scanning microscope (Olympus Corporation, Tokyo, Japan).

Cell Lysis and Immunoblotting

Cell lysis and immunoblotting were performed as described previously.¹⁰⁾ Briefly, 661W cells cultured in a 12-well plate (Corning) were washed once with 1 × PBS and lysed in RIPA buffer [50 mM Tris–HCl 150 mM NaCl 0.5% sodium deoxycholate 0.1% sodium dodecyl sulfate (SDS) and 0.1% NP-40] containing protease inhibitor cocktail, phosphatase inhibitor cocktail 2, and phosphatase inhibitor cocktail 3 (Sigma-Aldrich). The protein samples were boiled in sample buffer solution (FUJIFILM-Wako Pure Chemical Corporation) for 5 min and then separated by electrophoresis (2 µg per lane) on a 5–20% gradient SDS-polyacrylamide gel (SuperSep Ace, FUJIFILM-Wako Pure Chemical Corporation). After transfer to a PVDF membrane (Immobilon-P, Merck Millipore Corp., Billerica, MA, U.S.A.), the membranes were incubated with Blocking One-P solution (Nacalai Tesque) for 1 h at room temperature. The membranes were then incubated with primary antibodies in Can Get Signal Immunoreaction Enhancer Solution-1 (Toyobo, Osaka, Japan) overnight in a cold room, followed by incubation with secondary antibodies in Can Get Signal Immunoreaction Enhancer Solution-2 (Toyobo) for 2 h at room temperature. The chemiluminescent signals were detected using an Amersham Imager 680 (GE Healthcare, Chicago, IL, U.S.A.) and analyzed using Amersham Imager 680 Analysis software (GE Healthcare).

Cell Death Assay

Cell death assays were performed as described previously.¹⁰⁾ Briefly, 661W cells were seeded in 96-well plates at a density of 3000 cells/well and cultured in 5.0% CO₂ at 37°C for 24 h. After changing the medium, the cells were incubated for 1 h with chemicals. Next, the cells were incubated at 37°C in 5.0% CO₂ under blue light exposure (464 nm, M-Trust Co., Ltd., Hyogo, Japan) at 450 lx for 24 h. After irradiation, 8.1 µM of Hoechst 33342 and 1.5 µM of propidium iodide (PI) were added and incubated for 15 min. The images were collected using a Lionheart FX Automated Microscope (Bio Tek Instruments, Winooski, VT, U.S.A.), and the percentage of PI-positive cells relative to Hoechst 33342-positive cells was automatically calculated by the Gen5 software (Bio Tek Instruments) as a cell death ratio.

Real-Time PCR

Real-time PCR was performed according to the manufacturer’s instructions. Total RNA was extracted from 661W cells grown in a 12-well plate (Corning) using NucleoSpin RNA (TaKaRa Bio, Shiga, Japan). A cDNA library was created using a PrimeScript RT Reagent kit (TaKaRa Bio) and was then subjected to qPCR performed on a Thermal Cycler Dice Real-Time System III (TaKaRa Bio) using TB Green Premix Ex Taq II (TaKaRa Bio). The primer pairs used in this study are shown in Table 1. The CT values were normalized to Gapdh.

Table 1. List of Forward (F) and Reverse (R) Primer Sequences Used in this Study

Gene	Primer sequence (5′-3′)		Reference
Atf4	F: GCAAGGAGGATGCCTTTTC	R: GTTTCCAGGTCATCCATT CG	Ooe et al., 20173)
Bip	F: CTCCACGGCTTCCGATAA	R: TCCAGTCAGATCAAATGTACCCAG	Nakanishi et al., 201334)
Chop	F: AATAACAGCCGGAACCTGAGGA	R: CCCAATTTCATCTGAGGACAGGA	Nakanishi et al., 201334)
Der1	F: CGCGATTTAAGGCCTGTTAC	R: GGTAGCCAGCGGTACAAAAA	Ozawa et al., 202235)
Gapdh	F: AGGAGCGAGACCCCACTAAC	R: GATGACCCTTTTGGCTCCAC	Ozawa et al., 202235)
Grp94	F: TTTGAACCTCTGCTCAACTGGAT	R: CTGACTGGCCACAAGAGCACA	Ooe et al., 20173)
Xbp1s	F: CTGAGTCCGCAGCAGGTG	R: TGCCCAAAAGGATATCAGACT	Ozawa et al., 202235)

Statistics

The test results are presented as the mean ± standard error of the mean (S.E.M.). The SPSS Statistics software (IBM, Armonk, NY, U.S.A.) was used for statistical comparisons. Statistical comparisons were performed using the Tukey test, Student’s t-test, or Dunnett’s test. A p-value < 0.05 was considered statistically significant.

RESULTS

Pentadecyl Ameliorated ER Stress-Induced Cell Death in 661W Cells

First, we evaluated the effects of Pentadecyl on 661W cells. The cell number was significantly reduced when 661W cells were incubated with Pentadecyl at 50 µg/mL for 24 h (Fig. 1A). We then examined the intracellular distribution of lipids by immunostaining for PLIN2, which is a marker of lipid droplets. The size of the lipid droplet was enlarged after treatment with Pentadecyl (Fig. 1B). Consistently, the protein levels of PLIN2 were increased in the cells incubated with 10 µg/mL of Pentadecyl for 6 h (Figs. 1C, 1D). Our results indicated that 10 µg/mL of Pentadecyl is sufficient to alter cell metabolism, especially intracellular lipid distribution and its associated protein expression profile.

Fig. 1. Pentadecyl Promoted Lipid Droplet Formation in 661W Cells

(A) Quantification of cell numbers after treatment with Pentadecyl at the indicated concentrations for 24 h. (B) Representative images of immunostaining PLIN2 (green) in 661W cells treated with Pentadecyl for 8 h. Nuclei were stained with DAPI (blue). White dashed lines denote cell border. Enlarged views of the indicated areas are shown in the upper left corners. Bar = 10 µm. (C) The immunoblot images and (D) quantification of PLIN2 and β-actin in lysates from 661W cells treated with 10 µg/mL of Pentadecyl for 8 h. β-Actin was used as a loading control. N = 6. The data represent the means ± S.E.M.s. ^***p < 0.001, Tukey’s test vs. control (Cont); ^*p < 0.05, Student’s t-test vs. Control (−).

Recently, it has been shown that Pentadecyl decreases the elevation in UPR gene expression in the islets of the pancreatic-specific Cdka11 KO mice fed high-fat diets.⁸⁾ Thus, we assessed the effects of Pentadecyl on ER stress. We induced ER stress by incubation with either 2 µM of thapsigargin or 10 µg/mL of tunicamycin for 24 h (Fig. 2A). TUDCA is a known chemical that attenuates ER stress. The cell death ratio was elevated when 661W cells were treated with thapsigargin, which was significantly suppressed in the presence of Pentadecyl at 1 and 10 µg/mL, as well as 10 µM of TUDCA (Figs. 2B, 2C). Additionally, Pentadecyl (1 and 10 µg/mL) also ameliorated tunicamycin-induced cell death (Fig. 2D).

Fig. 2. Pentadecyl Ameliorated ER Stress-Induced 661W Cell Death

(A) The diagram shows the timeline of the chemical treatments. (B) Representative images of co-staining with propidium iodide (PI; magenta) and Hoechst 33342 (blue). Arrowheads indicate PI-positive dead cells. Bar = 200 µm. (C, D) The bar graphs show the cell death rates calculated as a percentage of PI-positive to Hoechst 33342-positive cells. N = 6. The data represent the means ± S.E.M.s. ^***p < 0.001, Tukey’s test vs. control (Cont); ^††p < 0.01, ^†††p < 0.001, Tukey’s test vs. vehicle (Veh). TU, TUDCA.

Pentadecyl Suppressed UPR Target Gene Expression and Thapsigargin-Induced ATF4 Protein Expression in 661W Cells

We then asked whether Pentadecyl suppresses UPR gene expression. To test this, we extracted total RNA from 661W cells treated with thapsigargin for 8 h (Fig. 3A) and performed quantitative RT-PCR (qRT-PCR) on genes associated with the ER stress response, including Atf4, Bip, Grp94, Chop, and Xbp1s, as well as ER-associated degradation represented by Der1. Thapsigargin treatment significantly increased the expression of all the target genes: Atf4, a transcriptional regulator within the PERK pathway,¹³⁾ rose to 15.9 ± 0.8; Bip and Grp94, involved in the ATF6 pathway,¹⁴⁾ increased to 91.1 ± 4.6 and 14.0 ± 0.7, respectively; and Chop, a pro-apoptotic marker linked to both the ATF6 and PERK pathways,¹⁵⁾ reached 383.3 ± 19.2. Similarly, Xbp1s, a transcription factor primarily associated with the IRE1α pathway,¹⁶⁾ was upregulated to 83.6 ± 4.2, and Der1, associated with ER-associated degradation through the IRE1 pathway,¹⁷⁾ increased to 5.084 ± 0.254. Interestingly, Pentadecyl (10 µg/mL) significantly reduced the mRNA levels of Atf4, Bip, and Grp94 to 5.9 ± 0.3, 47.2 ± 2.4, and 6.9 ± 0.3, respectively, but had no significant effect on the expression of Chop, Xbp1s, or Der1 (Figs. 3B–3G).

Fig. 3. In 661W Cells, Pentadecyl Suppressed UPR Target Gene Expression Stimulated by Thapsigargin

(A) The diagram depicts the timeline of the chemical treatments and qRT-PCR analyses. (B–G) The bar graphs show the results of qPCR analyses of (B) Atf4, (C) Bip, (D) Grp94, (E) Chop, (F) Xbp1s, and (G) Der1. The results were normalized to Gapdh and are shown as the fold change relative to the control. N = 3–4. The data represent the means ± S.E.M.s. ^**p < 0.01, ^***p < 0.001, Tukey’s test vs. control (Cont); ^†p < 0.05, Tukey’s test vs. vehicle (Veh).

Next, we surveyed ATF4 protein expression at the same time as the qRT-PCR analysis (Fig. 4A). ATF4 and CHOP was robustly increased in the cells treated with thapsigargin (Figs. 4B, 4D). ATF4 was barely detectable in the control group (Figs. 4B, 4C). Treatment with Pentadecyl (10 µg/mL) significantly suppressed the ATF4 expression but did not suppress the CHOP expression induced by thapsigargin (Figs. 4C–4F). The protein level of HO-1 was also increased in the cells treated with thaspigagin, but the treatment of Pentadecyl did not alter the increase of HO-1 (Fig. 4G). Altogether, Pentadecyl specifically suppressed the increase of ATF4 protein level.

Fig. 4. Pentadecyl Reduced the Elevated ATF4 Protein Levels in 661W Cells Treated with Thapsigargin

(A) The diagram shows the timeline of the chemical treatments and immunoblotting. (B, D, F) Representative immunoblot images (B, ATF4; D, CHOP; F, HO-1) of 661W lysates from cells treated with or without 2 µM of thapsigargin and with or without Pentadecyl treatment at the indicated concentrations. β-Actin was used as a loading control. Quantification of (C) ATF4, (E) CHOP, and (G) HO-1 protein levels. The bar graphs show fold changes compared with thapsigargin treatment only. N = 6. The data represent the means ± S.E.M.s. ^**p < 0.005, ^***p < 0.001, Tukey’s test vs. control (thapsigargin −, Pentadecyl −); ^†p < 0.05, Tukey’s test vs. vehicle (thapsigargin +, Pentadecyl −).

Pentadecyl Protected 661W Cells from Blue Light Irradiation-Induced Cell Death but Not from Hydrogen Peroxide-Induced Oxidative Stress-Mediated Cell Death

We reported that exposure to blue LED light increases reactive oxygen species and the expression of ATF4.³⁾ We next sought to assess the effects of Pentadecyl on blue light-induced cell damage and oxidative stress (Fig. 5A). Blue light irradiation-induced cell death was inhibited by treatment with Pentadecyl at 10 µg/mL as well as 1 mM of NAC (Figs. 5B, 5C). On the contrary, Pentadecyl did not protect 661W cells from hydrogen peroxide-induced cell death, which was prevented by the radical scavenger, edaravone (Fig. 5D). Taken together, these results indicated that Pentadecyl may not affect the excess reactive oxygen species (ROS) production induced by blue light.

Fig. 5. Pentadecyl Protected 661W Cells from Blue Light Irradiation-Induced Cell Death but Not from Hydrogen Peroxide-Induced Oxidative Stress-Mediated Cell Death

(A) The diagram depicts the timeline of the chemical treatments and blue light irradiation at 450 (lx). (B) Representative images of co-staining with propidium iodide (PI; magenta) and Hoechst 33342 (blue). Arrowheads indicate PI-positive dead cells. Bar = 200 µm. (C, D) The bar graphs show the cell death rates calculated as a percentage of PI-positive to Hoechst 33342-positive cells. N = 5–6. The data represent the means ± S.E.M.s. ^***p < 0.001, Tukey’s test vs. control (Cont); ^†††p < 0.001, Tukey’s test vs. vehicle (Veh). NAC, N-acetylcysteine; Eda, edaravone.

To investigate the effects of Pentadecyl on ER stress marker expression, we performed immunoblotting of ATF4 in lysates from 661W cells exposed to blue light for 8 h (Fig. 6A). As reported previously,³⁾ the ATF4 levels increased after blue light exposure, which was suppressed in the presence of Pentadecyl (Figs. 6B, 6C). Blue light exposure increased the CHOP level, which was not suppressed in the presence of Pentadecyl (Figs. 6D, 6E). We also found that the level of HO-1 was increased by the blue light, which was not suppressed in the presence of Pentadecyl (Figs. 6F, 6G). Taken together, we concluded that Pentadecyl could ameliorate the ER stress induced by blue light irradiation.

Fig. 6. In 661W Cells, Pentadecyl Suppressed the Elevation of ATF4 Protein Levels

(A) The diagram shows the timeline of Pentadecyl treatment, blue light exposure, and assays. (B, D, F) Representative immunoblot images (B, ATF4; D, CHOP; F, HO-1) of 661W lysates from cells treated with Pentadecyl after exposure to blue light. Quantification of (C) ATF4, (E) CHOP, and (G) HO-1 protein levels. The bar graphs show fold changes compared with blue light exposure only. N = 6. The data represent the means ± S.E.M.s. ^***p < 0.001, Tukey’s test vs. control (blue light −, Pentadecyl −); ^††p < 0.001, Tukey’s test vs. blue light only (blue light +, Pentadecyl −).

HO-1 Protected 661W Cells from the Cell Injury Induced by Blue Light Irradiation

When endoplasmic reticulum stress-inducing thapsigargin or light damage was added, HO-1 was found to increase at the protein level when subjected to both types of damage (Figs. 4G, 6G). To examine the role of HO-1 for the stress response against blue light exposure, we transiently expressed human HO-1 in 661W cells (Fig. 7A). The protein levels of exogenously expressed HO-1 (Fig. 7A, white arrow) at high level was similar to the one of endogenous HO-1 (Fig. 7A, black arrow). When we examined how cell death is altered by thapsigargin and blue light damage with respect to exogenous and endogenous HO-1, we found that cell death was significantly suppressed in the group expressing exogenous HO-1 when blue light damage was applied (Figs. 7D, 7E), suggesting that HO-1 can suppress oxidative stress but not ER stress.

Fig. 7. Exogenous Expression of HO-1 Protected 661W Cells from Blue Light Irradiation-Induced Cell Death but Not from ER Stress-Mediated Cell Death

(A) Representative immunoblot images of 661W lysates from cells transfected with either mock vector (pCAGIG) or pCX-HO1-2A-EGFP at low or high concentration. The white and black arrows indicate exogenous expressed HO-1 and endogenous HO-1, respectively. (B) The diagram depicts the timeline of the transfection and the exposure to either blue light irradiation (450 lx) or thapsigargin (2 µM). (C) Representative images of co-staining with propidium iodide (PI; magenta) and Hoechst 33342 (blue). Arrowheads indicate PI-positive dead cells. Bar = 200 µm. (D, E) The bar graphs show the cell death rates calculated as a percentage of PI-positive to Hoechst 33342-positive cells. N = 6. The data represent the means ± S.E.M.s. ^***p < 0.001, unpaired two-tailed Student’s t-test vs. the group without Thapsigargin or Blue light (−); ^†p < 0.05, Dunnet test vs. Mock with Thapsigargin or Blue light (+).

DISCUSSION

In this study, we examined the effects of Pentadecyl, a bioactive product obtained from A. limacinum, on either chemical-induced or blue light-induced ER stress using an in vitro model. Pentadecyl inhibited thapsigargin- or tunicamycin-induced cell death in 661W cells in a concentration-dependent manner at concentrations of 0.1–10 µg/mL (Fig. 2). Pentadecyl showed a protective effect against blue light-induced cell death at a concentration of 10 µg/mL. By contrast, it did not inhibit cell death caused by hydrogen peroxide treatment (Fig. 5). qRT-PCR analysis revealed that treatment with Pentadecyl (10 µg/mL) significantly attenuated thapsigargin-induced gene expression of UPR target genes, including Atf4 and Bip (Fig. 3). In a previous study, the variation of ER stress-related genes (bip, grp94, atf4) was examined under light stress, and it was confirmed that blue light irradiation increased their mRNA levels, respectively. Consistently, immunoblotting showed that Pentadecyl suppressed the increased ATF4 protein levels induced by either thapsigargin or blue light exposure (Figs. 4, 6). This increase in atf4 mRNA is not characteristic of 661W cells, and similar variations have been observed in the cardiomyocyte cell line HL-1. However, the transcription factor responsible for this increase in atf4 mRNA has not yet been identified. There is a need for further study. In conclusion, Pentadecyl is a novel compound that protects against light-induced ER stress in photoreceptors. As for the lack of expression changes in chop downstream of atf4 by Pentadecyl in the present study, chop is not only involved in the PERK pathway, but also in other pathways of ER stress, such as the ATF6 pathway. Therefore, it is likely that the action of Pentadecyl alone did not significantly suppress chop. ATF6 pathway could be also a target of Pentadecyl. Further studies are also necessary for mechanisms of actions of how Pentadacyl suppresses ER stress.

The main fatty acid components of Pentadecyl are an odd number of saturated fatty acids, which include pentadecanoic acid [C15:0] (>73%), followed by tridecanoic acid [C13:0] and heptadecanoic acid [C17:0].^6,8) It has been reported that circulating levels of odd-chain fatty acids are linked to the risk of metabolic syndromes and cardiovascular disease.⁷⁾ In the present study, we found that Pentadecyl promotes lipid droplet formation in 661W cells (Fig. 1). Odd-chain fatty acids undergo beta-oxidation, which may affect mitochondrial energy production. Blue LED light damage has been shown to strongly impair mitochondrial function.²⁾ The formation of lipid droplets is also associated with mitochondrial metabolism. Pentadecyl may modulate energy metabolism in ocular tissues, including photoreceptors. Further investigation is necessary to address how Pentadecyl is metabolized inside the cells and how it impacts the membrane organelles. Lipid droplets visualized by PLIN2 can be a source of ATP. However, the detailed action is not known. Therefore, further studies are necessary for the detailed action of lipid droplets.

The ER is known to interact with other cellular organelles, and it is becoming clear that the ER is closely related to mitochondria.¹⁸⁾ Mitochondria generate ROS when producing energy through aerobic respiration, and blue LED light disrupts the electron transport system and promotes ROS production.¹⁹⁾ ATF4 also contributes to the maintenance of mitochondrial function and the synthesis of necessary substances.²⁰⁾ Exposure to blue LED light has been shown to induce increased expression of ATF4 in photoreceptor cells.³⁾ It is believed that ER stress caused by excessive light damage induces photoreceptor cell death via the apoptotic pathway associated with CHOP activation.²¹⁾ Tunicamycin is a compound produced by actinomycetes that induces ER stress by inhibiting protein folding via suppressing the first step of the N-linked glycosylation pathway. In the present study, Pentadecyl showed a protective effect against tunicamycin-induced damage. It is already clear that ER stress in the retina is associated with various retinal diseases, including retinitis pigmentosa and glaucoma.^22–24) Further investigation to clarify the relationship between excess light exposure and ER stress in the retina will be necessary to develop future therapeutic agents to treat various retinal diseases.

We have been searching for compounds that exhibit protective effects against photodamage. It has been shown that ER stress and ROS are involved in blue LED light-induced cellular damage.²⁾ Edaravone,²⁵⁾ NSP-116,²⁶⁾ and SUN N8075²⁷⁾ function as free radical scavengers that inhibit light-induced oxidative stress that when left unchecked, produces retinal damage. In addition, RS9, an Nrf2 activator, showed protective effects against retinal light-induced damage by inducing HO-1 expression.²⁸⁾ These findings suggested that the regulation of oxidative stress is necessary for cytoprotection against photodamage and that the expression of antioxidant enzymes such as HO-1 is effective as a cytoprotective agent. Anthocyanins, a type of polyphenol and flavonoid, and astaxanthin, a type of carotenoid, are useful antioxidants that exhibit protective effects on the retina in a mouse model of photodamage.²⁹⁾ It has been suggested that under light damage conditions, anthocyanins and maqui berries (Aristotelia chilensis) protect cells by inhibiting both ROS production and mitochondrial fragmentation.^30,31) In addition, astaxanthin derivatives, including adonixanthin, show protective effects against retinal light damage via activation of Nrf2 as an antioxidant response.³²⁾ With respect to blue light damage, bilberry (Vaccinium myrtillus L.) and apple berry, which contain high concentrations of polyphenols, suppress 661W cell hypoactivity and ROS production.³⁾ Pentadecyl showed no significant effects against oxidative-induced stress, which suggested that the protective effect against blue light damage is not a secondary response due to a radical scavenging activity. Interestingly, anthocyanins and bilberry also inhibit the blue LED light-induced upregulation of ATF4 expression.³⁾ Blue LED light-induced ER stress was suppressed by blueberry stem extract via an antioxidant effect.³³⁾ It remains unclear whether the effects of Pentadecyl are due to the chaperone-like action of the UPR or other mechanisms. Further studies focused on the molecular mechanisms of the protective effects of these compounds are warranted.

Acknowledgments

This work was supported by a Grant-in-Aid for Early-Career Scientists from the Japan Society for the Promotion of Science (No. 21K14999 to W.O.) and Shin Nippon Biomedical Laboratories, Ltd.

Author Contributions

Conceptualization: M.O., W.O., and M.S.; methodology, formal analysis, and investigation: M.O., W.O., K.Y., S.N., and M.S.; writing, reviewing, and editing: M.O., W.O., S.N., and M.S.; supervision: H.I., Y.S., M.T., H.T., and M.S.

Conflict of Interest

The authors declare no conflict of interest.

REFERENCES

• 1)  Cruickshanks KJ, Klein R, Klein BEK, Nondahl DM. Sunlight and the 5-year incidence of early age-related maculopathy the beaver dam eye study. Arch. Ophthalmol., 119, 246–250 (2001).
• 2)  Kuse Y, Ogawa K, Tsuruma K, Shimazawa M, Hara H. Damage of photoreceptor-derived cells in culture induced by light emitting diode-derived blue light. Sci. Rep., 4, 5223 (2014).
• 3)  Ooe E, Tsuruma K, Kuse Y, Kobayashi S, Shimazawa M, Hara H. The involvement of ATF4 and S-opsin in retinal photoreceptor cell damage induced by blue LED light. Mol. Vis., 23, 52–59 (2017).
• 4)  Mori K. Signalling pathways in the unfolded protein response: development from yeast to mammals. J. Biochem., 146, 743–750 (2009).
• 5)  Wortel IMN, van der Meer LT, Kilberg MS, van Leeuwen FN. Surviving stress: modulation of ATF4-mediated stress responses in normal and malignant cells. Trends Endocrinol. Metab., 28, 794–806 (2017).
• 6)  Kaya K, Shiraishi F, Iida T, Yamada M, Sano T. An acidic morpholine derivative containing glyceride from thraustochytrid, Aurantiochytrium. Sci. Rep., 11, 6868 (2021).
• 7)  Venn-Watson S, Lumpkin R, Dennis EA. Efficacy of dietary odd-chain saturated fatty acid pentadecanoic acid parallels broad associated health benefits in humans: could it be essential? Sci. Rep., 10, 8161 (2020).
• 8)  Kaneko H, Sakakida K, Kaya K, Tsuboi M, Sakata Y, Sakamoto S, Wei FY, Tomizawa K. Improvement of glucose intolerance in Asian-type diabetes model mice using pentadecyl, pentadecanoic acid-based triglyceride. Diabetes Obes. Int. J., 8, 1–7 (2023).
• 9)  Tan E, Ding X-Q, Saadi A, Agarwal N, Naash MI, Al-Ubaidi MR. Expression of cone-photoreceptor-specific antigens in a cell line derived from retinal tumors in transgenic mice. Invest. Ophthalmol. Vis. Sci., 45, 764–768 (2004).
• 10)  Otsu W, Ishida K, Nakamura S, Shimazawa M, Tsusaki H, Hara H. Blue light-emitting diode irradiation promotes transcription factor EB-mediated lysosome biogenesis and lysosomal cell death in murine photoreceptor-derived cells. Biochem. Biophys. Res. Commun., 526, 479–484 (2020).
• 11)  Cinti A, De Giorgi M, Chisci E, Arena C, Galimberti G, Farina L, Bugarin C, Rivolta I, Gaipa G, Smolenski RT, Cerrito MG, Lavitrano M, Giovannoni R. Simultaneous overexpression of functional human HO-1, E5NT and ENTPD1 protects murine fibroblasts against TNF-α-induced injury in vitro. PLOS ONE, 10, e0141933 (2015).
• 12)  Matsuda T, Cepko CL. Electroporation and RNA interference in the rodent retina in vivo and in vitro. PNAS, 101, 16–22 (2003).
• 13)  Lu PD, Harding HP, Ron D. Translation reinitiation at alternative open reading frames regulates gene expression in an integrated stress response. J. Cell Biol., 167, 27–33 (2004).
• 14)  Jin S, Jin B, Ishikawa T, Ninagawa S, Okada T, Koyasu S, Harada H, Mori K. Loss of ATF6α in a human carcinoma cell line is compensated not by its paralogue ATF6β but by sustained activation of the IRE1 and PERK arms for tumor growth in nude mice. Mol. Biol. Cell, 34, ar20 (2023).
• 15)  Kawabata S, Gills JJ, Mercado-Matos JR, LoPiccolo J, Wilson W 3rd, Hollander MC, Dennis PA. Synergistic effects of nelfinavir and bortezomib on proteotoxic death of NSCLC and multiple myeloma cells. Cell Death Dis., 3, e353 (2012).
• 16)  Sidrauski C, Walter P. The transmembrane kinase ire1p is a site-specific endonuclease that initiates mRNA splicing in the unfolded protein response. Cell, 90, 1031–1039 (1997).
• 17)  Nishitoh H, Kadowaki H, Nagai A, Maruyama T, Yokota T, Fukutomi H, Noguchi T, Matsuzawa A, Takeda K, Ichijo H. ALS-linked mutant SOD1 induces ER stress- and ASK1-dependent motor neuron death by targeting Derlin-1. Genes Dev., 22, 1451–1464 (2008).
• 18)  Rowland AA, Voeltz GK. Endoplasmic reticulum-mitochondria contacts: Function of the junction. Nat. Rev. Mol. Cell Biol., 13, 607–625 (2012).
• 19)  Tao JX, Zhou WC, Zhu XG. Mitochondria as potential targets and initiators of the blue light hazard to the retina. Oxid. Med. Cell. Longev., 2019, 6435364 (2019).
• 20)  Kasai S, Yamazaki H, Tanji K, Engler MJ, Matsumiya T, Itoh K. Role of the ISRRATF4 pathway and its cross talk with Nrf2 in mitochondrial quality control. J. Clin. Biochem. Nutr., 64, 1–12 (2019).
• 21)  Shimazawa M, Sugitani S, Inoue Y, Tsuruma K, Hara H. Effect of a sigma-1 receptor agonist, cutamesine dihydrochloride (SA4503), on photoreceptor cell death against light-induced damage. Exp. Eye Res., 132, 64–72 (2015).
• 22)  Ito Y, Shimazawa M, Inokuchi Y, Yamanaka H, Tsuruma K, Imamura K, Onoe H, Watanabe Y, Aihara M, Araie M, Hara H. Involvement of endoplasmic reticulum stress on neuronal cell death in the lateral geniculate nucleus in the monkey glaucoma model. Eur. J. Neurosci., 33, 843–855 (2011).
• 23)  Ojino K, Shimazawa M, Izawa H, Nakano Y, Tsuruma K, Hara H. Involvement of endoplasmic reticulum stress in optic nerve degeneration after chronic high intraocular pressure in DBA/2J mice. J. Neurosci. Res., 93, 1675–1683 (2015).
• 24)  Chan P, Stolz J, Kohl S, Chiang WC, Lin JH. Endoplasmic reticulum stress in human photoreceptor diseases. Brain Res, 1648(Pt. B):538–541, 2016.
• 25)  Shimazaki H, Hironaka K, Fujisawa T, Tsuruma K, Tozuka Y, Shimazawa M, Takeuchi H, Hara H. Edaravone-loaded liposome eyedrops protect against light-induced retinal damage in mice. Invest. Ophthalmol. Vis. Sci., 52, 7289–7297 (2011).
• 26)  Izawa H, Shimazawa M, Inoue Y, Uchida S, Moroe H, Tsuruma K, Hara H. Protective effects of NSP-116, a novel imidazolyl aniline derivative, against light-induced retinal damage in vitro and in vivo. Free Radic. Biol. Med., 96, 304–312 (2016).
• 27)  Ojino K, Shimazawa M, Ohno Y, Otsuka T, Tsuruma K, Hara H. Protective effect of SUN N8075, a free radical scavenger, against excessive light-induced retinal damage in mice. Biol. Pharm. Bull., 37, 424–430 (2014).
• 28)  Inoue Y, Shimazawa M, Noda Y, Nagano R, Otsuka T, Kuse Y, Nakano Y, Tsuruma K, Nakagami Y, Hara H. RS9, a novel Nrf2 activator, attenuates light-induced death of cells of photoreceptor cells and Müller glia cells. J. Neurochem., 141, 750–765 (2017).
• 29)  Tanaka J, Nakanishi T, Ogawa K, Tsuruma K, Shimazawa M, Shimoda H, Hara H. Purple rice extract and anthocyanidins of the constituents protect against light-induced retinal damage in vitro and in vivo. J. Agric. Food Chem., 59, 528–536 (2011).
• 30)  Tanaka J, Kadekaru T, Ogawa K, Hitoe S, Shimoda H, Hara H. Maqui berry (Aristotelia chilensis) and the constituent delphinidin glycoside inhibit photoreceptor cell death induced by visible light. Food Chem., 139, 129–137 (2013).
• 31)  Yamazaki K, Ishida K, Otsu W, Muramatsu A, Nakamura S, Yamada W, Tsusaki H, Shimoda H, Hara H, Shimazawa M. Delphinidins from Maqui Berry (Aristotelia chilensis) ameliorate the subcellular organelle damage induced by blue light exposure in murine photoreceptor-derived cells. BMC Complement. Med. Ther., 24, 3 (2024).
• 32)  Inoue Y, Shimazawa M, Nagano R, Kuse Y, Takahashi K, Tsuruma K, Hayashi M, Ishibashi T, Maoka T, Hara H. Astaxanthin analogs, adonixanthin and lycopene, activate Nrf2 to prevent light-induced photoreceptor degeneration. J. Pharmacol. Sci., 134, 147–157 (2017).
• 33)  Ogawa K, Karitani T, Otsu W, Nishiyama K, Kunitake H, Goto Y, Nomiyama S, Hara H, Yamasaki M. Blueberry stem extract suppresses blue light-emitting diode light-induced endoplasmic reticulum stress on retinal photoreceptor cells. BPB Reports, 6, 87–97 (2023).
• 34)  Nakanishi T, Shimazawa M, Sugitani S, Kudo T, Imai S, Inokuchi Y, Tsuruma K, Hara H. Role of endoplasmic reticulum stress in light-induced photoreceptor degeneration in mice. J. Neurochem., 125, 111–124 (2013).
• 35)  Ozawa Y, Toda E, Homma K, Osada H, Nagai N, Tsubota K, Okano H. Effects of epigenetic modification of PGC-1α by a chemical chaperon on mitochondria biogenesis and visual function in retinitis pigmentosa. Cells, 11, 1497 (2022).