Adipose-Derived Mesenchymal Stromal/Stem Cells Reduce Inflammatory Responses and Partially Alleviate Skin Symptoms in Imiquimod-Induced Psoriasis-Like Dermatitis Model Mice

Abstract

Transplantation of adipose-derived mesenchymal stromal/stem cells (ASCs) has successfully alleviated the severity of psoriasis. Although several therapeutic mechanisms of mesenchymal stromal/stem cells (MSCs) for psoriasis have been elucidated using the imiquimod (IMQ)-induced psoriasis-like dermatitis model, the effects of MSC transplantation on pathways other than the interleukin (IL)-23/T helper 17 (Th17) axis, including the IL-36 pathway, remain unclear. In this study, we aimed to investigate the efficacy of ASC transplantation for the IMQ-induced psoriasis-like dermatitis in male C57BL/6J mice, and to elucidate its effects on the IL-36 pathway as well as the IL23/Th17 axis. ASCs (2.0 × 10⁶ cells) from mouse inguinal white adipose tissue were subcutaneously injected into the dorsal skin of mice. After the topical application of IMQ cream for 5 consecutive days, objective severity scores, cytokine gene expression levels, and neutrophil infiltration grade were determined to evaluate their efficacy. Anti-IL-23p19 antibody treatment was used for comparison. ASCs slightly ameliorated IMQ-induced epidermal thickening, although anti-IL-23p19 antibodies had no effect on any skin manifestations. Anti-IL-23p19 antibody and ASC suppressed the expressions of Il17a, Il17f, and Il22 mRNAs and neutrophil infiltration in IMQ-applied skin, but not the expression of Il1f6 and Il1f9. ASC also suppressed the expressions of Il23, Il6, Il1b, Tnfa, Lipocalin-2, and Cxcl5 mRNAs, which were not suppressed by anti-IL-23p19 antibody treatment. In conclusion, ASC transplantation suppressed activation of the IL-23/Th17 axis and neutrophil infiltration, and inhibited the activation of a broader range of inflammatory mediators except for IL-36 expression in IMQ-applied skin compared with anti-IL-23p19 antibody treatment.

INTRODUCTION

Psoriasis is a chronic inflammatory disease of the skin characterized by the abnormal proliferation of keratinocytes and infiltration of inflammatory cells.^1,2) The prevalence of psoriasis varies by ethnicity and region. In western Europe, 1.5% of the population is affected.¹⁾ Cytokines that activate the interleukin (IL)-23/T helper (Th) 17 cell axis including IL-23, IL-17, IL-22, tumor necrosis factor (TNF)-α, and interferon (IFN)-γ act on inflammatory cells and keratinocytes to progress the pathogenesis of psoriasis.³⁾ Indeed, biologics targeting TNF-α, IL-17, and IL-23 were highly effective and useful for the management of psoriasis.^1,4) However, continued treatment with biologics is often limited by their adverse events, pregnancy, and high cost, and failure to continue treatment leads to a relapse of symptoms related to residual pathogenic T cells.^2,3,5) For example, the median time to loss of the psoriasis area severity index (PASI) 75 with anti-IL-23p19 antibodies (Abs) (guselkumab and tildrakizumab) was reported to be approximately 32 weeks, while other biologics and oral systemic treatments showed an even shorter time to relapse compared with anti-IL-23p19 Abs.⁶⁾ Therefore, there is a need to develop new strategies for the curative therapy of psoriasis.

Mesenchymal stromal/stem cells (MSCs) are present in almost all tissues, including the bone marrow, adipose tissue, and umbilical cord, and they have potential for tissue repair and immunomodulation.^7–9) In clinical studies, MSCs and their extracellular vesicles ameliorated several inflammatory diseases,¹⁰⁾ including rheumatoid arthritis,¹¹⁾ inflammatory bowel disease,⁹⁾ and psoriasis.^12–19) In contrast, the intravenous administration of MSCs caused embolic disease as an adverse event.²⁰⁾ Several pilot studies have shown that MSC transplantation for psoriasis patients exhibited regression of disease and stable remission for over 1 year.¹⁹⁾ For example, all eight patients who received intravenous injections of adipose-derived MSCs (ASCs) at 2 × 10⁶ cells/kg had at least a 50% reduction in the PASI score from baseline without serious adverse events, and three of the eight patients maintained remission for at least 1 year.¹⁸⁾ Furthermore, 17 psoriatic patients treated with multiple intravenous infusions of human umbilical cord-derived MSCs at 1.5–3.0 × 10⁶ cells/kg had no serious adverse events, and 8 of 17 patients had at least a 40% reduction in the PASI score 6 months after treatment.¹⁷⁾ Although these clinical studies have demonstrated the benefit of MSC transplantation for psoriasis, the degree of efficacy varied among several reports due to the heterogeneity in cell populations, donor status, and/or the culture conditions of MSCs.^{2,19,21–23)} The efficacy of MSC transplantation for psoriasis is partly related to an increased regulatory T (Treg)/Th17 cell ratio,¹⁷⁾ decreased serum IL-17, TNF-α, and reactive oxygen species (ROS) levels,^12,17) and restoration of adaptive immune diversity.¹⁸⁾ However, its mechanisms have not been fully understood.

Several psoriatic animal models have been developed to help elucidate the pathogenesis of psoriasis, including the imiquimod-induced psoriasis-like dermatitis model (IMQ-model).^24–26) The expression profiles of genes in the skin of these psoriatic mouse models were statistically similar to those of psoriatic patients.^26–28) The IMQ-model mouse is often used to evaluate the efficacy of the transplantation of MSCs derived from humans and mice.^2,3,29–37) These studies reported that MSC transplantation ameliorated objective severity scores and suppressed epidermal thickening, neutrophil infiltration, and the IL-23/Th17 axis activation induced by IMQ application. However, the experimental procedures, including the timing, route, dose, and number of repetitions of MSC transplantation, source of MSCs, site and duration of IMQ application, mouse strains, and time of evaluation differed in each study.¹⁹⁾ Furthermore, there are few reports evaluating the effect of MSC transplantation on pathways other than the IL-23/Th17 axis, such as the IL-36 pathway in the IMQ model, which is activated in patients with generalized pustular psoriasis.³⁸⁾ Therefore, further studies are necessary to evaluate the efficacy of MSC transplantation for psoriasis.

The aim of this study was to investigate the efficacy of mouse ASC transplantation for psoriasis-like dermatitis, and to elucidate its effects on the IL23/Th17 axis and other pathways, including IL-36 and antimicrobial peptide using IMQ-model mice. Treatment with anti-IL-23p19 Abs was used to compare the efficacy of ASC transplantation.

MATERIALS AND METHODS

Animals

Male 6–7-week-old C57BL/6J mice were purchased from Japan SLC, Inc. (Shizuoka, Japan) and maintained at three mice per cage under specific pathogen-free conditions. The mice were randomly assigned to cages by facility staff unrelated to our experiments and acclimated for at least 1 week before starting experiments. This study was approved by the Hiroshima University Animal Ethics Committee (Approval No. A22-181) and Animal Research Committee of Shimane University (Approval No. IZ2-84), and conducted according to guidelines for animal experiments set by the Hiroshima University Animal Experiment Facility Committee and the Regulations for Animal Experimentation at Shimane University.

Preparation of ASCs

Primary mouse ASCs were obtained from 8- to 9-week-old C57BL/6J mice according to a previous report with a slight modification.²¹⁾ Briefly, inguinal white adipose tissue (iWAT) was collected under sterile conditions, and blood vessels and lymph nodes were removed. Then, the adipose tissue was minced and dissociated in phosphate-buffered saline (PBS) with 0.1% type I collagenase, 1% bovine serum albumin (BSA), and 2 mM CaCl₂ for 30 min at 37 °C. To obtain the stromal vascular fraction (SVF), the mixture was passed through a 100-μm cell strainer and centrifuged at 500 × g for 5 min. Pellets of SVF were washed with PBS and erythrocytes were lysed. SVF was resuspended in KBM ADSC-1 medium (Kohjin Bio Co., Ltd., Saitama, Japan) containing penicillin/streptomycin, and passed through a 70-μm cell strainer. SVF collected from approximately 1000 mg of iWAT was seeded into one T25 flask and cultured for 24 h at 37 °C under 5% CO₂. After discarding medium containing non-adherent cells and residues, fresh medium was added. When cells reached approximately 80% confluence, they were detached using TrypLE™ Express Enzyme (Thermo Fisher Scientific K.K., Tokyo, Japan) and passaged into new T75 flasks at approximately 15,000 cells/cm². After one further passage, the cell population (passage #2) was used for downstream experiments (Fig. 1A). This experiment was independently performed six times with 5–10 mice in each experiment (49 mice in total). To obtain sufficient numbers (≥6.0 × 10⁶) of ASCs for transplantation into three IMQ-model mice, iWAT from 9–10 mice were used.

Fig. 1. Characteristics of ASCs Obtained from Mouse iWAT

(A) Scheme of ASC collection from iWAT. (B) Multipotency of ASCs (Scale bar, 100 μm). ASC: adipose-derived mesenchymal stromal/stem cell; DAPI: 4′,6-diamidino-2-phenylindole; FABP4: fatty acid-binding protein 4; iWAT: inguinal white adipose tissue; SVF: stromal vascular fraction.

Characterization of ASCs

The cell population from iWAT was characterized by its differentiation potential and expression rates of cell surface antigens. The differentiation potential was confirmed using a Mouse Mesenchymal Stem Cell Functional Identification Kit (R&D Systems, Inc., Minneapolis, MN, U.S.A.) according to the manufacturer’s instructions. After incubation with each primary Ab [goat anti-mouse fatty acid-binding protein 4 (FABP4) Ab, goat anti-mouse osteopontin Ab, and sheep anti-mouse collagen II Ab], each differentiated cell was detected using donkey anti-goat immunoglobulin G (IgG) H&L (Alexa Fluor^® 488) (Abcam, Cambridge, U.K.) or donkey anti-sheep IgG H&L (Alexa Fluor^® 488) (Abcam). After nuclear counterstaining with 4′,6-diamidino-2-phenylindole (DAPI), cells were observed using a BZ-8000 microscope (Keyence, Osaka, Japan).

To determine the expression rates of cell surface antigens, cells were aliquoted at 1 × 10⁵ cells. After blocking IgG Fc receptors with TruStain FcX™ PLUS (anti-mouse CD16/32) Antibody (BioLegend, San Diego, CA, U.S.A.), the cells were stained with phycoerythrin (PE)-conjugated anti-mouse CD73 Ab, PE-conjugated anti-mouse CD105 Ab, PE-conjugated anti-mouse CD90.2 Ab, PE-conjugated anti-mouse Ly-6A/E (Sca-1) Ab, allophycocyanin (APC)-conjugated anti-mouse CD45 Ab, and APC-conjugated anti-mouse CD117 (c-kit) Ab. All Abs were purchased from BioLegend. Detection was performed using Guava^® easyCyte™ 8 (Luminex Japan Co., Ltd., Tokyo, Japan).

Induction of Dermatitis by IMQ in Mice

Two days before the first IMQ application, 8- to 9-week-old mice were anesthetized with isoflurane, and their dorsal hair was shaved with an electric shaver. A daily dose of 63–65 mg of 5% IMQ cream (Beselna cream 5%, Mochida Pharmaceutical Co., Ltd., Tokyo, Japan) was applied topically to the shaved back skin (2 × 3 cm²) for 5 consecutive days (Fig. 2A). In the sham control group, mice received 63–65 mg of hydrophilic cream (Maruishi Pharmaceutical Co., Ltd., Osaka, Japan). Mice were sacrificed 24 h after the final IMQ application and tissue samples were collected for analysis. To evaluate the effects of ASC transplantation, 200 μL PBS containing 2 × 10⁶ ASCs was subcutaneously injected into the shaved back skin 1 d before the first IMQ application (Fig. 2A). The dosage of ASCs was determined according to a previous report.³⁾ In addition, 100 μg of anti-IL-23p19 Abs (Ultra-LEAF™ Purified anti-mouse IL-23(p19) Antibody, BioLegend) was injected intraperitoneally at the same time as ASC transplantation (Fig. 2A). As a negative control of ASC transplantation or anti-IL-23p19 Ab treatment, 200 μL of PBS alone or PBS containing 100 μg of isotype control Abs (Ultra-LEAF™ Purified Mouse IgG2b, κ, Isotype Ctrl Antibody, BioLegend) was injected by the same route. This experiment was independently performed six times with three mice in each group (54 mice in total).

Fig. 2. Efficacy of Anti-IL-23p19 Ab and ASC Treatment on IMQ-Induced Dermatitis

(A) Experimental schedule. This experiment was independently performed three times with three mice in each group (54 mice in total). (B) Representative image of dorsal skin. Objective scores are expressed as the mean ± standard error of the mean. Ab: antibody; IMQ: imiquimod; PBS: phosphate-buffered saline. ^*p < 0.05.

Objective Scoring of IMQ-Induced Dermatitis in Mice

The severity of IMQ-induced dermatitis was evaluated as shown in Table 1 according to a previous report with a slight modification.³⁹⁾ Erythema, thickness, and scaling of the dorsal skin were scored independently by three blinded observers.

Table 1. Objective Scoring System for Evaluation of the Severity of IMQ-Induced Dermatitis

Parameter	Score
Erythema	0	Normal skin
	1	Blood capillary appear or slight erythema
	2	Scattered erythema
	3	Erythema appear on whole dorsal skin
	4	Dense erythema
Thickness	0	Normal skin
	1	Keratoplasia appear
	2	Keratoplasia appear on half of dorsal skin
	3	Thickness appear on whole dorsal skin
	4	Skin lesions sclerosis
Scales	0	Normal skin
	1	Scales appear
	2	Scales appear on half of dorsal skin
	3	Scales appear on whole dorsal skin
	4	Dense desquamation

Histochemical Analysis

The dorsal skin tissues were immersed in phosphate buffer solution containing 4% paraformaldehyde for 2 or 24 h to prepare frozen or paraffin-embedded tissue samples, respectively. Paraffin-embedded skin was sectioned at 5 μm and stained with hematoxylin and eosin to measure the epidermal thickness. To evaluate neutrophil infiltration in IMQ-applied skin, 10-μm sectioned frozen tissue samples were incubated with Blocking One Histo (Nacalai Tesque, Kyoto, Japan) for 10 min. After washing with Tris-buffered saline containing 0.1% Tween^® 20 (TBST), sections were incubated with 10 μg/mL Ly-6G/Ly-6C monoclonal Ab (clone: RB6-8C5, Thermo Fisher Scientific K.K.) for 1 h. After washing with TBST, sections were incubated with 10 μg/mL goat anti-rat IgG H&L (Alexa Fluor^® 555) (Abcam) for 1 h, and then nuclei were counterstained with DAPI. The high-power fields (HPF) of Ly-6G/Ly-6C (Gr-1)-positive areas were taken using a BZ-8000 microscope. Six HPF per mouse were used to evaluate neutrophil infiltration.

Quantitative RT-PCR (RT-qPCR)

Total RNA was extracted from the dorsal skin samples using an RNeasy Fibrous Tissue Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. Reverse transcription was performed using a PrimeScript RT Reagent Kit (Perfect Real Time) (TaKaRa Bio Inc., Shiga, Japan) and iCycler (Bio-Rad Laboratories, Inc., Hercules, CA, U.S.A.) using 1.0 μg of total RNA. Real-time PCR was performed using THUNDERBIRD^® SYBR™ qPCR Mix (Toyobo Co., Ltd., Osaka, Japan) and Thermo Scientific PikoReal Real-Time PCR System and CFX Opus Real-Time PCR System (Bio-Rad Laboratories, Inc). The primers listed in Table 2 were purchased from TaKaRa Bio Inc. or Eurofins Genomics K.K. (Tokyo, Japan). The expression levels of each gene were normalized against Gapdh expression levels. A standard curve was prepared using serial dilutions of control samples and plotted against the number of cycles obtained in the log-linear phase of the reaction. The relative mRNA expression levels of Il1f6, Il1rl2, and Nlrp3 were determined using the 2^−ΔΔCt method while the expression levels of the other genes were determined using standard curve method. The data are presented as fold changes relative to the Isotype Ab group or IMQ control group.

Table 2. List of Primers Used in Gene Expression Analysis

Gene	Primer sequence	Annealing & extension temperature/time
Gapdh	(F) TGTGTCCGTCGTGGATCTGA	60°C/30 s
	(R) TTGCTGTTGAAGTCGCAGGAG
Il17a	(F) CTGATCAGGACGCGCAAAC	65°C/30 s
	(R) TCGCTGCTGCCTTCACTGTA
Il17f	(F) GAGGATAACACTGTGAGAGTTGAC	62.5°C/60 s
	(R) GAGTTCATGGTGCTGTCTTCC
Il22	(F) TCCAGCAGCCATACATCGTCA	60°C/30 s
	(R) GAGCCGGACATCTGTGTTGTTATC
Il23	(F) ACATGCACCAGCGGGACATA	65°C/30 s
	(R) CTTTGAAGATGTCACAGTCAAGCAG
S100a7	(F) TGAAGGGTCCATCAGTCA	62.5°C/60 s
	(R) CTAGTAGAGGCTGTGCT
Lipocalin-2	(F) CCAGTTCGCCATGGTATTTTTC	65°C/30 s
	(R) CACACTCACCACCCATTCAGTT
Il1f6	(F) CTACAGCTTGGGGAAGGGAACATA	60°C/30 s
	(R) CCCTTTAGAGCAGACAGCGATGAA
Il1f9	(F) TCCTGACTTTGGGGAGGTTTT	60°C/30 s
	(R) TCACGCTGACTGGGGTTACT
Il1rl2	(F) AAACACCTAGCAAAAGCCCAG	60°C/30 s
	(R) AGACTGCCCGATTTTCCTATG
Tnfα	(F) ACTCCAGGCGGTGCCTATGT	60°C/30 s
	(R) GTGAGGGTCTGGGCCATAGAA
Il1b	(F) TCCAGGATGAGGACATGAGCAC	60°C/30 s
	(R) GAACGTCACACACCAGCAGGTTA
Il6	(F) ACTCCAGGCGGTGCCTATGT	60°C/30 s
	(R) GTGAGGGTCTGGGCCATAGAA
Cxcl5	(F) GTTCCATCTCGCCATTCATG	65°C/30 s
	(R) GCGGCTATGACTGAGGAAGG
Nlrp3	(F) TCCCAGACACTCATGTTGCC	60°C/30 s
	(R) GTCCAGTTCAGTGAGGCTCC

Gapdh: glyceraldehyde-3-phosphate dehydrogenase; Il: interleukin; Tnfα: tumor necrosis factor alpha; Cxcl5: C-X-C motif chemokine 5; Nlrp3: NLR family, pyrin domain containing 3.

Enzyme-Linked Immunosorbent Assay (ELISA)

The whole mouse blood was collected using a heparinized syringe by cardiac puncture and then centrifuged at 2000 × g for 20 min at 4 °C. Plasma IL-17 levels were determined using a Mouse IL-17 Quantikine ELISA Kit (R&D Systems) according to the manufacturer’s instructions.

Western Blotting

The dorsal skin samples were immediately immersed in liquid nitrogen after harvest and stored at −80 °C until protein extraction. Skin proteins were extracted using the Nuclear Extract Kit (Active Motif Japan, Tokyo Japan), in accordance with the manufacturer’s protocol for whole cell extract from tissue. The concentration of the extracted protein was determined using the Bio-Rad Protein Assay Kit, based on Bradford assay. Skin proteins (30 μg for detection of nuclear factor-kappaB (NF-κB) p65 and phospho-NF-κB p65, and 3 μg for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and NLR family, pyrin domain containing 3 (NLRP3)) were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) using a 10% poly-acrylamide gel and transferred electrophoretically onto an Immobilon^®-P membrane (Merck Millipore, Burlington, MA, U.S.A.). After blocking with TBST containing 0.6% polyvinylpyrrolidone (PVP40, Sigma-Aldrich, St. Louis, MO, U.S.A.), the membrane was washed with TBST. The membrane was then incubated with anti-GAPDH polyclonal Ab (PA1-987, 1 : 1000, Thermo Fisher Scientific K.K.), anti-NF-κB p65 polyclonal Ab (14-6734-81, 1 : 1000, Thermo Fisher Scientific K.K.), or anti-NLRP3 polyclonal Ab (PA5-88709, 1 : 1000, Thermo Fisher Scientific K.K.) for 2 h at 37 °C. To detect phospho-NF-κB p65, the membrane was incubated overnight with anti-phospho-NFκB p65 (Ser536) (clone: 93H1) mAb (3033, 1 : 1000, Cell Signaling Technology Japan, K.K. Tokyo, Japan) diluted with 5% (w/v) BSA in TBST at 4 °C. After washing with TBST, the membrane was incubated with HRP-conjugated donkey anti-rabbit IgG H&L (ab7083, 1 : 5,000, Abcam) for 1 h at room temperature. Except for the anti-phospho-NF-κB p65 mAb, each primary and secondary Ab was diluted with Can Get Signal Immunoreaction Enhancer Solution 1 and 2 (Toyobo), respectively. The target proteins were detected using the Amersham ECL-Prime Kit (Cytiva, Tokyo, Japan) and FUSION SOLO 7S EDGE (Vilber, Collégien, France). The signal intensities of the bands were determined using ImageJ software and the macro “_BandPeakQuantification.ijm.”⁴⁰⁾ The data are presented as changes relative to the Isotype Ab group or IMQ control group.

Evaluation of Size and Neutrophil Rate in the Spleen

Mouse spleens were weighed and their long and short axes were measured. Then, splenocytes were dispersed in PBS containing 0.5% BSA using a 70-μm cell strainer. After lysing erythrocytes and blocking IgG Fc receptors, the samples were incubated with APC-conjugated anti-mouse CD45 Ab, PE-conjugated anti-mouse Ly-6G Ab (clone: 1A8), and Peridinin chlorophyll protein (PerCP)/Cyanine5.5-conjugated anti-mouse CD11b Ab. The rates of CD45 positive myeloid cells (CD45+ cell) and neutrophils (CD45+, CD11b+, Ly-6G+ cell) were analyzed using Guava^® easyCyte™ 8.

Statistical Analysis

Statistical analyses were performed using RStudio (version 2021.09.1 + 372, Posit, Boston, MA, U.S.A.). The data outside of the first quartile −1.5× interquartile range (IQR) and the third quartile +1.5× IQR were excluded from the statistical analysis as outliers, and are presented as means ± standard error or the median and IQR as appropriate. Differences between three groups with the same administration route (i.p. or s.c.) were analyzed using Tukey’s honestly significant difference test or the Steel–Dwass test. If data could not be obtained from sham control groups, the results in IMQ-treated groups were compared using the Wilcoxon rank sum test. p-Values <0.05 were considered statistically significant.

RESULTS

Characteristics of ASCs from Mouse iWAT

The scheme of ASCs collection from mouse iWAT is shown in Fig. 1A. To confirm multipotency in our cell population, the collected cell population was cultured using a differentiation medium kit. FABP4-positive adipocytes, osteopontin-positive osteoblasts, and collagen II-positive chondroblasts were observed at 14, 21, and 22 d after induction, respectively (Fig. 1B). These results indicate that the cell population had differentiation potential in vitro, and met the requirement for mesenchymal stromal cell multipotency.⁴¹⁾

Next, we determined the expression rates of cell surface antigens in our cell population. The International Society for Cell & Gene Therapy Mesenchymal Stromal Cell committee defines a cell population with ≥95% expression rate of CD73, CD105, and CD90 and ≤2% of CD45, CD34, CD14 or CD11b, CD79α or CD19, and HLA class II as human MSCs, but the expression rates for mouse MSCs have not been defined.⁴²⁾ In this study, Sca-1 and c-kit were further determined as positive and negative markers for mouse MSCs, respectively.^7,43) Of the six ASC populations collected, ≥95% of the cells expressed CD90.2 and Sca-1, whereas CD45 and c-kit were barely expressed (Table 3). We did not obtain positive rates for CD73 (6.99 ± 1.04%) or CD105 (42.14 ± 2.43%). In our preliminary study, the expressions of CD73 and CD105 in mouse MSCs derived from subcutaneous fat (MSA11C, Cosmo Bio Co., Ltd., Tokyo, Japan) were also negative (0.20 and 35.12%, respectively), consistent with our cell population. In addition, our cell population adhered to plastic culture flasks. Based on these results, we defined our cell population as ASCs.

Table 3. Expression of Cell Surface Antigens in ASCs

Antigens	CD73	CD105	CD90.2	Sca-1	CD45	c-kit
Positive % (mean ± S.E.)	6.99 ± 1.04	42.14 ± 2.43	99.24 ± 0.50	98.26 ± 1.03	0.22 ± 0.07	0.44 ± 0.23

The values are expressed as the mean ± standard error of the mean (S.E.) calculated from six individual experiments.

Efficacy of Treatment with Anti-IL-23p19 Abs and ASCs on Histological Changes

The experimental scheme is shown in Fig. 2A. In the IMQ-model, the body weight decreased transiently from day 2 to 4, and splenomegaly was observed on day 6 (Supplementary Fig. 1), indicating that IMQ induced systemic inflammatory responses.³⁵⁾ Treatment with anti-IL-23p19 Abs and ASCs did not affect these changes. Regarding skin manifestations in the IMQ-model, erythema and thickness were observed in the dorsal skin on day 3, which worsened until day 5, and scaling was observed after day 4 (Fig. 2B). Treatment with anti-IL-23p19 Abs slightly reduced the thickness score whereas ASC transplantation significantly suppressed the increased thickness scores on days 5 and 6 (Fig. 2B). However, neither anti-IL-23p19 Ab nor ASC treatments had any effect on erythema and scaling.

Histological analysis showed that the epidermal thickness was increased by IMQ cream and not suppressed by anti-IL-23p19 Ab (Fig. 3A). Consistent with the appearance of the dorsal skin, ASC transplantation tended to suppress the increase in epidermal thickness [IMQ control, 89.18 μm (74.02–92.24); ASC, 72.47 μm (70.40–76.66)]. To evaluate the effects of the treatments on neutrophil infiltration, frozen sections of IMQ-applied skin were stained with anti-Gr-1 Ab (Fig. 3B). The Gr-1-positive area per tissue area was defined as the infiltration grade. Few Gr-1-positive cells were detected in the skin from the sham control groups, whereas many of these cells were detected near the superficial dermis in IMQ-applied skin (Isotype Ab group and IMQ control group). The neutrophil infiltration grade was significantly suppressed by anti-IL-23p19 Ab administration and ASCs transplantation. IMQ-application also increased the rate of neutrophils in the spleen, while neither treatment affected the increased neutrophil rate (Fig. 3C).

Fig. 3. Histological Analysis of the Dorsal Skin and Changes of Neutrophil Rates in the Skin and Spleen

(A) Representative hematoxylin and eosin stained specimen from dorsal skin (day 6; Scale bar, 50 μm). (B) Immunohistochemical staining for mouse neutrophils (Gr-1, red) and nuclei (blue). Scale bar, 100 μm. (C) Rate of CD45+ cells (left panel) and neutrophils (CD45+, CD11b+, Ly-6G+ cells, right panel) in the spleen. The data were pooled from three independent experiments and expressed as follows: [(rate of target cells in the each group)/(rate of target cells in the Isotype Ab or IMQ control group)]. Each data is expressed as the median and interquartile range. DAPI: 4′,6-diamidino-2-phenylindole; ^*p < 0.05, ^**p < 0.01.

Efficacy of the Treatments on the Expression of Inflammatory Mediators

RT-qPCR was performed to evaluate the effects of the treatment with anti-IL-23p19 Abs and ASCs on the expression of inflammatory mediators in IMQ-model mice. Expressions of the IL-23/Th17 axis cytokines (Il17a, Il17f, Il22, and Il23) mRNAs were barely detectable in the dorsal skin of the sham groups (Fig. 4). IMQ cream induced the expression of these genes and anti-IL-23p19 Abs significantly suppressed the expression of these genes except for Il23 mRNA. In contrast, ASC transplantation suppressed the IMQ-induced activation of the IL-23/Th17 axis, including the mRNA expression of Il23. The inflammatory cytokines Tnfa and Il6, chemokine Cxcl5, and antimicrobial peptides S100a7 and Lipocalin-2 were also induced by IMQ application. Anti-IL-23p19 Abs significantly suppressed S100a7 mRNA expression but did not affect the other mRNA expressions. In contrast, ASCs significantly suppressed the expression of all of these inflammatory cytokines, chemokine, and antimicrobial peptides. Among the genes of IL-1 family cytokines, the expression of Il1b mRNA tended to be suppressed by anti-IL-23p19 Abs treatment (isotype Ab vs. anti-IL-23p19 Ab, p = 0.101) and was significantly suppressed by ASC transplantation. In contrast, neither treatment affected the mRNA expression of Il1f6 and Il1f9, which encode IL-36α and IL-36γ, respectively. The mRNA expression of Il1rl2, which encodes the IL-36 receptor, did not increase in IMQ-applied skin on day 6. Expression of an inflammasome marker Nlrp3 mRNA increased in IMQ-applied skin. Treatment with anti-IL-23p19 Ab or ASCs did not suppress the mRNA expression of Nlrp3, but its expression level was not significantly different from that of the sham control groups.

Fig. 4. Gene Expression Analysis

mRNA was extracted from the dorsal skin harvested at day 6. Data are expressed as the median and interquartile range. BLQ: below the lower limit of quantification; ND: not detected. ^*p < 0.05, ^**p < 0.01.

We further evaluate the effects of these treatments on the expression of inflammatory mediators at protein level. The plasma levels of IL-17 in the sham groups could not be quantified using the ELISA kit (Fig. 5A). IMQ cream increased plasma IL-17 levels, and anti-IL-23p19 Ab and ASCs significantly suppressed this increase. Additionally, the expression level of NLRP3 protein and activation of NF-κB signal in skin were evaluated by Western blot analysis. The level of NLRP3 was significantly increased by the application of IMQ cream, indicating that the inflammasome was induced (Fig. 5B). The anti-IL-23p19 Ab treatment did not suppress NLRP3 protein expression, whereas ASC transplantation tended to suppress it (IMQ control vs. ASC, p = 0.173). We could not detect any changes in the phospho-NF-κB/NF-κB ratio, which is involved in inflammatory responses, including IL-36 signaling, 24 h after the final IMQ application.

Fig. 5. Evaluation of IL-17 Level in Plasma and NLRP3 Protein and NF-κB Activation in Dorsal Skin

(A) Plasma IL-17 level were measured by ELISA (day 6). (B) Proteins extracted from the dorsal skin were separated and detected by Western blot analysis. The density of each band was analyzed using ImageJ software. Data are expressed as the median and interquartile range. BLQ: below the lower limit of quantification. ^*p < 0.05, ^**p < 0.01.

DISCUSSION

In this study, we collected ASCs from mouse iWAT and determined their differentiation potential and expression rate of cell surface antigens. ASC transplantation suppressed epidermal thickening, the expressions of IL-23/Th17 axis cytokines, antimicrobial peptides, and inflammatory cytokines, as well as neutrophil infiltration in IMQ-applied mouse skin. These factors were reported to induce and exacerbate psoriasis in humans.^1,25,44) In contrast, ASC transplantation as well as anti-IL-23p19 Ab treatment had no effect on IMQ-induced erythema, scales, or Il1f6 and Il1f9 mRNA expression in dorsal skin and splenomegaly.

IMQ, a toll-like receptor (TLR) 7/8 ligand that activates macrophages and plasmacytoid dendritic cells via TLR7, induces cytokine expression, including type I IFN and subsequent IL-23.^25,45) In this study, we used C57BL/6J mice to establish an IMQ-induced dermatitis model because the response to IMQ application in this strain showed the most similar expression pattern to the pathogenesis of human psoriasis, including the mRNA expression of IL-17 family cytokines and IL-36 among the seven strains.²⁸⁾ In previous studies, the depletion of Langerhans cells⁴⁴⁾ and IL-17 receptor A⁴⁶⁾ reduced epidermal thickening induced by IMQ application. However, IMQ cream also induced epidermal thickening and neutrophil infiltration, even in TLR7-knockout mice.⁴⁷⁾ Isostearic acid contained in the base of IMQ cream induced more severe skin erythema than IMQ dissolved in dimethyl sulfoxide.⁴⁸⁾ Isostearic acid also caused NLRP3 inflammasome activation and caspase-1-dependent pyroptosis in keratinocytes.^47,48) These reports suggest that cross-talk between immune cells and keratinocytes via the TLR7/IL-23/Th17 axis, as well as isostearic acid-induced inflammasome activation, should be considered when evaluating the efficacy of ASC transplantation using the IMQ-model.

The anti-IL-23p19 Ab treatment could not improve the objective scores and epidermal thickening (Fig. 2B). We used the same anti-IL-23p19 Ab (clone: MMp19B2) that was used in a previous study by Shimizu et al.⁴⁹⁾ In their study, the cumulative objective score of IMQ-model mice was significantly reduced by intraperitoneal injection of this Ab at a dose of 100 μg three times every other day. In our preliminary study, we also injected 100 μg of the anti-IL-23p19 Ab into our IMQ-model mice at days 0, 2, and 4. However, treatment with anti-IL-23p19 Ab could only slightly suppress the epidermal thickening [65.02 μm (61.55–80.66) n = 3] although this Ab could completely suppress the plasma IL-17 levels. Additionally, Li et al. reported that anti-IL-17A Abs (10 mg/kg, 3 times/week) had no effect on 62.5 mg IMQ-induced dermatitis.⁵⁰⁾ This report suggests that skin damage in this model is not solely mediated by the IL-17A pathway. These results also suggest that inflammatory responses outside the IL-23/Th17 axis may play a dominant role in our model which was applied with 63–65 mg of IMQ cream.

In our study, ASC transplantation suppressed Il1b mRNA expression; therefore, other cytokines may cause erythema in our model. IL-36 has been reported to have a dominant role in generalized pustular psoriasis. Additionally, serum IL-36γ levels have been reported to correlate with disease severity in patients with psoriasis vulgaris.^38,51) Secreted pro-IL-36 is activated by neutrophil-secreted proteases such as neutrophil elastase and cathepsin G, or by neutrophil extracellular traps (NETs) containing those proteases.^38,52) Activated IL-36 then induces the expressions of IL-36 and neutrophil chemokine in keratinocytes, forming an IL-36/chemokine/neutrophil axis.^38,52,53) Activated IL-36 also causes activation of the P2X purinoceptor 7–NLRP3–caspase-1 axis, forming an IL-36 amplified inflammatory loop.^54,55) Previous reports have shown that anti-IL-36 receptor Abs or knockdown of IL-36 receptor with shRNA successfully alleviated IMQ-induced dermatitis.^56–58) In these studies, inhibition of IL-36 receptor led to suppress the expression of several inflammatory cytokines and chemokines, neutrophil infiltration, and NETs formation.^56–58) In our study, IL-36α and IL-36γ were highly expressed in IMQ-applied skin and was not suppressed by anti-IL-23p19 Ab treatment or ASC transplantation (Fig. 4). However, ASC transplantation could suppress IL-36-induced inflammatory responses, including neutrophil infiltration, NLRP3 protein expression, and the mRNA expression of Tnfa, Il1b, Il6, and Cxcl5 (Figs. 3B, 4, 5B). These responses might be partly suppressed through mechanisms outside of the IL-36 signal itself, such as the IL-23/Th17 pathway because anti-IL-17A Abs have been reported to suppress mRNA expression of Il1b and Il6 in a model with 42 mg/d of IMQ-cream application.⁵⁰⁾ Previous studies have shown that MSCs suppressed NETs formation by releasing extracellular superoxide dismutase in response to neutrophil ROS⁵⁹⁾ and modulated neutrophil apoptosis via MSC-extracellular vesicles.⁶⁰⁾ Therefore, ASC transplantation potentially suppressed the IMQ-induced IL-23/Th17 axis and neutrophil infiltration, but did not disrupt the IL-36/chemokine/neutrophil axis and NLRP3 inflammasome/IL-36 amplified inflammatory loop in our study.

Previous studies reported that MSCs suppressed IMQ-induced dermatitis by suppressing dendritic cell maturation,^31,36) inhibiting Th17 cell differentiation, inducing Treg cell differentiation,^30,31,35) decreasing IL-17+ γδT cells in draining lymph nodes,³⁾ and suppressing neutrophil activation.³⁴⁾ Furthermore, exosomes derived from umbilical cord MSCs and TNF stimulating gene 6 (TSG-6) secreted by MSCs primed with IFN-γ and TNF-α (MSCs-IT) were reported to successfully treat dermatitis in IMQ-model mice.^2,36) In contrast, Ding et al. reported that non-primed human umbilical cord MSCs could not suppress the epidermal thickening and neutrophil infiltration in skin.²⁾ In our study, reduction of epidermal thickening (approximately 20% reduction) by ASC transplantation was weaker than in previous studies (approximately 20–60% reduction).^{2,3,29–31,33)} The mechanisms of IMQ-induced splenomegaly are not understood, but several studies have shown that multiple injections of MSCs or primed MSCs suppressed splenomegaly.^{2,29,30,33,35)} Our ASC transplantation slightly suppressed the increase in neutrophil rate in the spleen, but did not suppress IMQ-induced splenomegaly, a systemic inflammatory response.³⁵⁾ Therefore, the anti-inflammatory and immunomodulatory effects of our non-primed ASCs were insufficient to treat IMQ-induced dermatitis on C57BL/6J mice. To enhance the efficacy of ASC treatment in the IMQ-model, culture conditions should be optimized to suppress activation of the IL-23/Th17 axis, neutrophils, and keratinocytes. For example, TSG-6 secreted by MSCs-IT suppressed neutrophil-related inflammatory disease.²⁾ However, ASCs derived from patients with obesity or type 2 diabetes have reduced mitochondrial functions and anti-oxidative stress capacity.^21–23) To provide robust MSC transplantation for psoriatic patients, it is necessary to determine appropriate culture conditions for priming MSCs derived from any donors and indicators of MSC function related to breaking the IL-23/Th17 axis and IL-36/chemokine/neutrophil axis.

There are several limitations to this study. First, the contribution of IL-36α and IL-36γ to the pathogenesis of our IMQ model could not be evaluated. Second, cytokine expression was assessed only 24 h after the final IMQ application, at which point NF-κB was not activated. Third, the expression of neutrophil-derived proteases involved in the activation of IL-36 was not evaluated. As a result, while the mRNA expression of IL-36α and IL-36γ was significantly increased by IMQ cream, their activation profiles were not validated.

To establish effective MSC transplantation for psoriasis, several drawbacks should be overcome, including the high cost and long time required for cell preparation. Recently, new methods have been developed to separate MSCs from contaminant cells using thermoresponsive polymers.^61,62) These methods have the potential to reduce the time of MSC culture and increase their efficacy by avoiding cell damage caused by cell-dissociating enzymes to remove contaminant cells.

In conclusion, ASCs derived from mouse iWAT partially ameliorated IMQ-induced dermatitis by suppressing the IL-23/Th17 axis and neutrophil infiltration, similar to that achieved using anti-IL-23p19 Abs. Inflammasomes in keratinocytes may also be activated by IMQ cream, and this might contribute to the IL-36/chemokine/neutrophil axis and amplified inflammatory loop. Although our ASC treatment had a suppressive effect on inflammatory cytokines and chemokines beyond the IL-23/Th17 axis, it did not suppress IL-36 expression. To develop a more effective treatment for psoriasis using MSCs, optimal culture conditions for the priming of MSCs to suppress activation of the IL-23/Th17 axis, IL-36/chemokine/neutrophil axis are needed.

Acknowledgments

The authors thank Yuko Ozaki, Yuna Nagai, and Aoi Terakawa for technical assistance. The work was conducted with the facilities in the Radiation Research Center for Frontier Science, Research Institute for Radiation Biology and Medicine, Hiroshima University (host researcher: Keiji Tanimoto), the Natural Science Center for Basic Research and Development (N-BARD) at Hiroshima University, and Central Laboratory of School of Dentistry at Hiroshima University. This research was funded by JSPS KAKENHI, Grant Nos.: JP20K17318 and JP24K11474.

Conflict of Interest

The authors declare no conflict of interest.

Supplementary Materials

This article contains supplementary materials.

REFERENCES

• 1)  Griffiths CEM, Armstrong AW, Gudjonsson JE, Barker JNWN. Psoriasis. Lancet, 397, 1301–1315 (2021).
• 2)  Ding Y, Gong P, Jiang J, Feng C, Li Y, Su X, Bai X, Xu C, Liu C, Yang J, Fang J, Ji X, Chen Y, Li P, Guo L, Shao C, Shi Y. Mesenchymal stem/stromal cells primed by inflammatory cytokines alleviate psoriasis-like inflammation via the TSG-6-neutrophil axis. Cell Death Dis., 13, 996 (2022).
• 3)  Chen Y, Hu Y, Zhou X, Zhao Z, Yu Q, Chen Z, Wang Y, Xu P, Yu Z, Guo C, Zhang X, Shi Y. Human umbilical cord-derived mesenchymal stem cells ameliorate psoriasis-like dermatitis by suppressing IL-17-producing γδ T cells. Cell Tissue Res., 388, 549–563 (2022).
• 4)  Saeki H, Mabuchi T, Asahina A, Abe M, Igarashi A, Imafuku S, Okubo Y, Komine M, Sano S, Torii H, Morita A, Yotsuyanagi H, Watanabe A, Ohtsuki M. English version of Japanese guidance for use of biologics for psoriasis (the 2022 version). J. Dermatol., 50, e41–e68 (2023).
• 5)  Ghoreschi K, Balato A, Enerbäck C, Sabat R. Therapeutics targeting the IL-23 and IL-17 pathway in psoriasis. Lancet, 397, 754–766 (2021).
• 6)  Masson Regnault M, Shourick J, Jendoubi F, Tauber M, Paul C. Time to relapse after discontinuing systemic treatment for psoriasis: a systematic review. Am. J. Clin. Dermatol., 23, 433–447 (2022).
• 7)  Ogino R, Hayashida K, Yamakawa S, Morita E. Adipose-derived stem cells promote intussusceptive lymphangiogenesis by restricting dermal fibrosis in irradiated tissue of mice. Int. J. Mol. Sci., 21, 3885 (2020).
• 8)  Ogino R, Yokooji T, Hayashida M, Suda S, Yamakawa S, Hayashida K. Emerging anti-inflammatory pharmacotherapy and cell-based therapy for lymphedema. Int. J. Mol. Sci., 23, 7614 (2022).
• 9)  Lightner AL, Irving PM, Lord GM, Betancourt A. Stem cells and stem cell-derived factors for the treatment of inflammatory bowel disease with a particular focus on perianal fistulizing disease: a minireview on future perspectives. BioDrugs, 38, 527–539 (2024).
• 10)  Wang LT, Liu KJ, Sytwu HK, Yen ML, Yen BL. Advances in mesenchymal stem cell therapy for immune and inflammatory diseases: Use of cell-free products and human pluripotent stem cell-derived mesenchymal stem cells. Stem Cells Transl. Med., 10, 1288–1303 (2021).
• 11)  Liu H, Li R, Liu T, Yang L, Yin G, Xie Q. Immunomodulatory effects of mesenchymal stem cells and mesenchymal stem cell-derived extracellular vesicles in rheumatoid arthritis. Front. Immunol., 11, 1912 (2020).
• 12)  De Jesus MM, Santiago JS, Trinidad CV, See ME, Semon KR, Fernandez MO Jr, Chung FS. Autologous adipose-derived mesenchymal stromal cells for the treatment of psoriasis vulgaris and psoriatic arthritis: a case report. Cell Transplant., 25, 2063–2069 (2016).
• 13)  Chen H, Niu JW, Ning HM, Pan X, Li XB, Li Y, Wang DH, Hu LD, Sheng HX, Xu M, Zhang L, Zhang B. Treatment of psoriasis with mesenchymal stem cells. Am. J. Med., 129, e13–e14 (2016).
• 14)  Comella K, Parlo M, Daly R, Dominessy K. First-in-man intravenous implantation of stromal vascular fraction in psoriasis: a case study. Int. Med. Case Rep. J., 11, 59–64 (2018).
• 15)  Seetharaman R, Mahmood A, Kshatriya P, Patel D, Srivastava A. Mesenchymal stem cell conditioned media ameliorate psoriasis vulgaris: a case study. Case Rep. Dermatol. Med., 2019, 8309103 (2019).
• 16)  Yao D, Ye S, He Z, Huang Y, Deng J, Wen Z, Chen X, Li H, Han Q, Deng H, Zhao RC, Lu C. Adipose-derived mesenchymal stem cells (AD-MSCs) in the treatment for psoriasis: results of a single-arm pilot trial. Ann. Transl. Med., 9, 1653 (2021).
• 17)  Cheng L, Wang S, Peng C, et al. Human umbilical cord mesenchymal stem cells for psoriasis: a phase 1/2a, single-arm study. Signal Transduct. Target. Ther., 7, 263 (2022).
• 18)  Tang L, Yao D, He Z, Ye S, Chen X, Huang Y, Han Q, Zeng X, Zheng X, Liu T, Wang Z, Zhao RC, Zheng G, Lu C. Distinct adaptive immune receptor feature of adipose-derived mesenchymal stem cells (AD-MSCs) treatment of psoriasis. Arch. Dermatol. Res., 316, 542 (2024).
• 19)  Dairov A, Sekenova A, Alimbek S, Nurkina A, Shakhatbayev M, Kumasheva V, Kuanysh S, Adish Z, Issabekova A, Ogay V. Psoriasis: the versatility of mesenchymal stem cell and exosome therapies. Biomolecules, 14, 1351 (2024).
• 20)  Thompson M, Mei SHJ, Wolfe D, Champagne J, Fergusson D, Stewart DJ, Sullivan KJ, Doxtator E, Lalu M, English SW, Granton J, Hutton B, Marshall J, Maybee A, Walley KR, Santos CD, Winston B, McIntyre L. Cell therapy with intravascular administration of mesenchymal stromal cells continues to appear safe: an updated systematic review and meta-analysis. EClinicalMedicine, 19, 100249 (2020).
• 21)  Strong AL, Bowles AC, Wise RM, Morand JP, Dutreil MF, Gimble JM, Bunnell BA. Human adipose stromal/stem cells from obese donors show reduced efficacy in halting disease progression in the experimental autoimmune encephalomyelitis model of multiple sclerosis. Stem Cells, 34, 614–626 (2016).
• 22)  Alicka M, Major P, Wysocki M, Marycz K. Adipose-derived mesenchymal stem cells isolated from patients with type 2 diabetes show reduced “Stemness” through an altered secretome profile, impaired anti-oxidative protection, and mitochondrial dynamics deterioration. J. Clin. Med., 8, 765 (2019).
• 23)  Eirin A, Thaler R, Glasstetter LM, Xing L, Zhu XY, Osborne AC, Mondesir R, Bhagwate AV, Lerman A, van Wijnen AJ, Ler-man LO. Obesity-driven mitochondrial dysfunction in human adipose tissue-derived mesenchymal stem/stromal cells involves epigenetic changes. Cell Death Dis., 15, 387 (2024).
• 24)  Nakajima K, Sano S. Mouse models of psoriasis and their relevance. J. Dermatol., 45, 252–263 (2018).
• 25)  van der Fits L, Mourits S, Voerman JS, Kant M, Boon L, Laman JD, Cornelissen F, Mus AM, Florencia E, Prens EP, Lubberts E. Imiquimod-induced psoriasis-like skin inflammation in mice is mediated via the IL-23/IL-17 axis. J. Immunol., 182, 5836–5845 (2009).
• 26)  Gangwar RS, Gudjonsson JE, Ward NL. Mouse Models of psoriasis: a comprehensive review. J. Invest. Dermatol., 142 (3 Pt. B), 884–897 (2022).
• 27)  Swindell WR, Johnston A, Carbajal S, Han G, Wohn C, Lu J, Xing X, Nair RP, Voorhees JJ, Elder JT, Wang XJ, Sano S, Prens EP, DiGiovanni J, Pittelkow MR, Ward NL, Gudjonsson JE. Genome-wide expression profiling of five mouse models identifies similarities and differences with human psoriasis. PLOS ONE, 6, e18266 (2011).
• 28)  Swindell WR, Michaels KA, Sutter AJ, Diaconu D, Fritz Y, Xing X, Sarkar MK, Liang Y, Tsoi A, Gudjonsson JE, Ward NL. Imiquimod has strain-dependent effects in mice and does not uniquely model human psoriasis. Genome Med., 9, 24 (2017).
• 29)  Rokunohe A, Matsuzaki Y, Rokunohe D, Sakuraba Y, Fukui T, Nakano H, Sawamura D. Immunosuppressive effect of adipose-derived stromal cells on imiquimod-induced psoriasis in mice. J. Dermatol. Sci., 82, 50–53 (2016).
• 30)  Sah SK, Park KH, Yun CO, Kang KS, Kim TY. Effects of human mesenchymal stem cells transduced with superoxide dismutase on imiquimod-induced psoriasis-like skin inflammation in mice. Antioxid. Redox Signal., 24, 233–248 (2017).
• 31)  Lee YS, Sah SK, Lee JH, Seo KW, Kang KS, Kim TY. Human umbilical cord blood-derived mesenchymal stem cells ameliorate psoriasis-like skin inflammation in mice. Biochem. Biophys. Rep., 9, 281–288 (2017).
• 32)  Imai Y, Yamahara K, Hamada A, Fujimori Y, Yamanishi K. Human amnion-derived mesenchymal stem cells ameliorate imiquimod-induced psoriasiform dermatitis in mice. J. Dermatol., 46, 276–278 (2019).
• 33)  Kim CH, Lim CY, Lee JH, Kim KC, Ahn JY, Lee EJ. Human embryonic stem cells-derived mesenchymal stem cells reduce the symptom of psoriasis in imiquimod-induced skin model. Tissue Eng. Regen. Med., 16, 93–102 (2019).
• 34)  Chen M, Peng J, Xie Q, Xiao N, Su X, Mei H, Lu Y, Zhou J, Dai Y, Wang S, Li C, Lin G, Cheng L. Mesenchymal stem cells alleviate moderate-to-severe psoriasis by reducing the production of type I interferon (Ifn-I) by plasmacytoid dendritic cells (pDCs). Stem Cells Int., 2019, 6961052 (2019).
• 35)  Ye Z, Liang Y, Lin B, Li Y, Chai X, Lian J, Zhang X, Che Z, Zeng J. Gingiva-derived mesenchymal stem cells attenuate imiquimod- (Imq-) induced murine psoriasis-like skin inflammation. Stem Cells Int., 2022, 6544514 (2022).
• 36)  Zhang Y, Yan J, Li Z, Zheng J, Sun Q. Exosomes derived from human umbilical cord mesenchymal stem cells alleviate psoriasis-like skin inflammation. J. Interferon Cytokine Res., 42, 8–18 (2022).
• 37)  Cuesta-Gomez N, Medina-Ruiz L, Graham GJ, Campbell JDM. IL-6 and TGF-β-secreting adoptively-transferred murine mesenchymal stromal cells accelerate healing of psoriasis-like skin inflammation and upregulate IL-17A and TGF-β. Int. J. Mol. Sci., 24, 10132 (2023).
• 38)  Johnston A, Xing X, Wolterink L, Barnes DH, Yin Z, Reingold L, Kahlenberg JM, Harms PW, Gudjonsson JE. IL-1 and IL-36 are dominant cytokines in generalized pustular psoriasis. J. Allergy Clin. Immunol., 140, 109–120 (2017).
• 39)  Wu DH, Zhang MM, Li N, Li X, Cai QW, Yu WL, Liu LP, Zhu W, Lu CJ. PSORI-CM02 alleviates IMQ-induced mouse dermatitis via differentially regulating pro- and anti-inflammatory cytokines targeting of Th2 specific transcript factor GATA3. Biomed. Pharmacother., 110, 265–274 (2019).
• 40)  Ohgane K, Yoshioka H. Quantification of gel bands by an Image J Macro, band/peak quantification tool. protocols.io (2019).
• 41)  Viswanathan S, Shi Y, Galipeau J, Krampera M, Leblanc K, Martin I, Nolta J, Phinney DG, Sensebe L. Mesenchymal stem versus stromal cells: International Society for Cell & Gene Therapy (ISCT^®) Mesenchymal Stromal Cell committee position statement on nomenclature. Cytotherapy, 21, 1019–1024 (2019).
• 42)  Dominici M, Le Blanc K, Mueller I, Slaper-Cortenbach I, Marini F, Krause D, Deans R, Keating A, Prockop DJ, Horwitz E. Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement. Cytotherapy, 8, 315–317 (2006).
• 43)  Hwang I, Jo K, Shin KC, Kim JI, Ji Y, Park YJ, Park J, Jeon YG, Ka S, Suk S, Noh HL, Choe SS, Alfadda AA, Kim JK, Kim S, Kim JB. GABA-stimulated adipose-derived stem cells suppress subcutaneous adipose inflammation in obesity. Proc. Natl. Acad. Sci. U.S.A, 116, 11936–11945 (2019).
• 44)  Yoshiki R, Kabashima K, Honda T, Nakamizo S, Sawada Y, Sugita K, Yoshioka H, Ohmori S, Malissen B, Tokura Y, Naka-mura M. IL-23 from Langerhans cells is required for the development of imiquimod-induced psoriasis-like dermatitis by induction of IL-17A-producing γδ T cells. J. Invest. Dermatol., 134, 1912–1921 (2014).
• 45)  Gilliet M, Conrad C, Geiges M, Cozzio A, Thürlimann W, Burg G, Nestle FO, Dummer R. Psoriasis triggered by toll-like receptor 7 agonist imiquimod in the presence of dermal plasmacytoid dendritic cell precursors. Arch. Dermatol., 140, 1490–1495 (2004).
• 46)  Moos S, Mohebiany AN, Waisman A, Kurschus FC. Imiquimod-induced psoriasis in mice depends on the IL-17 signaling of keratinocytes. J. Invest. Dermatol., 139, 1110–1117 (2019).
• 47)  Walter A, Schäfer M, Cecconi V, Matter C, Urosevic-Maiwald M, Belloni B, Schönewolf N, Dummer R, Bloch W, Werner S, Beer HD, Knuth A, van den Broek M. Aldara activates TLR7-independent immune defence. Nat. Commun., 4, 1560 (2013).
• 48)  Straß S, Geiger J, Martorelli M, Geiger S, Cloos N, Keppler M, Fischer T, Riexinger L, Schwamborn A, Guezguez J, Späth N, Cruces S, Guse JH, Sandri TL, Burnet M, Laufer S. Isostearic acid is an active component of imiquimod formulations used to induce psoriaform disease models. Inflammopharmacology, 31, 799–812 (2023).
• 49)  Shimizu T, Kamata M, Fukaya S, Hayashi K, Fukuyasu A, Tanaka T, Ishikawa T, Ohnishi T, Tada Y. Anti-IL-17A and IL-23p19 antibodies but not anti-TNFα antibody induce expansion of regulatory T cells and restoration of their suppressive function in imiquimod-induced psoriasiform dermatitis. J. Dermatol. Sci., 95, 90–98 (2019).
• 50)  Li Q, Liu W, Gao S, Mao Y, Xin Y. Application of imiquimod-induced murine psoriasis model in evaluating interleukin-17A antagonist. BMC Immunol., 22, 11 (2021).
• 51)  D’Erme AM, Wilsmann-Theis D, Wagenpfeil J, Hölzel M, Ferring-Schmitt S, Sternberg S, Wittmann M, Peters B, Bosio A, Bieber T, Wenzel J. IL-36γ (IL-1F9) is a biomarker for psoriasis skin lesions. J. Invest. Dermatol., 135, 1025–1032 (2015).
• 52)  Samotij D, Szczęch J, Reich A. Generalized pustular psoriasis: divergence of innate and adaptive immunity. Int. J. Mol. Sci., 22, 9048 (2021).
• 53)  Giannoudaki E, Stefanska AM, Lawler H, Leon G, Hernandez Santana YE, Hassan N, Russell SE, Horan R, Sweeney C, Pres-ton RS, Mantovani A, Garlanda C, Fallon PG, Walsh PT. SIGIRR negatively regulates IL-36-driven psoriasiform inflammation and neutrophil infiltration in the skin. J. Immunol., 207, 651–660 (2021).
• 54)  Chi HH, Hua KF, Lin YC, Chu CL, Hsieh CY, Hsu YJ, Ka SM, Tsai YL, Liu FC, Chen A. IL-36 signaling facilitates activation of the NLRP3 inflammasome and IL-23/IL-17 axis in renal inflammation and fibrosis. J. Am. Soc. Nephrol., 28, 2022–2037 (2017).
• 55)  Zhan ZY, Jiang M, Zhang ZH, An YM, Wang XY, Wu YL, Nan JX, Lian LH. NETs contribute to psoriasiform skin inflammation: a novel therapeutic approach targeting IL-36 cytokines by a small molecule tetrahydroxystilbene glucoside. Phytomedicine, 131, 155783 (2024).
• 56)  Ganesan R, Raymond EL, Mennerich D, et al. Generation and functional characterization of anti-human and anti-mouse IL-36R antagonist monoclonal antibodies. MAbs, 9, 1143–1154 (2017).
• 57)  Fischer B, Kübelbeck T, Kolb A, Ringen J, Waisman A, Wittmann M, Karbach S, Kölsch SM, Kramer D. IL-17A-driven psoriasis is critically dependent on IL-36 signaling. Front. Immunol., 14, 1256133 (2023).
• 58)  Zhang ZH, Zhan ZY, Jiang M, Wang XY, Quan SL, Wu YL, Nan JX, Lian LH. Casting NETs on psoriasis: the modulation of inflammatory feedback targeting IL-36/IL-36R axis. Int. Immunopharmacol., 142 (Pt. B), 113190 (2024).
• 59)  Jiang D, Muschhammer J, Qi Y, Kügler A, de Vries JC, Saffarzadeh M, Sindrilaru A, Beken SV, Wlaschek M, Kluth MA, Ganss C, Frank NY, Frank MH, Preissner KT, Scharffetter-Kochanek K. Suppression of neutrophil-mediated tissue damage—a novel skill of mesenchymal stem cells. Stem Cells, 34, 2393–2406 (2016).
• 60)  Chen L, Liu Y, Wang Z, Zhang L, Xu Y, Li Y, Zhang L, Wang G, Yang S, Xue G. Mesenchymal stem cell-derived extracellular vesicles protect against abdominal aortic aneurysm formation by inhibiting NET-induced ferroptosis. Exp. Mol. Med., 55, 939–951 (2023).
• 61)  Nagase K, Okada A, Matsuda J, Ichikawa D, Hattori Y, Kanazawa H. A thermoresponsive cationic block copolymer brush-grafted silica bead interface for temperature-modulated separation of adipose-derived stem cells. Colloids Surf. B Biointerfaces, 220, 112928 (2022).
• 62)  Nagase K, Wakayama H, Matsuda J, Kojima N, Kanazawa H. Thermoresponsive mixed polymer brush to effectively control the adhesion and separation of stem cells by altering temperature. Mater. Today Bio, 20, 100627 (2023).