Stimulation of α7 Nicotinic Acetylcholine Receptors by PNU282987 Demonstrates Efferocytosis-Like Activation and Neuroprotection in Human Models of Microglia and Cholinergic Neurons under the Pathophysiological Conditions of Alzheimer’s Disease

Abstract

Alzheimer’s disease (AD) is a progressive neurodegenerative disorder characterized by amyloid-β (Aβ) peptide accumulation, leading to neuroinflammation and neurodegeneration. In early AD stages, neurodegeneration of basal forebrain cholinergic neurons occurs. Microglia, which are brain immune cells, contribute to Aβ clearance and neuroinflammation. This study investigated the therapeutic effects of PNU282987, a selective full agonist of α7 nicotinic acetylcholine receptor (nAChR), using human models of microglia (hiMacs) and basal forebrain cholinergic neurons (hiBFChNs), both differentiated from human induced pluripotent stem cells (hiPSCs). Our findings indicated that PNU282987 markedly enhanced Aβ phagocytosis by microglia and extracellular Aβ clearance. Furthermore, PNU282987 injection reduced Aβ accumulation in the brain of a mouse model. Treatment of hiMacs with PNU282987 upregulated the expressions of efferocytosis-related genes, such as ASAP2, OSM, and THBD. Efferocytosis-like activation by PNU282987 in hiMacs was further suggested by an increased release of the anti-inflammatory cytokine interleukin-10 (IL-10), along with suppression of the pro-inflammatory cytokine IL-1β produced from microglia with Aβ treatment. This indicates a transformation from Aβ-induced inflammatory phagocytosis to an efferocytosis-like anti-inflammatory phagocytosis. PNU282987 also exerted direct neuroprotective effects on hiBFChNs against Aβ and tumor necrosis factor-α. Furthermore, PNU282987 changed the extracellular contents released from Aβ-treated hiMacs and attenuated the neurotoxicity. These results suggest that α7 nAChR stimulation by PNU282987 enhances the therapeutic effects against AD by promoting Aβ clearance with anti-neuroinflammatory regulation in the microglia and providing direct protection to neurons, thereby addressing the inflammatory and neurodegenerative aspects of AD.

INTRODUCTION

Alzheimer’s disease (AD) is a progressive neurodegenerative disorder and the leading cause of dementia. The main risk factor for AD is aging. The WHO estimates that between 2015 and 2050, the proportion of the global population aged 60 years and over will almost double, rising from 12 to 22%. Accordingly, it is predicted that by 2050, the number of people with dementia worldwide will increase to 139 million from approximately 55 million in 2019. Thus, treating AD is one of the top priorities that humanity must address as soon as possible. One of the pathological features of AD is the formation of senile plaques owing to the extracellular accumulation of amyloid-β (Aβ) peptides in the brain. The amyloid cascade hypothesis states that Aβ accumulation triggers a series of events leading to neurodegeneration, including tauopathy and neuroinflammation.¹⁾ Furthermore, it has been reported that Aβ oligomers, which are soluble aggregation intermediates, show even higher neurotoxicity.²⁾

Microglia are responsible for brain immunity. Although they are suggested to play a pivotal role in the removal of Aβ from the brain through phagocytic function,³⁾ it is believed that long-term exposure to Aβ causes microglial activation, which induces neuroinflammation.⁴⁾ Pro-inflammatory-activated microglia release cytokines such as interleukin-1β (IL-1β) and tumor necrosis factor-α (TNF-α), which cause neurological damage. The dual aspects of microglia in preventing and promoting AD pathophysiology have been discussed for a long time.⁵⁾ In this context, the current analysis using single-cell RNA-sequencing has revealed the existence of various microglial subpopulations and activation states as a continuum.^6,7)

Clearance of apoptotic cells, cellular debris, and detrimental metabolic products by professional phagocytic cells is necessary for the retention of tissue homeostasis and the resolution of inflammation. Efferocytosis is the process of apoptotic cell clearance by phagocytosis, followed by tissue repair.⁸⁾ Macrophages are one of the representative cell types that carry out efferocytosis. During efferocytosis, macrophages engulf apoptotic cells and secrete anti-inflammatory cytokines, such as IL-10, to suppress pro-inflammatory cytokine production and promote tissue repair.⁸⁾ The removal of Aβ accumulated in the brain by microglia, tissue macrophages in the brain, is considered to be part of efferocytosis.⁹⁾ In addition, it has been suggested that impaired efferocytosis contributes to the onset of AD and that its improvement may hold potential for AD treatment.^10,11)

Nicotinic acetylcholine receptors (nAChRs) incorporate ion channels that are permeable to positive ions and regulate the neuronal activity and the release of neurotransmitters in neurons. The following subunits have been identified in humans: α1–7, α9–10, β1–4, δ, ε, and γ. The α7 nAChR is formed by a pentamer of α7 subunits. In the brain, it is highly expressed in neurons, including basal forebrain cholinergic neurons,^12,13) which are known to be particularly vulnerable to AD. The α7 nAChR is found not only in neurons but also in microglia, astrocytes, and endothelial cells and is thereby involved in various events in the brain, such as neuroprotection and brain immunity.¹⁴⁾

We previously reported that Aβ phagocytosis by microglia was promoted by treatment with galantamine,¹⁵⁾ a positive allosteric modulator (PAM) of nAChR, and DMXBA (GST-21),¹⁶⁾ a selective partial agonist of α7 nAChR in the rodent system. However, the effects of selective full agonists of α7 nAChR on microglial Aβ phagocytosis, cytokine production, and neuroprotection using human cell model systems have not yet been examined. This study, in which human cell model systems were used, revealed that PNU282987, a selective full agonist of α7 nAChR, induced human microglial efferocytosis-like activation characterized by the promotion of Aβ phagocytosis, production of the anti-inflammatory cytokine IL-10, and suppression of pro-inflammatory cytokine production of IL-1β induced by Aβ. Furthermore, PNU282987 exerted direct neuroprotective effects against neurotoxicity induced by Aβ and neuroinflammation-related factors in human basal forebrain cholinergic neurons.

MATERIALS AND METHODS

Primary Mouse Microglia Culture

Primary cultured mouse microglia were prepared as previously described.¹⁶⁾ Briefly, the forebrains of newborn mice were filtered through a nylon mesh with a 70-μm pore size. Subsequently, the cells were cultured in Dulbecco’s modified Eagle’s medium (Nacalai Tesque, Kyoto, Japan) containing 5% fetal bovine serum (Sigma-Aldrich, St. Louis, MO, U.S.A.) and 1% penicillin–streptomycin (PC/SM; FUJIFILM Wako Pure Chemical Corporation, Osaka, Japan) on a 10-cm diameter dish at 37°C in a humidified 5% CO₂/95% air atmosphere. After 4 weeks of cultivation, the floating microglia in the culture medium were collected and utilized in the experiment. Animal experiments for the preparation of primary cultured mouse microglia were performed in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals and were approved by the Committee for Animal Research at Kyoto Pharmaceutical University (Approval No. DIPS-19-005).

Maintenance of the Human Induced Pluripotent Stem Cells (hiPSCs)

The 1231A3 line of hiPSCs, derived from ePBMC^® and purchased from Cellular Technology Limited (Cleveland, OH, U.S.A.), was established by Kyoto University and provided by the RIKEN Bioresource Research Center (Tsukuba, Japan) through the National BioResource Project of the Ministry of Education, Culture, Sports, Science and Technology/Japan Agency for Medical Research and Development (MEXT/AMED), Japan.¹⁷⁾ Experiments using hiPSCs were conducted in accordance with the Code of Ethics of the World Medical Association (Declaration of Helsinki) and approved by the Ethics Review Committee for Medical and Health Research Involving Human Subjects of Kyoto Pharmaceutical University (Approval No. 20-18-26). The hiPSCs were maintained under feeder-free conditions in Essential 8 (E8) medium (Thermo Fisher Scientific, Waltham, MA, U.S.A.) containing 10-μM Y-27632 (Selleck Chemicals, Houston, TX, U.S.A.) for the 1st day on culture dishes coated with iMatrix-511 silk (Nippi, Tokyo, Japan), as previously described.¹⁸⁾ Y-27632 was removed from the culture medium from the next day onward.

Differentiation of hiPSC-Derived Primitive Macrophages (hiMacs)

The hiMacs were produced as previously reported.^19,20) Briefly, hiPSCs and hiPSC-derived cells were cultured in StemPro-34 SFM medium (Thermo Fisher Scientific) supplemented with 150-μg/mL transferrin from human serum (Roche, Basel, Switzerland), l-glutamine (1×; FUJIFILM Wako Pure Chemical Corporation), 500-μM l-ascorbic acid (Sigma-Aldrich), 0.45-mM monothioglycerol (FUJIFILM Wako Pure Chemical Corporation), and PC/SM (1×) during differentiation days 0–16. Starting from Day 16, the basal culture medium was changed to serum-free differentiation (SF-DIFF) medium prepared by combining Iscove’s modified Dulbecco’s medium with GlutaMAX supplement (Thermo Fisher Scientific) and Ham’s F-12 medium (Thermo Fisher Scientific) in a ratio of 3 : 1. The following components were further added to the SF-DIFF medium: N2 supplement (1×; Thermo Fisher Scientific), B27 supplement without vitamin A (1×; Thermo Fisher Scientific), 0.1% bovine serum albumin (BSA) (FUJIFILM Wako Pure Chemical Corporation), and PC/SM (1×). The cells were cultured in incubators set to 37°C under hypoxic conditions (5% O₂ with 5% CO₂) for Days 0–7 and under normoxic conditions (5% CO₂/95% air) for Days 8–28. The use of cytokines (R&D Systems, Minneapolis, MN, U.S.A.) and the chemical CHIR99021 (Selleck Chemicals, Houston, TX, U.S.A.) for differentiation is summarized in Table 1. From Day 30 onward, the floating hiMacs were collected and used in the experiments.

Table 1. Cytokines and Chemicals Used in the Differentiation of hiMacs

Supplements	Concentration	Differentiation day
hrBMP4	5 ng/mL	0–4
CHIR99021	2 μM	0–2
hrVEGF	50 ng/mL	0–4
	15 ng/mL	4–6
	10 ng/mL	6–10
hrFGF2	20 ng/mL	2–4
	5 ng/mL	4–6
	10 ng/mL	6–16
hrDKK-1	30 ng/mL	6–12
hrIL-3	20 ng/mL	6–16
hrIL-6	10 ng/mL	6–16
hrSCF	50 ng/mL	6–16
hrCSF-1	50 ng/mL	16–30

BMP4: bone morphogenic protein 4; CSF1: colony-stimulating factor 1; FGF2: fibroblast growth factor 2; hr: human recombinant; IL: interleukin; SCF: stem cell factor; VEGF: vascular endothelial growth factor.

Differentiation of hiBFChNs from hiPSCs

The hiPSC-derived basal forebrain cholinergic neurons (hiBFChNs) were produced as previously reported.¹⁸⁾ Briefly, hiPSCs and hiPSC-derived cells were cultured in E6 medium (Thermo Fisher Scientific) with PC/SM (1×) on Days 0–10 as the culture basal medium. AscleStem Neuronal Medium (Nacalai Tesque) was gradually added to the E6 medium on Day 5, and from Day 11 onward, it was utilized as the culture basal medium instead of the E6 medium. During the differentiation, the cells were cultured on dishes coated with iMatrix-511 silk at 37°C in humidified 5% CO₂/95% air. The following components were added to the basal culture medium: ascorbic acid, DAPT (Selleck Chemicals), LDN193189 (Selleck Chemicals), MA83-01 (FUJIFILM Wako Pure Chemical Corporation), purmorphamine (Selleck Chemicals), XAV939 (Selleck Chemicals), and Y27632, as well as brain-derived neurotrophic factor (PeproTech, Rocky Hill, NJ, U.S.A.). The usage of these components is summarized in Table 2. On Day 16, the cells were replated onto plastic-bottom dishes coated with iMatrix-511 silk or glass-bottom dishes coated with iMatrix-511 silk, poly-l-ornithine hydrobromide (Sigma-Aldrich), and fibronectin (FUJIFILM Wako Pure Chemical Corporation).

Table 2. Chemicals and Supplements Used in the Differentiation of hiBFChNs

Supplements	Concentration	Differentiation day
Y27632	10 μM	0–3
A83-01	500 nM	0–6
Purmorphamine	3 μM	1–10
LDN193189	200 nM	0–15
XAV939	2 μM	0–15
AscleStem Neuronal Medium	25%	5–6
	50%	7–8
	75%	9–10
SU9516	5 μM	16–24
PD0325901	1 μM	16–24
Ascorbic acid	200 nM	16–24
DAPT	10 μM	16–24
BDNF	20 ng/μL	16–24

Supplements were added to E6 medium on Days 0–10 and to AscleStem Neuronal Medium on Days 11–24. BDNF: brain-derived neurotrophic factor.

Preparation of PNU282987 and Aβ Peptides

PNU282987 (Alomone Labs, Jerusalem, Israel), an α7 nAChR-selective agonist, was diluted to 300 mM with 100% dimethyl sulfoxide (DMSO; Nacalai Tesque). In this study, O-acyl isopeptide Aβ_1–42 (isoAβ; Peptide Institute, Osaka, Japan) was utilized to induce neuronal cell death. The isoAβ possesses an O-acyl residue at the Gly25–Ser26 sequence and maintains its monomeric state without aggregation under acidic conditions. Upon changing the pH of the solvent from acidic to neutral, e.g., from trifluoroacetic acid (TFA) to neutral cell culture medium, isoAβ is converted to the native Aβ_1–42 sequence and immediately initiates self-aggregation.^18,21,22) Therefore, isoAβ reproducibly generates Aβ oligomers with high neurotoxicity under neutral pH conditions. The isoAβ was dissolved in 0.1% TFA (FUJIFILM Wako Pure Chemical Corporation) and centrifuged at 20000 × g at a temperature of 4°C for 1 h. The protein concentration in the collected supernatant was determined by measuring the absorption spectrum at 280 nm using a microvolume spectrophotometer (NanoPhotometer NP80; Implen, München, Germany). Next, isoAβ was diluted with 0.1% TFA to a stock concentration of 140 μM and stored at −80°C. β-Amyloid (1–42), HiLyte™ Fluor 488-labeled (fluorescence-labeled Aβ; AnaSpec, Fremont, CA, U.S.A.), was diluted with distilled water containing 1% NH₄OH to a stock concentration of 100 μM and treated with primary cultured microglia. Meanwhile, the hydrochloride salt form of Aβ_1–42 (Aβ; AnaSpec) was utilized for the assays of phagocytosis and gene expression in hiMacs. Aβ was first diluted with 1,1,1,3,3,3-hexafluoropropan-2-ol (HFIP) for Aβ disaggregation. After HFIP evaporation by deaeration, 100% DMSO was added to achieve a final Aβ concentration of 400 μM, and Aβ was stored at −80°C.

Flow Cytometry

For flow cytometry, a blocking buffer was prepared by adding 0.5% BSA, 1% mouse serum (Sigma-Aldrich), 1% rat serum (Sigma-Aldrich), and 125 mM ethylenediaminetetraacetic acid (EDTA) (Nacalai Tesque) to phosphate-buffered saline (PBS). To analyze α7 nAChR expression on the surface of the plasma membrane, primary cultured mouse microglia and hiMacs were incubated with a primary antibody against α7 nAChR (1 : 100; Alomone Labs) in the blocking buffer for 20 min at 4°C, followed by a secondary antibody (Alexa Fluor 647-conjugated anti-rabbit immunoglobulin G (IgG), 1 : 200; Abcam, Cambridge, U.K.) in the blocking buffer under the same conditions. The cells were treated with nothing as a negative control (without a primary antibody). 7-Aminoactinomycin D (1 : 100; Thermo Fisher Scientific) was added to the cells to detect dead cells, and the cells were analyzed using a Fortessa X-20 flow cytometer (BD Biosciences, Franklin Lakes, NJ, U.S.A.). Histograms were generated using Kaluza software (Beckman Coulter, Brea, CA, U.S.A.).

WST-8 Assay

To analyze the effect of PNU282987 on cell viability, a WST-8 assay was performed. Primary cultured mouse microglia and hiMacs were seeded at a density of 5.0 × 10⁴ cells per well in 96-well plates. The day after seeding, the cells were treated with PNU282987 (3–100 μM) for 48 h, and the WST-8 assay was performed using Cell Count Reagent SF (Nacalai Tesque) according to the manufacturer’s protocol.

Lactate Dehydrogenase (LDH) Assay

To analyze cytotoxicity, an LDH assay was performed. Primary cultured mouse microglia and hiMacs were seeded at a density of 5.0 × 10⁴ cells per well in 96-well plates and then treated with PNU282987 (3–100 μM) for 48 h the day after seeding. Meanwhile, the progenitor cells of hiBFChNs (differentiation day 16) were replated at 1.5 × 10⁵ cells per well in 96-well plates. On Days 8–14 from replating (differentiation days 24–30), the cells were treated with PNU282987 (30–100 μM) in the presence or absence of 3 μM isoAβ for 48 h. Mecamylamine (10 μM; a nAChR-nonselective antagonist; Sigma-Aldrich) and methyllycaconitine (10 nM; an α7 nAChR-selective antagonist; Sigma-Aldrich) were added 10 min before the PNU282987 treatment. TNF-α (100 ng/μL; FUJIFILM Wako Pure Chemical Corporation) was added to hiBFChNs for 24 h instead of isoAβ. Furthermore, hiBFChNs were cultured for 48 h in the conditioned medium collected from hiMacs treated with isoAβ (3 μM) in the presence or absence of PNU282987 (100 μM) for 12 h. The LDH assay was performed using an LDH cytotoxicity assay kit (Nacalai Tesque) according to the manufacturer’s protocol. The average of the values obtained for the sample with cells lysed using the provided lysate reagent was set to 100% as the high control.

Assays of Aβ Phagocytosis and Clearance

Aβ phagocytosis and clearance in primary cultured mouse microglia and hiMacs were analyzed via image analysis following immunocytochemistry and enzyme-linked immunosorbent assay (ELISA). In the immunocytochemical analysis, primary cultured mouse microglia and hiMacs were seeded at a density of 2.5 × 10⁴ cells on glass-bottom plates (Matsunami Glass Ind., Ltd., Osaka, Japan). Fluorescence-labeled Aβ and Aβ (both at 1 μM) were added to primary cultured mouse microglia and hiMacs, respectively, in the presence or absence of PNU282987 (3–100 μM) for 12 h. The cells were fixed with PBS containing 4% paraformaldehyde (PFA; Nacalai Tesque) for 30 min at 4°C. Then, hiMacs were incubated with a primary antibody against Aβ (clone 6E10, 1 : 500; BioLegend, San Diego, CA, U.S.A.) overnight at 4°C, followed by Alexa Fluor 488-labeled anti-mouse IgG secondary antibody (1 : 500; Thermo Fisher Scientific) for 2 h at room temperature for the detection of non-labeled Aβ. To visualize the shape of the cells, actin filaments were probed with rhodamine–phalloidin (1 : 500; Thermo Fisher Scientific). Fluorescent signals were imaged using a confocal laser scanning microscope (LSM800; Zeiss, Jena, Germany). In the image analysis, the fluorescence intensities of Aβ inside the cells and the cell area were measured by enclosing each cell with the region of interest (ROI) using an open-source software, ImageJ (National Institutes of Health, Bethesda, MD, U.S.A.; https://imagej.net). Moreover, the Aβ fluorescence intensity per unit area of primary cultured mouse microglia contained in a single field of view and per unit area of each hiMacs was calculated.

In ELISA, primary cultured mouse microglia and hiMacs were seeded at a density of 5.0 × 10⁴ cells per well in 96-well plates. The cells were treated with Aβ (1 μM) in the presence or absence of PNU282987 (10–100 μM) for 12 h. The conditioned medium was collected, and the extracellular Aβ concentration was measured using a human amyloid (1–x) kit (Immuno-Biological Laboratories, Gunma, Japan) according to the manufacturer’s protocol.

Immunocytochemical Analysis of hiBFChNs

hiBFChNs were fixed with 4% PFA for 30 min at 4°C. Primary antibodies against Aβ (clone 6E10, 1 : 500) and microtubule-associated protein 2 (1 : 1000; Abcam) were incubated overnight at 4°C. Subsequently, the cells were incubated with secondary antibodies (Alexa Fluor 555-labeled anti-mouse IgG antibody and Alexa Fluor 488-labeled anti-chicken IgY antibody, each 1 : 500; Thermo Fisher Scientific) for 2 h at room temperature. Fluorescent signals were imaged using a confocal laser scanning microscope (LSM800; Zeiss).

A Mouse Model of Brain Aβ Accumulation and Drug Treatment

APdE9 mice were utilized as models of Aβ accumulation in the brain.²³⁾ The APdE9 mice, heterozygous harboring for the mutant Aβ precursor protein (APPswe: KM594/5NL) and presenilin 1 (dE9: deletion of exon 9), were purchased from The Jackson Laboratory (Bar Harbor, ME, U.S.A.) and maintained as strains by mating with littermates. The mice were bred under conditions of 25°C temperature, 12-h light/dark cycle, and 24-h free access to distilled water in the Bioscience Research Center at Kyoto Pharmaceutical University. Animal experiments for the assays of Aβ accumulation in the brain were conducted in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals and approved by the Committee for Animal Research at Kyoto Pharmaceutical University (Approval No.: DIPS-19-001). Male APdE9 mice aged 18 months were administered PNU282987 (2 mg/kg; n = 6) or saline (n = 6) via intraperitoneal (i.p.) injection once a day for 2 weeks.

Analysis of Brain Aβ Accumulation via Immunohistochemical Analysis and ELISA

After the final drug injection, the mice were deeply anesthetized via i.p. administration of a mixture of butorphanol (5 mg/kg; Meiji Seika Pharma, Tokyo, Japan), midazolam (4 mg/kg; Maruishi Pharmaceutical Co., Osaka, Japan), and medetomidine (0.3 mg/kg; ZENOAQ, Koriyama, Japan). Once deep anesthesia was confirmed, the mice were transcardially perfused with PBS on ice to remove blood from the circulatory system. Then, the brains were carefully removed and divided into hemibrains for immunohistochemical analysis and ELISA.

For the immunohistochemical analysis, the hemibrains were immediately placed in ice-cold 4% PFA for fixation and further immersion-fixed at 4°C for 3 d. Subsequently, the fixed hemibrains were dehydrated with 30% sucrose for 3 d and then sectioned (20-μm thickness) using a cryostat. Next, the hemibrain sections were incubated with primary antibodies against Aβ (clone 82E1; 1 : 1000) and ionized calcium-binding adapter protein 1 (Iba1; 1 : 1000, FUJIFILM Wako Pure Chemical Corporation) at 4°C overnight. For nuclei staining, Hoechst 33342 (1 : 4000, Thermo Fisher Scientific) was mixed. The fluorescent signal in the hemibrain sections mounted on the glass slides was detected using the LSM800 in the Z-stack mode. In the image analysis, the fluorescent areas of Aβ and the merged areas of Aβ and Iba1 were measured by enclosing each brain area (hemispheres, hippocampi, and cortexes) with an ROI using the ImageJ software.

For ELISA, hemibrains were prepared as previously described.^15,16) The hemibrains were homogenized in Tris-buffered saline (TBS) and then centrifuged at 100000 × g for 1 h. The supernatants (TBS fractions) were collected for the measurement of soluble Aβ. Pellets were homogenized in 70% formic acid (FA), followed by centrifugation (100000 × g) for 1 h at 4°C, and then the supernatants (FA fractions) were collected for the measurement of insoluble Aβ. The FA fractions were neutralized with a 20-fold volume of 1 M Tris buffer (pH 11.0) before analysis. The Aβ in the TBS and FA fractions was measured using a human amyloid (1–x) kit (Immuno-Biological Laboratories) according to the manufacturer’s protocol.

Real-Time Quantitative PCR (RT-qPCR)

The hiMacs were treated with Aβ_1–42 (1 μM) in the presence or absence of PNU282987 (100 μM) for 12 h. After washing the cells with PBS, total RNA was extracted from the hiMacs using the NucleoSpin RNA Kit (TaKaRa Bio Inc., Kusatsu, Japan). RT for cDNA synthesis was conducted using the High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific). RT-qPCR was performed using PowerUp SYBR Green Master Mix (Thermo Fisher Scientific) on a CronoSTAR 96 Real-Time PCR System (WakenBtech, Kyoto, Japan). The data were analyzed using the ΔΔCT method, and raw data were normalized to the GAPDH gene. The primer sequences used are listed in Table 3.

Table 3. RT-qPCR Primers Used in This Study

Genes	Sense (5′–3′)	Antisense (5′–3)
GAPDH	ttgaggtcaatgaaggggtc	gaaggtgaaggtcggagtca
ASAP2	attccttggcccagttctgg	tcagagctgggctatggact
OSM	ggatttggagaggtctgggc	tctgagttgtccagcagctg
THBD	taccaagcaccttagctggc	tccctctaatcaccccctcg

Cytokine Production Assay

The hiMacs were treated with isoAβ (3 μM) in the presence or absence of PNU282987 (100 μM) for 12 h. Then, the conditioned medium was collected from the cells, and the IL-10, IL-1β, and TNF-α levels were measured using ELISA kits (R&D Systems) according to the manufacturer’s protocols.

Statistical Analysis

All data were statistically analyzed using GraphPad Prism 5 (GraphPad Software, La Jolla, CA, U.S.A.). The results were expressed as means ± standard errors of the mean. Student’s unpaired t-test was used to compare the 2 groups. One-way ANOVA was followed by Bonferroni’s post hoc multiple comparison test in the statistical analysis among more than 3 groups. p-Value <0.05 was considered statistically significant.

RESULTS

PNU282987 Promotes Aβ Phagocytosis in Mouse Primary-Cultured Microglia

To explore the effects of PNU282987, a selective full agonist of α7 nAChR, on microglia, we first analyzed the expression of α7 nAChR on the plasma membrane of primary cultured mouse microglia (mouse microglia) via flow cytometry and confirmed its presence (Fig. 1A). Then, we evaluated the cytotoxicity of PNU282987 in mouse microglia. The WST-8 and LDH assays (Figs. 1B and 1C, respectively) demonstrated that PNU282987 does not exhibit cytotoxicity to mouse microglia at doses ranging from 10 to 100 μM.

Fig. 1. Effects of PNU282987 on Primary Cultured Mouse Microglia

(A) α7 nAChR expression on the plasma membrane of primary cultured mouse microglia was analyzed via flow cytometry. (B, C) The cytotoxicity of PNU282987 (PNU; 10–100 μM) was evaluated via the WST-8 assay (B) and LDH assay (C). The average of the values obtained for the sample with cells lysed using the provided lysate reagent was set to 100% as the high control in the LDH assay. (D) Aβ phagocytosis was analyzed via confocal laser scanning microscopy after treatment with 1-μM fluorescence-labeled Aβ (green) in the presence or absence of PNU (10–100 μM) for 12 h. Primary cultured microglia (red) were visualized using an antibody against the actin cytoskeleton protein. Scale bar, 100 μm. (E) Image analysis was conducted to measure the fluorescence intensity of Aβ per unit area of microglia contained in a single field of view. (F) The amount of extracellular Aβ was measured via ELISA. Data were expressed as mean ± S.E.M. (B, C; n = 3, E; n = 6, F; n = 5–6). The statistical significance of differences among the groups was determined via ANOVA with post hoc Bonferroni’s/Dunn’s test (B, C, and E) and Student’s t-test (F). n.s.: Not significant; (C) ***p = 0.0002 vs. control; (E) *p = 0.0376, **p = 0.0028 vs. control; and (F) *p = 0.0117.

Next, the effect of PNU282987 on the phagocytic function of mouse microglia was analyzed. We treated mouse microglia with fluorescence-labeled Aβ (1 μM) in the presence or absence of PNU282987 (10–100 μM). Laser confocal microscopic analysis revealed that fluorescence-labeled Aβ was internalized into the microglia (Fig. 1D), and that the fluorescence intensity of Aβ per unit area of the microglia was markedly increased by treatment with PNU282987 at a dose of 100 μM (Fig. 1E). In contrast, the amount of Aβ in the conditioned medium was significantly decreased by treatment with PNU282987 at a dose of 100 μM (Fig. 1F). These results suggest that PNU282987 promoted microglial Aβ phagocytosis and decreased extracellular Aβ.

PNU282987 Promotes Aβ Phagocytosis in hiMacs

We further investigated the effects of PNU282987 on hiMacs, which serve as a model for human primitive macrophages as well as mouse microglia. Primitive macrophages are the progenitors of microglia.²⁴⁾ When we examined α7 nAChR expression via flow cytometry, the expression on the cell surface was found to be the same as that of primary cultured mouse microglia (Fig. 2A). We further evaluated the cytotoxicity of PNU282987 in the hiMacs. The WST-8 and LDH assays (Figs. 2B and 2C, respectively) revealed no cytotoxic effects of PNU282987 at doses ranging from 3 to 100 μM.

Fig. 2. Effects of PNU282987 on hiMacs

(A) α7 nAChR expression on the plasma membrane of human-induced pluripotent stem cell-derived primitive macrophages (hiMacs) was analyzed via flow cytometry. (B, C) The cytotoxicity of PNU282987 (PNU; 3–100 μM) was assessed via the WST-8 assay (B) and LDH assay (C). The average of the values obtained for the sample with cells lysed using the provided lysate reagent was set to 100% as the high control in the LDH assay. (D) Aβ phagocytosis was analyzed via confocal laser scanning microscopy after treatment with the hydrochloride salt form of Aβ_1–42 (Aβ) (1 μM) in the presence or absence of PNU (100 μM) for 12 h. Aβ (green) and hiMacs (red) were visualized using antibodies against Aβ and actin cytoskeleton proteins. Scale bar, 100 μm. (E) Image analysis was performed to measure the fluorescence intensity of Aβ per unit area of each hiMacs after treatment with 1 μM Aβ in the presence or absence of PNU (3–100 μM) for 12 h. (F) The amount of extracellular Aβ was measured via ELISA. Data were expressed as mean ± S.E.M. (B; n = 5, C; n = 3–5, E; n = 26–53, F; n = 5–7). The statistical significance of the differences among the groups was determined via ANOVA with post hoc Bonferroni’s/Dunn’s test. n.s.: Not significant; (C) ***p < 0.0001 vs. control,; (E) **p = 0.004, ***p < 0.0001 vs. control; and (F) *p = 0.0439 vs. control.

Next, to analyze the effect of PNU282987 on Aβ phagocytosis, the hiMacs were treated with Aβ (1 μM). Aβ was effectively incorporated by the hiMacs (Fig. 2D), and the Aβ-immunoreactivity (fluorescence intensity) within the hiMacs was significantly increased by treatment with PNU282987 at doses of 30 and 100 μM (Fig. 2E). In contrast, the amount of extracellular Aβ in the conditioned medium of hiMacs was significantly decreased by treatment with PNU282987 at a dose of 100 μM (Fig. 2F). Thus, in the human cell model of microglia using hiMacs, PNU282987 also promoted microglial Aβ phagocytosis to reduce extracellular Aβ.

PNU282987 Attenuates Aβ Accumulation through Microglial Activation in the Brains of AD Mouse Models

Male APdE9 mice aged 18 months were intraperitoneally administered PNU282987 for 2 weeks, and Aβ accumulation in the brains was analyzed via fluorescence immunohistochemistry. Aβ was found to be massively accumulated throughout the brains (Fig. 3A), including the hippocampi (Fig. 3B) and cortex (Fig. 3C). Image analysis revealed that PNU282987 injection significantly reduced the Aβ plaque area in the hemisphere (Fig. 3D), hippocampi (Fig. 3E), and cortex (Fig. 3F). Moreover, ELISA revealed that PNU282987 significantly reduced insoluble Aβ in the FA fraction prepared from the contralateral hemispheres of the brains analyzed by immunohistochemistry, but not soluble Aβ in the TBS fraction (Fig. 3G). In addition, we assessed the microglial coverage on Aβ plaques (Fig. 3H). Image analysis showed that the merged area of immunoreactivities of Aβ and Iba1, a microglia marker, was significantly increased in the brains collected from PNU282987-injected mice compared with PBS-injected control mice. Thus, the results further indicated that PNU282987 promoted microglial Aβ phagocytosis and reduced the amount of accumulated insoluble Aβ in in vivo brains, similar to the in vitro study.

Fig. 3. Effects of PNU282987 on Aβ Accumulation in the Brains of AD Mouse Models

PNU282987 was administered to an AD mouse model (aged 18 months) for 2 weeks via intraperitoneal injection. The hemispheres (A), hippocampi (B), and cortices (C) were immunohistochemically analyzed using an antibody against Aβ (clone 82E1; red) and a nuclear dye (Hoechst 33342, blue). Scale bars, 500 μm. Image analysis was conducted to measure the Aβ plaque area-to-total area ratio in the hemispheres (D), hippocampi (E), and cortices (F). (G) Another set of hemibrains was prepared for ELISA to measure the amount of soluble Aβ (TBS fraction) and insoluble Aβ (FA fraction). (H) To measure the coverage rate of microglia on Aβ plaques, the hemispheres were immunohistochemically analyzed using antibodies against Aβ (clone 82E1; red) and ionized calcium-binding adapter protein 1 (Iba1, a microglia marker; green). Image analysis was conducted to measure the Aβ plaque area and merged area to calculate the coverage rate of microglia on Aβ plaques. Data were expressed as mean ± S.E.M. (D–F, H; n = 9, G; n = 6). The statistical significance of the differences among the groups was determined via ANOVA with Student’s t-test. (D) *p = 0.0327; (E) *p = 0.0376, (F) *p = 0.0486; (G) *p = 0.0149; and (H) *p = 0.0211.

PNU282987 Induces Efferocytosis-Like Activation in hiMacs

To further analyze the effect of PNU282987 on hiMacs, we performed preliminary bulk RNA-sequencing (Supplementary Fig. S1). The data indicated that treatment with PNU282987 induced efferocytosis-like gene expression profiles in hiMacs. Therefore, we further confirmed the expression of efferocytosis-related mRNAs via RT-qPCR and found that treatment with PNU282987, but not Aβ, significantly upregulated the expression of ASAP2, OSM, and THBD in hiMacs (Fig. 4A). The upregulation was induced even in the presence of Aβ.

Fig. 4. Effects of PNU282987 on Efferocytosis-Related Gene Expression and Cytokine Release in the hiMacs

(A) RT-qPCR was performed to analyze the expression of efferocytosis-related genes (ASAP2, OSM, and THBD) after treatment of hiMacs with O-acyl isopeptide Aβ_1–42 (isoAβ; 3 μM) in the presence or absence of PNU282987 (PNU, 100 μM) for 12 h. (B) The amount of cytokines (IL10, IL-1β, and TNF-α) in conditioned media collected from the hiMacs after treatment with isoAβ (3 μM) in the presence or absence of PNU (100 μM) was assessed via ELISA. Data were expressed as mean ± S.E.M. (n = 3). The statistical significance of the differences among the groups was determined via ANOVA with post hoc Bonferroni’s/Dunn’s test. (A) ASAP2, ***p < 0.0001 vs. control, ^†††p < 0.0001 vs. isoAβ; OSM, ***p = 0.0001 (PNU), ***p = 0.0009 (isoAβ + PNU) vs. control, ^††p = 0.0015, ^†††p = 0.0002 vs. isoAβ; THBD, ***p = 0.001 (PNU), ***p = 0.0005 (isoAβ + PNU) vs. control, ^††p = 0.0014, ^†††p = 0.0007 vs. isoAβ,; (B) IL-10, *p = 0.0252, ***p = 0.0008 vs. control, ^†p = 0.0287, ^†††p = 0.0009 vs. isoAβ; IL-1β, ***p < 0.0001 vs. control, ^†††p < 0.0001 (PNU) vs. isoAβ, ^‡‡‡p < 0.0001; TNF-α, ***p < 0.0001 vs. control, ^†††p < 0.0001 (PNU), isoAβ, ^‡‡‡p < 0.0001.

One of the characteristics of efferocytosis is the activation of tissue repair, accompanied by the release of anti-inflammatory cytokines such as IL-10.⁸⁾ Therefore, we measured the level of IL-10, an anti-inflammatory cytokine, in the culture medium of hiMacs via ELISA after treatment with PNU282987 (Fig. 4B). The results indicated that treatment with isoAβ did not increase IL-10 release, whereas treatment with PNU282987 significantly promoted IL-10 release in hiMacs, regardless of the presence of isoAβ. Meanwhile, we further investigated the release of pro-inflammatory cytokines, such as IL-1β and TNF-α (Fig. 4B). While treatment with isoAβ considerably increased the release of IL-1β and TNF-α from hiMacs compared with the control, treatment with PNU282987 alone exerted no effect. Notably, the release of IL-1β was slightly but significantly suppressed by co-treatment of PNU282987 with isoAβ compared with treatment with isoAβ alone. However, the presence of PNU282987 did not influence the release of TNF-α induced by isoAβ. Thus, PNU282987 triggered anti-inflammatory activation by increasing IL-10 production and suppressed isoAβ induced pro-inflammatory activation, reducing IL-1β production in hiMacs.

PNU282987 Attenuates Neurotoxicity of isoAβ and Conditioned Medium Collected from IsoAβ-Treated hiMacs in hiBFChNs

Next, we evaluated the neuroprotective effects of PNU282987 on basal forebrain cholinergic neurons, which are particularly vulnerable in AD brains.²⁵⁾ For this, our differentiation method from hiPSCs toward hiBFChNs was employed¹⁸⁾ (Supplementary Fig. S2). The LDH assay revealed that treatment with isoAβ (3 μM) induced neurotoxicity in hiBFChNs (Fig. 5A). Under neurotoxic conditions induced by isoAβ, PNU282987 protected hiBFChNs at concentrations ranging from 30 to 100 μM. Furthermore, the presence of mecamylamine (10 μM), a subtype-nonselective nAChR antagonist, and methyllycaconitine (10 nM), an α7 nAChR-specific antagonist, prevented neuroprotection by PNU282987 (100 μM) (Fig. 5B). Thus, PNU282987 rescued hiBFChNs against isoAβ neurotoxicity through the α7 nAChR subtype.

Fig. 5. Neuroprotective Effect of PNU282987 against Aβ Neurotoxicity in hiBFChNs

(A) The basal forebrain cholinergic neurons differentiated from hiPSCs (hiBFChNs) were treated with O-acyl isopeptide Aβ_1–42 (isoAβ; 3 μM) in the presence or absence of PNU282987 (PNU; 30–100 μM), and neuronal damage was analyzed via the LDH assay. (B) hiBFChNs were treated with isoAβ (3 μM) in the presence or absence of PNU (100 μM), mecamylamine (Mec, a nAChR-nonselective antagonist; 10 μM), and methyllycaconitine (MLA, a nAChR-selective antagonist; 10 nM), and neuronal damages were analyzed via the LDH assay. (C) hiBFChNs were analyzed via confocal laser scanning microscopy after treatment with isoAβ (3 μM) in the presence or absence of PNU (100 μM). Dendrites (green) and Aβ (red) were visualized using antibodies against MAP2 and Aβ, respectively. Scale bar, 20 μm. The arrowheads indicate damaged dendrites. (D) hiBFChNs were treated with TNF-α (100 ng/mL) in the presence or absence of PNU (100 μM), Mec (10 μM), and MLA (10 nM), and neuronal damage was analyzed via the LDH assay. (E) hiBFChNs were treated with conditioned medium collected from human-induced pluripotent stem cell-derived primitive macrophages (hiMacs) treated with isoAβ (3 μM) in the presence or absence of PNU (100 μM). Data were expressed as mean ± S.E.M. (A; n = 6, B; n = 3–6, D; n = 6, E; n = 9). The statistical significance of the differences among the groups was determined via ANOVA with post hoc Bonferroni’s/Dunn’s test. (A) *p = 0.0109 vs. control, ^†p = 0.0383, ^††p = 0.0077 vs. isoAβ; (B) **p = 0.002, ***p < 0.0001 (isoAβ), ***p = 0.0006 (isoAβ + PNU + Mec) vs. control, ^†††p = 0.0002 vs. isoAβ, ^‡p = 0.011 (isoAβ + PNU + Mec), ^‡p = 0.0431 (isoAβ + PNU + MLA) vs. isoAβ + PNU; (D) ***p < 0.0001 vs. control, ^†p = 0.0122, ^††p = 0.0086, ^†††p < 0.0001 vs. TNF-α, ^‡‡‡p = 0.0004 (TNF-α +PNU + Mec), ^‡‡‡p = 0.0006 (TNF-α + PNU + MLA) vs. TNF-α + PNU; and (E) **p = 0.0012 (isoAβ), **p = 0.0015 (isoAβ + PNU) vs. control, ^†††p < 0.0001 vs. isoAβ. The average of the values obtained for the sample with cells lysed using the provided lysate reagent was set to 100% as the high control in the LDH assay.

To confirm the neuroprotective effect of PNU282987 against isoAβ neurotoxicity, we further examined fluorescence immunocytochemistry and found that the dendrites of hiBFChNs were damaged by treatment with isoAβ (3 μM), forming bead-like structures (Fig. 5C). The aggregated Aβ adhered to the damaged dendrites. In contrast, in the presence of PNU282987 (100 μM), the bead-like structures of the neuronal dendrites decreased, and Aβ aggregation on the dendrites was alleviated (Fig. 5C).

In AD brains, microglia have been suggested to contribute to neuroprotection by Aβ phagocytosis, whereas they may also induce neuroinflammation by releasing inflammatory cytokines such as IL-1β and TNF-α.⁴⁾ In the above assay (Fig. 4B), treatment with isoAβ induced the release of IL-1β and TNF-α from hiMacs, and co-treatment with PNU282987 did not suppress TNF-α production. Therefore, we further attempted to examine the neuroprotective effect of PNU282987 against TNF-α neurotoxicity in hiBFChNs. The LDH assay revealed that treatment with TNF-α (100 ng/μL) induced neurotoxicity in hiBFChNs, whereas treatment with PNU282987 (100 μM) significantly prevented neurotoxicity (Fig. 5D). Moreover, the presence of mecamylamine (10 μM) and methyllycaconitine (10 nM) inhibited neuroprotection by PNU282987 (Fig. 5D). Thus, PNU282987 exerted direct neuroprotective effects against not only isoAβ but also pro-inflammatory factors such as TNF-α via α7 nAChR.

In neuroinflammation caused by Aβ, microglia release various neurotoxic factors, including reactive oxygen species (ROS), nitric oxide, glutamate, and pro-inflammatory cytokines.⁴⁾ Therefore, we further examined the effect of PNU282987 on the release of neurotoxic factors from microglia using a conditioned medium collected from Aβ-treated hiMacs (Fig. 5E). The conditioned medium collected from isoAβ (3 μM)-treated hiMacs showed significant neurotoxicity in hiBFChNs (Fig. 5E). However, the conditioned medium collected from isoAβ-treated hiMacs in the presence of PNU282987 (100 μM) did not exhibit neurotoxicity in hiBFChNs compared with the control (Fig. 5E). Therefore, PNU282987 was found to markedly reduce the neurotoxicity of the conditioned medium by altering the composition of substances secreted from hiMacs treated with isoAβ.

DISCUSSION

In this study, we analyzed the effects of PNU282987 using hiMacs¹⁹⁾ and hiBFChNs¹⁸⁾ as human cell models of microglia and basal forebrain cholinergic neurons, respectively. We also used a mouse model of Aβ accumulation in the brain for the in vivo analysis of PNU282987. Disease mouse models are useful for analyzing in vivo responses and mechanisms in preclinical research; however, there are limitations to their use as models owing to genetic differences between mice and humans. The FDA Modernization Act 2.0 aims to reduce reliance on animal models and address obstacles in drug development by promoting the use of alternatives, such as human cells and organoids.^26,27) In this context, the hiPSC technology is expected to overcome challenges arising from differences between mice and humans and was therefore extensively applied to not only to mouse models but also hiPSC-derived cells in this study.

In the Aβ phagocytosis assay using hiMacs as well as primary cultured mouse microglia, we provide compelling evidence that PNU282987, a selective full agonist of α7 nAChR, markedly enhances the phagocytic activity of microglia, similar to our previous studies using galantamine¹⁵⁾ and DMXBA,¹⁶⁾ a PAM and a selective partial agonist of α7 nAChR, respectively. Thus, the present study proved the promotive effect of α7 nAChR stimulation on microglial Aβ phagocytosis and extracellular Aβ clearance in both the human system and mouse microglia. However, nAChR stimulation by agonists such as nicotine and GST-21 is suggested to increase Aβ production through the activation of β-site Aβ precursor protein-cleaving enzyme-1 in mouse brain and SH-SY5Y cells, a human neuroblastoma cell line.²⁸⁾ Therefore, α7 nAChR activation on neurons and microglia suggests that they exert opposite effects on Aβ metabolism in the brain, namely, Aβ production and degradation systems. In the present study using a mouse model of brain Aβ accumulation, immunohistochemical analysis with an anti-Aβ antibody (clone 82E1), whose epitope is not masked by nAChR agonists,²⁸⁾ and ELISA revealed that PNU282987 actually reduced Aβ accumulation in the brain. Therefore, PNU282987 may have exerted a stronger effect on the Aβ phagocytic activity of microglia in the Aβ metabolism. However, since behavioral tests to analyze cognitive function have not been conducted, this remains an important issue to address in the future.

Efferocytosis is an essential process for tissue homeostasis through the phagocytosis of apoptotic cells and cellular debris, and it includes tissue repair by releasing anti-inflammatory cytokines such as IL-10.²⁹⁾ It has recently been suggested that Aβ clearance is closely associated with efferocytosis by microglia and that the failure of this process is a critical risk factor for AD.^9,10,30) Conversely, functional recovery and the promotion of Aβ clearance, as well as anti-inflammatory processes for the resolution of neuroinflammation by efferocytosis, are attractive targets for AD treatment.¹¹⁾ The present study indicated that PNU282987 promoted not only the intake (phagocytosis) of Aβ by microglia but also the decrease in extracellular Aβ in in vitro and in vivo assays. Furthermore, treatment of hiMacs with PNU282987 increased the release of the anti-inflammatory cytokine IL-10, with slight suppression of the release of the pro-inflammatory cytokine IL-1β induced by treatment with isoAβ. Therefore, it can be inferred that PNU282987 converts Aβ uptake, which induces pro-inflammatory phagocytosis, into efferocytosis-like anti-inflammatory uptake. In fact, efferocytosis-related genes such as ASAP2, OSM, and THBD were upregulated by treatment of hiMacs with PNU282987 even in the presence of Aβ.

ASAP2, an ADP-ribosylation factor GTPase-activating protein, activates ARF6,³¹⁾ which, in turn, activates Rac1.³²⁾ ARF6 and Rac1, both small GTPases, regulate actin assembly, which is critical for phagocytosis in macrophages.^33,34) Rac1 also activates the Wiskott–Aldrich syndrome protein family verprolin-homologous protein (WAVE),³⁵⁾ and the WAVE activity has been reported to be involved in Aβ phagocytosis by microglia.³⁶⁾ Thus, PNU282987 may enhance microglial Aβ phagocytosis as part of the efferocytosis-like function through the upregulation of ASAP2. In addition, Rac1 is well known to promote the internalization of IgG-opsonized targets through Fcγ receptors.³⁷⁾ The primary mechanism by which anti-Aβ antibodies promote Aβ clearance in the brain is phagocytosis of anti-Aβ antibody–Aβ complexes through Fcγ receptors by microglia.³⁸⁾ Therefore, the combination of drugs that enhance ASAP2 expression, such as PNU282987, may synergistically enhance the therapeutic effects of anti-Aβ antibodies that are currently in clinical use.

Oncostatin M (OSM) is a cytokine belonging to the IL-6 superfamily and is suggested to be involved in the anti-inflammatory (M2) polarization of macrophages.^39,40) This process may involve molecular mechanisms through the mammalian target of rapamycin complex 2/Akt1 signaling pathway.⁴¹⁾ THBD encodes thrombomodulin (TM), and TM is shown to induce the transition of macrophages from the pro-inflammatory state (M1) to M2, including IL-10 expression, via activation of the IL-4R/c-Myc/pSTAT6/PPARγ pathway⁴²⁾ and inhibition of the ERK/HIF-1α pathway in macrophages.⁴³⁾ Therefore, the release of OSM and TM from microglia after treatment with PNU282987 may confer anti-inflammatory activation, an important aspect of efferocytosis beyond simply promoting phagocytosis, through an autocrine mechanism. Taken together, PNU282987 is considered to convert Aβ-induced inflammatory phagocytosis into efferocytosis-like anti-inflammatory phagocytosis in the microglia. On the other hand, the narrow definition of efferocytosis includes the removal of apoptotic cells and cellular debris, which is also an important factor in neuroprotection against AD. Therefore, to demonstrate the further usefulness of selective stimulation of α7 nAChR, analysis of whether PNU28298 promotes the clearance of apoptotic cells and cellular debris in hiMacs, along with promotion of Aβ clearance and anti-inflammatory activation, will be important in future studies.

Besides the microglial involvement in AD pathophysiology, basal forebrain cholinergic neurons play a critical role in cognitive function,⁴⁴⁾ and atrophy of the basal forebrain is already detected in mild cognitive decline, which is considered to be a potential precursor to AD.⁴⁵⁾ Thus, degeneration of cholinergic neurons in the basal forebrain is induced from the early stages of AD and is closely associated with cognitive impairment. In the present study, PNU282987 exerted significant neuroprotective effects on hiBFChNs against Aβ-induced neurotoxicity through α7 nAChR. nAChR stimulation by nicotine has long been shown to protect rat cortical neurons against Aβ_25–35 neurotoxicity.⁴⁶⁾ A recent study has confirmed the neuroprotective effect of nAChR stimulation with acetylcholine on rat hippocampal neurons, suggesting that the mechanism involves activation of the phosphatidylinositol 3-kinase (PI3K)/Akt and Nrf2/keap1 pathways.⁴⁷⁾ Neuroprotection by PNU282987 has also been reported to activate the PI3K/Akt pathway, which suppresses proapoptotic caspase 3 activation, in a rat model of subarachnoid hemorrhage.⁴⁸⁾

In the present study, PNU282987 also directly protected hiBFChNs from neurotoxicity induced by TNF-α. TNF-α is released from Aβ-activated microglia and exhibits neurotoxicity through the autocrine release of glutamate from neurons.⁴⁹⁾ Moreover, Aβ-activated microglia release glutamate.^50,51) Thus, Aβ neurotoxicity is closely associated with glutamate neurotoxicity. In contrast, nicotine treatment protected rat cortical neurons against Aβ-enhanced glutamate neurotoxicity via activation of α7 nAChR, followed by PI3K/Akt/Bcl2 signaling,⁵²⁾ whereas PNU282987 has also been reported to protect rat retinal neurons from glutamate-induced excitotoxicity.⁵³⁾ Therefore, the neuroprotective effect of PNU282987 against TNF-α may be associated with neuroprotection against glutamate toxicity. Furthermore, even when considering neuroinflammation mediated by microglia, this strongly suggests the potential efficacy of PNU282987 against AD.

Aβ-activated microglia release several neurotoxic factors, not only pro-inflammatory cytokines and glutamate but also ROS and nitric oxide.^50,51) Consistent with previous reports, the conditioned medium collected from Aβ-treated hiMacs exhibited strong neurotoxicity in the present study. However, in the simultaneous treatment with isoAβ and PNU282987, the conditioned medium did not show neurotoxicity compared with the control. This may include IL-1β suppression and promotion of the release of IL-10, as demonstrated in the present study. Furthermore, heme oxygenase-1 induction following the activation of the Jak2/PI3K/Akt cascades induced by PNU282987 has been suggested as the antioxidant mechanism against ROS. Therefore, the total effects of PNU282987 on the microglia through α7 nAChR activation may contribute to neuroprotection. As regards the direct and indirect neuroprotective effects of PNU28298, activation of the PI3K/Akt cascade through α7 nAChR stimulation is a potentially critical pathway. However, further research is needed to elucidate the details. In addition, PNU282987 acted on hiMacs at a relatively high concentration of 100 μM. It is also known that selective agonists of α7 nicotinic receptors simultaneously inhibit serotonin 5-HT₃ receptors.⁵⁴⁾ Since serotonin receptor agonists were not present in the hiMacs culture medium in the present experiment, we, therefore, believe that the effect of PNU282987 may be induced via α7 nAChR in hiMacs. However, to draw a conclusion, future analyses using α7 nAChR inhibitors or α7 knockout hiPSCs are necessary.

In the present study, we utilized a human cell model system using hiPSCs to analyze the effects of PNU282987 on microglia and basal forebrain cholinergic neurons under the pathophysiological condition of AD. The results indicated that PNU282987 induced an efferocytosis-like phagocytic function and an anti-inflammatory activation in the microglia via α7 nAChRs. PNU282987 further acted directly on neurons to exert neuroprotective effects against Aβ and TNF-α. Moreover, PNU282987 changed the extracellular contents released from the microglia and attenuated the neurotoxicity of the conditioned medium collected from Aβ-activated microglia. Thus, the full agonists of α7 nAChR, which could reduce Aβ burden, suppress neuroinflammation, and directly protect neurons, show the capacity to address multiple pathological aspects of AD and are promising therapeutic candidates for AD treatment. Therefore, it is also essential to elucidate the mechanisms underlying the neuroprotective effects of various α7 nAChR full agonists, including their safety profiles.

Acknowledgments

M.S. is a student of the Soroptimist Japan Foundation Scholarship, and K.H. is a student of the Nagai Memorial Research Scholarship from the Pharmaceutical Society of Japan. This study was supported in part by grants from the Japan Society for the Promotion of Science (JSPS; KAKEN: 20H03569 to K.T.), the Kobayashi Foundation (K.T.), the Shimizu Foundation for Immunology and Neuroscience (K.T.), the Kyoto Pharmaceutical University Fund for Collaborative Research (K.T.), and the Smoking Research Foundation (K.T.).

Conflict of Interest

The authors declare no conflict of interest.

Data Availability

The datasets produced in this study (Supplementary Fig. S1) are available in the Gene Expression Omnibus (RNA-Seq data: GSE295886).

Supplementary Materials

This article contains supplementary materials.

REFERENCES

• 1)  Selkoe DJ, Hardy J. The amyloid hypothesis of Alzheimer’s disease at 25 years. EMBO Mol. Med., 8, 595–608 (2016).
• 2)  Tolar M, Hey J, Power A, Abushakra S. Neurotoxic soluble amyloid oligomers drive Alzheimer’s pathogenesis and represent a clinically validated target for slowing disease progression. Int. J. Mol. Sci., 22, 6355 (2021).
• 3)  Feng W, Zhang Y, Wang Z, Xu H, Wu T, Marshall C, Gao J, Xiao M. Microglia prevent beta-amyloid plaque formation in the early stage of an Alzheimer’s disease mouse model with suppression of glymphatic clearance. Alzheimers Res. Ther., 12, 125 (2020).
• 4)  Takata K, Ginhoux F, Shimohama S. Roles of microglia in Alzheimer’s disease and impact of new findings on microglial heterogeneity as a target for therapeutic intervention. Biochem. Pharmacol., 192, 114754 (2021).
• 5)  He C, Chen B, Yang H, Zhou X. The dual role of microglia in Alzheimer’s disease: from immune regulation to pathological progression. Front. Aging Neurosci., 17, 1554398 (2025).
• 6)  Deczkowska A, Keren-Shaul K, Weiner A, Colonna M, Schwartz M, Amit I. Disease-associated microglia: a universal immune sensor of neurodegeneration. Cell, 173, 1073–1081 (2018).
• 7)  Masuda T, Sankowski R, Staszewski O, Prinz M. Microglia heterogeneity in the single-cell era. Cell Rep., 30, 1271–1281 (2020).
• 8)  Boada-Romero E, Martinez J, Heckmann BL, Green DR. The clearance of dead cells by efferocytosis. Nat. Rev. Mol. Cell Biol., 21, 398–414 (2020).
• 9)  Tajbakhsh A, Read M, Barreto GE, Ávila-Rodriguez M, Gheibi-Hayat SM, Sahebkar A. Apoptotic neurons and amyloid-beta clearance by phagocytosis in Alzheimer’s disease: pathological mechanisms and therapeutic outlooks. Eur. J. Pharmacol., 895, 173873 (2021).
• 10)  Andrews SJ, Renton AE, Fulton-Howard B, Podlesny-Drabiniok A, Marcora E, Goate AM. The complex genetic architecture of Alzheimer’s disease: novel insights and future directions. eBioMedicin, 90, 104511 (2023).
• 11)  Chen Y, Kou Y, Ni Y, Yang H, Xu C, Fan H, Liu H. Microglia efferocytosis: an emerging mechanism for the resolution of neuroinflammation in Alzheimer’s disease. J. Neuroinflammation, 22, 96 (2025).
• 12)  Breese CR, Adams C, Logel J, Drebing C, Rollins Y, Barnhart M, Sullivan B, Demasters BK, Freedman R, Leonard S. Comparison of the regional expression of nicotinic acetylcholine receptor α7 mRNA and [¹²⁵I]-α-bungarotoxin binding in human postmortem brain. J. Comp. Neurol., 387, 385–398 (1997).
• 13)  Court JA, Martin-Ruiz C, Graham A, Perry E. Nicotinic receptors in human brain: topography and pathology. J. Chem. Neuroanat., 20, 281–298 (2000).
• 14)  Conejero-Goldberg C, Davles P, Ulloa L. Alpha7 nicotinic acetylcholine receptor: a link between inflammation and neurodegeneration. Neurosci. Biobehav. Rev., 32, 693–706 (2008).
• 15)  Takata K, Kitamura Y, Saeki M, Terada M, Kagitani S, Kitamura R, Fujikawa Y, Maelicke A, Tomimoto H, Taniguchi T, Shimohama S. Galantamine-induced amyloid-β clearance mediated via stimulation of microglial nicotinic acetylcholine receptors. J. Biol. Chem., 285, 40180–40191 (2010).
• 16)  Takata K, Kitamura Y, Saeki M, Terada M, Kagitani S, Kitamura R, Fujikawa Y, Maelicke A, Tomimoto H, Taniguchi T, Shimohama S. Alpha7 nicotinic acetylcholine receptor-specific agonist DMXBA (GTS-21) attenuates Aβ accumulation through suppression of neuronal γ-secretase activity and promotion of microglial amyloid-β phagocytosis and ameliorates cognitive impairment in a mouse model of Alzheimer’s disease. Neurobiol. Aging., 62, 197–209 (2018).
• 17)  Nakagawa M, Taniguchi Y, Senda S, Takizawa N, Ichisaka T, Asano K, Morizane A, Doi D, Takahashi J, Nishizawa M, Yoshida Y, Toyoda T, Osafune K, Sekiguchi K, Yamanaka S. A novel efficient feeder-free culture system for the derivation of human induced pluripotent stem cells. Sci. Rep., 4, 3594 (2014).
• 18)  Fukuda A, Nakashima S, Oda Y, Nishimura K, Kawashima H, Kimura H, Ohgita T, Kawashita E, Ishihara K, Hanaki A, Okazaki M, Matsuda E, Tanaka Y, Nakamura S, Matsumoto T, Akiba S, Saito H, Matsuda H, Takata K. Plantainoside B in Bacopa monniera binds to Aβ aggregates attenuating neuronal damage and memory deficits induced by Aβ. Biol. Pharm. Bull., 46, 320–333 (2023).
• 19)  Takata K, Kozaki T, Lee CZW, et al. Induced-pluripotent-stem-cell-derived primitive macrophages provide a platform for modeling tissue-resident macrophage differentiation and function. Immunity, 47, 183–198.e6 (2017).
• 20)  Takata K, Nishimura K, Harada H, Iwasaki R, Ando M, Yamada S, Ginhoux F, Takata K. Analysis of Aβ-induced neurotoxicity and microglial responses in simple two- and three-dimensional human iPSC-derived cortical culture systems. Tissue Cell, 81, 102023 (2023).
• 21)  Sohma Y, Hirayama Y, Taniguchi A, Mukai H, Kiso Y. ‘Click peptide’ using production of monomer A β from the O-acyl isopeptide: application to assay system of aggregation inhibitors and cellular cytotoxicity. Bioorg. Med. Chem., 19, 1729–1733 (2011).
• 22)  Taniguchi A, Sohma Y, Hirayama Y, Mukai H, Kimura T, Hayashi Y, Matsuzaki K, Kiso Y. “Click peptide”: pH-triggered in situ production and aggregation of monomer Aβ1-42. ChemBioChem, 10, 710–715 (2009).
• 23)  Jankowsky JL, Fadale DJ, Anderson J, Xu GM, Gonzales V, Jenkins NA, Copeland NG, Lee MK, Younkin LH, Wagner SL, Younkin SG, Borchelt DR. Mutant presenilins specifically elevate the levels of the 42 residue β-amyloid peptide in vivo: evidence for augmentation of a 42-specific γ secretase, Hum. Mol. Genet., 12, 159–170 (2024).
• 24)  Ginhoux F, Greter M, Leboeuf M, Nandi S, See P, Gokhan S, Mehler MF, Conway SJ, Ng LG, Stanley ER, Samokhvalov IM, Merad M. Fate mapping analysis reveals that adult microglia derive from primitive macrophages. Science, 330, 841–845 (2010).
• 25)  Giacobini E, Cuello AC, Fisher A. Reimagining cholinergic therapy for Alzheimer’s disease. Brain, 145, 2250–2275 (2022).
• 26)  Wadman M. FDA no longer needs to require animal tests before human drug trials. Science, 379, 127–128 (2023).
• 27)  Zushin PJH, Mukherjee S, Wu JC. FDA Modernization Act 2.0: transitioning beyond animal models with human cells, organoids, and AI/ML-based approaches. J. Clin. Invest., 133, e175824 (2023).
• 28)  Nakano M, Tsuchida T, Mitsuishi Y, Nishimura M. Nicotinic acetylcholine receptor activation induces BACE1 transcription via the phosphorylation and stabilization of nuclear SP1. Neurosci. Res., 203, 28–41 (2024).
• 29)  Doran AC, Yurdagul A Jr, Tabas I. Efferocytosis in health and disease. Nat. Rev. Immunol., 20, 254–267 (2020).
• 30)  Romero-Molina C, Garretti F, Andrews SJ, Marcora E, Goate AM. Microglial efferocytosis: diving into the Alzheimer’s disease gene pool. Neuron, 110, 3513–3533 (2022).
• 31)  Tanna CE, Goss LB, Ludwig CG, Chen PW. Arf GAPs as regulators of the actin cytoskeleton—an update. Int. J. Mol. Sci., 20, 442 (2019).
• 32)  Chan WWR, Li W, Chang RCC, Lau KF. ARF6-Rac1 signaling-mediated neurite outgrowth is potentiated by the neuronal adaptor FE65 through orchestrating ARF6 and ELMO1. FASEB J., 34, 16397–16413 (2020).
• 33)  Niedergang F, Colucci-Guyon E, Dubois T, Raposo G, Chavrier P. ADP ribosylation factor 6 is activated and controls membrane delivery during phagocytosis in macrophages. J. Cell Biol., 161, 1143–1150 (2003).
• 34)  Van Acker T, Tavernier J, Peelman F. The Small GTPase Arf6: an overview of its mechanisms of action and of its role in host-pathogen interactions and innate immunity. Int. J. Mol. Sci., 20, 2209 (2019).
• 35)  Miki H, Suetsugu S, Takenawa T. WAVE, a novel WASP-family protein involved in actin reorganization induced by Rac. EMBO J., 17, 6932–6941 (1998).
• 36)  Kitamura Y, Shibagaki K, Takata K, Tsuchiya D, Taniguchi T, Gebicke-Haerter PJ, Miki H, Takenawa T, Shimohama S. Involvement of Wiskott-Aldrich syndrome protein family verprolinhomologous protein (WAVE) and Rac1 in the phagocytosis of amyloid-β (1–42) in rat microglia. J. Pharmacol. Sci., 92, 115–123 (2003).
• 37)  Ikeda Y, Kawai K, Ikawa A, Kawamoto K, Egami Y, Araki N. Rac1 switching at the right time and location is essential for Fcγ receptor-mediated phagosome formation. J. Cell Sci., 130, 2530–2540 (2017).
• 38)  Takata K, Kitamura Y, Yanagisawa D, Morikawa S, Morita M, Inubushi T, Tsuchiya D, Chishiro S, Saeki M, Taniguchi T, Shimohama S, Tooyama I. Microglial transplantation increases amyloid-β clearance in Alzheimer model rats. FEBS Lett., 581, 475–478 (2007).
• 39)  Botelho F, Dubey A, Ayaub EA, Park R, Yip A, Humbles A, Kolbeck R, Richards CD. 1IL-33 mediates lung inflammation by the IL-6-type cytokine oncostatin M. Mediators Inflamm., 28, 4087315 (2020).
• 40)  Yuan Y, Zhang Q, Wu B, Huang T, Gong P, Xiang L. Oncostatin M regulates macrophages polarization in osseointegration via yes-associated protein. Int. Immunopharmacol., 120, 110348 (2023).
• 41)  Shrivastava R, Asif M, Singh V, Dubey P, Ahmad Malik S, Lone MUD, Tewari BN, Baghel KS, Pal S, Nagar GK, Chattopadhyay N, Bhadauria S. M2 polarization of macrophages by Oncostatin M in hypoxic tumor microenvironment is mediated by mTORC2 and promotes tumor growth and metastasis. Cytokine, 118, 130–143 (2019).
• 42)  Huang TC, Wu HL, Chen SH, Wang YT, Wu CC. Thrombomodulin facilitates peripheral nerve regeneration through regulating M1/M2 switching. J. Neuroinflammation, 17, 240 (2020).
• 43)  Chang CH, Peng IC, Huang YH. Recombinant thrombomodulin domain 1 modulates macrophage polarization and enhances healing in corneal alkali burns. Invest. Ophthalmol. Vis. Sci., 66, 21 (2025).
• 44)  Ballinger EC, Ananth M, Talmage DA, Role LW. Basal forebrain cholinergic circuits and signaling in cognition and cognitive decline. Neuron, 91, 1199–1218 (2016).
• 45)  Grothe M, Heinsen H, Teipel SJ. Atrophy of the cholinergic basal forebrain over the adult age range and in early stages of Alzheimer’s disease. Biol. Psychiatry, 71, 805–813 (2012).
• 46)  Kihara T, Shimohama S, Sawada H, Kimura J, Kume T, Kochiyama H, Maeda T, Akaike A. Nicotinic receptor stimulation protects neurons against β-amyloid toxicity. Ann. Neurol., 42, 159–163 (1997).
• 47)  Guo J, Yang G, He Y, Xu H, Fan H, An J, Zhang L, Zhang R, Cao G, Hao D, Yang H. Involvement of α7nAChR in the protective effects of genistein against β-amyloid-induced oxidative stress in neurons via a PI3K/Akt/Nrf2 pathway-related mechanism. Cell. Mol. Neurobiol., 41, 377–393 (2021).
• 48)  Duris K, Manaenko A, Suzuki H, Rolland WB, Krafft PR, Zhang JH. α7 Nicotinic acetylcholine receptor agonist PNU-282987 attenuates early brain injury in a perforation model of subarachnoid hemorrhage in rats. Stroke, 42, 3530–3536 (2011).
• 49)  Ye L, Huang Y, Zhao L, Li Y, Sun L, Zhou Y, Qian G, Zheng JC. Iβ and TNF-α induce neurotoxicity through glutamate production: a potential role for neuronal glutaminase. J. Neurochem., 125, 897–908 (2013).
• 50)  Noda M, Nakanishi H, Akaike N. Glutamate release from microglia via glutamate transporter is enhanced by amyloid-beta peptide. Neuroscience, 92, 1465–1474 (1999).
• 51)  Wu Z, Tang W, Ibrahim FEEM, Chen X, Yan H, Tao C, Wang Z, Guo Y, Fu Y, Wang Q, Ge Y. Aβ induces neuroinflammation and microglial M1 polarization via cGAS-STING-IFITM3 signaling pathway in BV-2 cells. Neurochem. Res., 48, 2881–2894 (2023).
• 52)  Kihara T, Shimohama S, Sawada H, Honda K, Nakamizo T, Shibasaki H, Kume T, Akaike A. Alpha7 Nicotinic receptor transduces signals to phosphatidylinositol 3-kinase to block Aβ-amyloid-induced neurotoxicity. J. Biol. Chem., 276, 13541–13546 (2001).
• 53)  Iwamoto K, Mata D, Linn DM, Linn CL. Neuroprotection of rat retinal ganglion cells mediated through alpha7 nicotinic acetylcholine receptors. Neuroscience, 237, 184–198 (2013).
• 54)  Bertrand D, Lee CHL, Flood D, Marger F, Donnelly-Roberts D. Therapeutic potential of α7 nicotinic acetylcholine receptors. Pharmacol. Rev., 67, 1025–1073 (2015).