Kaempferol Inhibits Ferroptosis in Lung Epithelial Cells in LPS-Induced Acute Lung Injury via m5C Methylation of TFRC

Abstract

Ferroptosis is involved in the progression of sepsis-induced acute lung injury (ALI). Kaempferol is a flavonoid compound that can protect against ALI. 5-Methylcytosine (m5C) is involved in the pathogenesis of sepsis. This study aimed to investigate the impact of kaempferol on ferroptosis and the underlying mechanism, focusing on m5C methylation. MLE-12 cells were exposed to lipopolysaccharide (LPS) to induce cell injury, and treated with kaempferol to assess ferroptosis by detecting ferrous, glutathione, malonaldehyde, and lipid-reactive oxygen species levels using commercial kits. m5C methylation was assessed using dot blot, RNA immunoprecipitation, dual-luciferase reporter analysis, and RNA stability assay. The results showed that kaempferol inhibited ferroptosis in LPS-induced cells and NOP2/Sun RNA methyltransferase family member 7 (NSUN7)-mediated m5C modification levels. Overexpression of NSUN7 reversed the inhibition of ferroptosis caused by kaempferol. Moreover, NSUN7 knockdown reduced transferrin receptor (TFRC) stability by suppressing its m5C methylation, and TFRC overexpression promoted ferroptosis in cells with NSUN7 downregulation. In conclusion, kaempferol inhibits ferroptosis in lung epithelial cells by suppressing NSUN7-mediated m5C methylation of TFRC. These findings suggest that kaempferol and targeting m5C methylation may be used for the treatment of sepsis-induced ALI.

INTRODUCTION

Sepsis is a systemic inflammatory response to infection. It causes multiple organ dysfunction and is a leading cause of death.^1,2) Lung injury is one of the most worrying complications of sepsis, including acute lung injury (ALI) and acute respiratory distress syndrome (ARDS).³⁾ The pathogenesis of sepsis-ALI is complex. Recently, ferroptosis has been found to be implicated in sepsis-ALI, and inhibition of ferroptosis contributes to protecting the lung from sepsis-induced damage.⁴⁾ Ferroptosis is an iron-dependent programmed cell death characterized by lipid peroxidation, which plays a role in the progression of multiple diseases.⁵⁾ Iron accumulation can be seen in the lower respiratory tract of patients with ALI, leading to iron metabolism disorders, affecting normal cellular function, and further exacerbating lung damage.⁶⁾ Therefore, exploring the involvement of ferroptosis in ALI may provide new ideas for the treatment of the disease.

Kaempferol is a widely studied flavonoid that serves as an anti-bacterial, anti-fungal, anti-tumor, and anti-inflammatory agent.⁷⁾ Growing evidence has revealed that kaempferol is a promising candidate drug for the treatment of several diseases, such as atherosclerosis, Alzheimer’s disease, and diabetes.^8–10) A previous study has reported that kaempferol improves the survival rate of septic mice by exerting its anti-inflammatory and anti-oxidant activities.¹¹⁾ Moreover, kaempferol possesses the effect of alleviating ALI caused by sepsis.¹²⁾ However, little is known about the molecular mechanisms underlying the action of kaempferol in ALI.

RNA modification is associated with human biological processes and diseases.¹³⁾ 5-Methylcytosine (m5C) is a type of RNA modification that affects the export, stability, and translation of mRNA, noncoding RNA, transfer RNA, and ribosomal RNA.¹⁴⁾ Growing evidence has demonstrated that m5C modification is regulated by methyltransferases (NOL1/NOP2/SUN domain [NSUN] family and DNA methyltransferase-2), demethylases (ten-eleven translocation family and AlkB homolog 1), and the binding proteins (Aly/REF export factor and Y-box binding protein 1 [YBX1]).¹⁵⁾ The NSUN family consists of 7 members, NSUN1–7, which promote m5C methylation to affect various biological functions such as embryogenesis, proliferation, inflammation, differentiation, and senescence.^16,17) A previous study has indicated that aberrant m5C methylation contributes to the pathogenesis of sepsis. The NOP2/Sun RNA methyltransferase family members NSUN7/NSUN3/NSUN5/NSUN6 are highly expressed in sepsis. Among them, NSUN7 acts as a biomarker for the diagnosis of sepsis.¹⁸⁾ Hence, it is necessary to further elucidate the role and regulatory mechanisms of m5C methylation in sepsis and sepsis-induced ALI, so as to provide new insights into the pathogenesis and development of the disease.

In this study, we investigated the impact of kaempferol on ferroptosis and its molecular mechanism using in vitro experiments, mainly focusing on its regulation of m5C methylation. This study may provide new insights into the pathogenesis of sepsis-ALI and theoretical support for the use of kaempferol in the treatment of this disease.

MATERIALS AND METHODS

Cell Culture

A mouse lung epithelial cell line (MLE-12) was purchased from the American Type Culture Collection (ATCC, Manassas, VA, U.S.A.). All the cells were maintained in the specific cell culture medium (Procell, Wuhan, China) at 37°C with 5% CO₂ and 95% air.

Cell Counting Kit-8 (CCK-8)

The cells were plated into 96-well plates and cultured to the logarithmic growth stage. Lipopolysaccharide (LPS; 1 μg/mL; Solarbio, Beijing, China) was used to treat the cells for 24 h. Different concentrations of kaempferol (10, 20, and 40 μM; purity ≥98%; Solarbio; Fig. 1A) were used to treat the cells for 24 h before LPS treatment. To confirm the role of ferroptosis, the cells were treated with 5 μM ferrostatin-1 (Fer-1; Solarbio) while being treated with LPS. After LPS and Fer-1 or kaempferol stimulation, the cells were incubated with 10 μL of CCK-8 reagent (Dojindo, Kumamoto, Japan) at 37°C. After 4 h of incubation, the absorbance was measured at 450 nm using a microplate reader (Thermo Fisher Scientific, Waltham, MA, U.S.A.).

Fig. 1. Kaempferol Inhibits LPS-Induced Ferroptosis in MLE-12 Cells

(A) The chemical structure of kaempferol. After MLE-12 cells were exposed to LPS and 10, 20, and 40 μM kaempferol, (B) cell viability was measured by CCK-8; ferroptosis indexes, including (C) Fe²⁺, (D) GSH, (E) MDA, and (F) lipid ROS, were determined using their commercial kits. p < 0.05 was considered statistically significant. NS: no significance.

Determination of Ferrous (Fe²⁺) Levels

Fe²⁺ levels were measured using the iron assay kit (Abcam, Cambridge, MA, U.S.A.). The samples were incubated with 5 μL of assay buffer at 37°C for 30 min, followed by incubation with 100 μL of iron probe at 37°C for 60 min. The absorbance was measured at 593 nm using a microplate reader.

Determination of Glutathione (GSH) Levels

The levels of reduced GSH were measured using a GSH assay kit (Leagene, Beijing, China). Cells were washed with phosphate-buffered saline), mixed with GSH extract solution for 5 min on ice, and then centrifuged at 4000 × g for 20 min. The supernatant (0.1 mL) was collected and incubated with GSH assay buffer (0.1 mL) and 5,5′-Dithiobis-(2-nitrobenzoic acid) color development solution (0.05 mL). The absorbance at 412 nm was measured using a microplate reader.

Measurement of Malonaldehyde (MDA) Content

MDA levels were measured using the MDA assay kit (thiobarbituric acid colorimetric method; Leagene). Cells were lysed using radio immunoprecipitation assay (RIPA) buffer. The supernatant was collected following centrifugation at 12000 × g for 10 min. The supernatant (0.08 mL) was boiled with the MDA working solution (3 mL) for 40 min. After cooling to room temperature, the samples were centrifuged at 1000 × g for 1 min, and the absorbance was measured at 535 nm using a microplate reader.

Assessment of Lipid-Reactive Oxygen Species (ROS) Content

The single-cell suspension was incubated with a C11 BODIPY 581/591 probe (MCE, Monmouth Junction, NJ, U.S.A.) at room temperature for 30 min and then centrifuged at 4°C, 400 × g for 4 min. The fluorescence was detected using a fluorescence microscope (Nikon, Tokyo, Japan).

Quantitative Real-Time PCR (qPCR)

Total RNA was extracted from cultured cells using TRIzol reagent (Invitrogen, Carlsbad, CA, U.S.A.). After that, RNA concentration was measured using a NanoDrop One/OneC ultramicro-UV spectrophotometer (Thermo Fisher Scientific). RNA integrity was visualized by agarose gel electrophoresis. RT was conducted using the HiScript RT SuperMix for qPCR (Vazyme, Nanjing, China). qPCR was performed using ChamQ Universal SYBR qPCR Master Mix (Vazyme). mRNA expression was calculated by the 2^−ΔΔCt method. β-Actin acted as the internal control. The primer sequences are listed in Table 1.

Table 1. Primers Sequences Used for qPCR

Name	Forward (5′–3′)	Reverse (5′–3′)
NSUN2	AGGTGGCTATCCCGAGATCG	GACTCCATGAATTGGTCCCATT
NSUN3	CTGACTCGGCTGAAAGCAAAA	CCCTTACTGTACTCCAGGAATCC
NSUN4	TGGGATAGTGTGAGTGCTAAGC	AAGCATCGAAGATTTGGGCTG
NSUN5	CTGAAGCAGTTGTACGCTCTG	CCCTTCCCCAGCAATAATTCAT
NSUN6	AAGACAACAGGGTGAAGTGATTG	TCCATCAAATTCTTTGGCTCCTT
NSUN7	TGGACCCAACGAGTGAAAGG	GTATTGGCGACTACATCCCCC
ACSL4	CTCACCATTATATTGCTGCCTGT	TCTCTTTGCCATAGCGTTTTTCT
GPX4	GCCTGGATAAGTACAGGGGTT	CATGCAGATCGACTAGCTGAG
SLC7A11	AGGGCATACTCCAGAACACG	GGACCAAAGACCTCCAGAATG
TFRC	GTTTCTGCCAGCCCCTTATTAT	GCAAGGAAAGGATATGCAGCA
β-Actin	GGCTGTATTCCCCTCCATCG	CCAGTTGGTAACAATGCCATGT

m5C Dot Blot

Total RNA (1.8 μg) was loaded onto the membranes, which were crosslinked using UV rays (254 nm; 1 min). The membranes were blocked with 5% non-fat milk at room temperature for 1 h. Subsequently, the membranes were incubated with anti-m5C antibody (ab10805; Abcam) overnight at 4°C, and then incubated with rabbit anti-mouse IgG at room temperature for 1.5 h. The dot blots were visualized using an enhanced chemiluminescence kit (Thermo Fisher Scientific).

Molecular Docking

Kaempferol structure was downloaded from the PubChem Database. The format was transformed, and the energy was minimized using Chem3D. The NSUN7 structure was downloaded from the Research Collaboratory for Structural Bioinformatics Protein Data Bank database. Crystal water was removed, hydrogen atoms were added, and energy was minimized using the Maestro 11.9 platform. Docking was carried out using the Glide module in the Schrӧdinger Maestro software. Visual analysis was performed using the PyMOL 2.1 software.

Cell Transfection

Transferrin receptor (TFRC)-overexpressing vector (the full-length open-reading frame of the TFRC gene was inserted into the pcDNA3.1 vector), NSUN7-overexpressing vector (the full-length open-reading frame of the NSUN7 gene was inserted into the pcDNA3.1 vector), empty vector (pcDNA3.1), NSUN7 short hairpin RNA (shNSUN7, 5′-GTTCTGTTTCTAAAGAGGAAA-3′), and shNC (5′-CCTAAGGTTAAGTCGCCCTCG-3′) were acquired from GenePharma (Shanghai, China). MLE-12 cells were seeded into 6-well plates and transfected with these plasmids using Lipofectamine 2000 (Invitrogen). After 48 h, the cells were harvested.

Western Blot

Proteins were isolated from MLE-12 cells using RIPA buffer and separated using 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis. After transferring the proteins onto polyvinylidene fluoride membranes, the membranes were blocked with 5% skim milk. The membranes were incubated with anti-NSUN7 (17546-1-AP; Proteintech, Wuhan, China) at 4°C overnight, and then incubated with goat anti-rabbit IgG (SA00001-2; Proteintech) at room temperature for 1 h. The bands were visualized using the West Pico ECL substrate (Solarbio).

RNA Immunoprecipitation (RIP) and m5C RIP

The interaction between NSUN7 and TFRC was confirmed using the BeyoRI RIP assay kit (Beyotime, Shanghai, China). Briefly, protein A/G agarose beads were washed with wash buffer 3 times and incubated with anti-IgG and anti-NSUN7 antibodies at 4°C for 4 h. The cells were lysed on ice using the lysis buffer for 10 min and immunoprecipitated with antibody-combined beads at 4°C for 4 h. After elution, qPCR was performed to measure TFRC expression.

For m5C RIP, except for replacing the anti-NSUN7 antibody with the anti-m5C antibody, the other steps were the same as in the RIP experiment. Finally, qPCR was conducted to measure acyl-CoA synthetase long chain family member 4 (ACSL4), glutathione peroxidase 4 (GPX4), solute carrier family 7 member 11 (SLC7A11), and TFRC expression.

Dual-Luciferase Reporter Analysis

Potential m5C sites in TFRC were predicted by the RNAm5C finder tool (http://www.rnanut.net/rnam5cfinder/) using its mRNA sequence (accession version: NM_001357298.1). TFRC wild-type (WT) sequences and the mutant sequences targeting m5C sites (mutated sequence 1 containing GGATTTGAA sequences [2136–2144 bp], mutated sequence 2 containing TGGTTATGA sequences [2806–2814 bp], and mutated sequence 3 containing GGAGTAGTG sequences [3820–3828 bp]) were inserted into the pGL3-basic vector (Promega, Madison, WI, U.S.A.) to construct reporter plasmids. MLE-12 cells were co-transfected with the reporter plasmids, shNC or shNSUN7, and the pRL-TK vector (Promega) using Lipofectamine 2000. Firefly and Renilla luciferase activities were measured using the Dual-Luciferase Reporter Assay System (Promega), and the relative luciferase activity was calculated as the ratio of firefly-to-Renilla luciferase activity.

RNA Stability Assay

The cells were exposed to 5 μg/mL actinomycin D (MCE) for 0, 4, 8, and 12 h. The TFRC expression was measured by qPCR.

Statistical Analysis

All data are shown as mean ± standard deviation and were analyzed using the GraphPad Prism 8.0 software. Differences were analyzed using Student’s t-test or 1-way ANOVA followed by Tukey’s post hoc test. Normal distribution was assessed using the Kolmogorov–Smirnov test. Homoscedasticity was assessed using Brown–Forsythe test. A p < 0.05 was considered statistically significant.

RESULTS

Kaempferol Inhibits LPS-Induced Ferroptosis in MLE-12 Cells

To explore the involvement of ferroptosis in sepsis-induced ALI, MLE-12 cells were stimulated with LPS to establish an in vitro cell model. Then, we used Fer-1 to inhibit ferroptosis to demonstrate that LPS indeed induced ferroptosis. Results of CCK-8 showed that cell viability was inhibited after LPS treatment, while Fer-1 reversed this inhibition (Supplementary Fig. S1A). In addition, ferroptosis was assessed by detecting Fe²⁺, GSH, MDA, and lipid ROS levels. LPS treatment increased Fe²⁺, MDA, and lipid ROS levels and reduced GSH levels, while Fer-1 abrogated the effects induced by LPS (Supplementary Figs. S1B–S1E). These findings suggest that LPS-induced cell death is partially dependent on ferroptosis.

To investigate the impact of kaempferol on lung epithelial cell ferroptosis, MLE-12 cells were treated with different concentrations of kaempferol before LPS stimulation. LPS inhibited cell viability, and kaempferol promoted the viability of LPS-treated cells in a dose-dependent manner (Fig. 1B). Additionally, Fe²⁺, MDA, and lipid ROS levels were elevated, while GSH levels were reduced by LPS treatment, suggesting that LPS promotes ferroptosis. Nevertheless, kaempferol treatment reversed the promotion of ferroptosis in MLE-12 cells induced by LPS in a dose-dependent manner (Figs. 1C–1F). However, in MLE-12 cells without LPS treatment, kaempferol did not change cell viability, Fe²⁺, GSH, MDA, or lipid ROS levels (Supplementary Figs. S2A–S2E). In summary, kaempferol did not affect ferroptosis in MLE-12 cells, but it inhibited ferroptosis in LPS-treated MLE-12 cells.

Kaempferol Downregulates NSUN7-Mediated m5C Methylation

We assessed whether m5C methylation was involved in the ferroptosis process. MLE-12 cells were treated with LPS and 40 μM kaempferol. Results showed that LPS increased m5C levels, while kaempferol abrogated this increase (Fig. 2A). Subsequently, to explore which writer regulated m5C modification, we focused on the members of the NSUN family. As shown in Fig. 2B, LPS elevated NSUN2, NSUN3, NSUN4, and NSUN7 levels; however, only NSUN7 expression was counteracted by kaempferol (Fig. 2B). Additionally, we found that kaempferol could bind to NSUN7 (Fig. 2C). To sum up, kaempferol bound to NSUN7 to inhibit NSUN7-catalyzed m5C modification in LPS-treated MLE-12 cells.

Fig. 2. Kaempferol Downregulates NSUN7-Mediated m5C Methylation

(A) m5C levels in LPS/kaempferol-treated cells were measured by dot blot. (B) mRNA expression of NSUN2, NSUN3, NSUN4, NSUN5, NSUN6, and NSUN7 was detected by qPCR. (C) The binding between kaempferol and NSUN7 was analyzed using molecular docking. p < 0.05 was considered statistically significant.

Overexpression of NSUN7 Abrogates Kaempferol-Inhibited Ferroptosis

Next, we analyzed whether NSUN7 was implicated in ferroptosis. We transfected NSUN7-overexpressing plasmids, and results showed that NSUN7 expression was upregulated (Fig. 3A), and NSUN7 protein levels were also increased (Fig. 3B). The promotion of cell viability caused by kaempferol was reversed by NSUN7 overexpression (Fig. 3C). Additionally, kaempferol reduced Fe²⁺, MDA, and lipid ROS levels, and elevated GSH levels in LPS-treated cells. Nevertheless, overexpressing NSUN7 counteracted the effects of these indexes induced by kaempferol (Figs. 3D–3G). Together, kaempferol suppresses ferroptosis in LPS-treated MLE-12 cells by decreasing NSUN7 expression.

Fig. 3. Overexpression of NSUN7 Abrogates Kaempferol-Inhibited Ferroptosis

NSUN7 expression was detected by (A) qPCR and (B) Western blot after overexpressing NSUN7. After MLE-12 cells were transfected with NSUN7-overexpressing plasmids or empty vector, followed by treatment with LPS and kaempferol, (C) cell viability was measured by CCK-8; ferroptosis indexes, including (D) Fe²⁺, (E) GSH, (F) MDA, and (G) lipid ROS were determined using their commercial kits. p < 0.05 was considered statistically significant.

Knockdown of NSUN7 Suppresses m5C Methylation of TFRC

To explore which mRNA was modified by NSUN7, several ferroptosis-related factors, including ACSL4, GPX4, SLC7A11, and TFRC,¹⁹⁾ were selected for study. After NSUN7 knockdown, ACSL4 and TFRC levels were downregulated, whereas GPX4 and SLC7A11 levels were increased (Fig. 4A). However, silencing of NSUN7 only decreased m5C levels of TFRC, but did not regulate the m5C levels of ACSL4, GPX4, and SLC7A11 (Fig. 4B). NSUN7 was verified to interact with TFRC (Fig. 4C). Later, the methylation sites were predicted, and sites 2140, 2810, and 3824 were the potential modification sites (Fig. 4D). Results of the luciferase reporter analysis showed that NSUN7 knockdown reduced the relative luciferase activity in the WT group with site 2810, but did not affect the luciferase activity in the site 2140 or 3824 WT group (Figs. 4E–4G), indicating that site 2810 is the NSUN7-modified m5C methylation site. Moreover, NSUN7 knockdown reduced the RNA stability of TFRC (Fig. 4H). Taken together, interfering with NSUN7 suppresses TFRC m5C methylation at site 2810 and thereby reduces TFRC stability.

Fig. 4. Knockdown of NSUN7 Suppresses m5C Methylation of TFRC

(A) The levels of ACSL4, GPX4, SLC7A11, and TFRC in cells after NSUN7 knockdown were measured by qPCR. (B) The m5C methylation levels of ACSL4, GPX4, SLC7A11, and TFRC affected by NSUN7 knockdown were measured by ac4C RIP. (C) The interaction between NSUN7 and TFRC was assessed by RIP. (D) The potential m5C sites in TFRC. (E–G) A dual-luciferase reporter assay was conducted to assess the m5C sites. (H) TFRC mRNA stability was measured after NSUN7 knockdown. p < 0.05 was considered statistically significant.

TFRC Reverses the Inhibition of Ferroptosis Caused by the Downregulation of NSUN7

Rescue experiments were conducted to analyze the effect of both NSUN7 and TFRC on ferroptosis. NSUN7 expression was downregulated after shNSUN7 transfection (Fig. 5A), while TFRC expression was increased after TFRC-overexpressing vector transfection (Fig. 5B). In LPS-induced MLE-12 cells, NSUN7 knockdown enhanced cell viability, which was abrogated by TFRC overexpression (Fig. 5C). Additionally, interfering with NSUN7 reduced Fe²⁺, MDA, and lipid ROS levels and increased GSH levels, whereas overexpressing TFRC counteracted the changes in these indexes caused by NSUN7 knockdown (Figs. 5D–5G). Together, NSUN7 knockdown inhibits ferroptosis in LPS-induced cells by downregulating TFRC expression.

Fig. 5. TFRC Reverses the Inhibition of Ferroptosis Caused by the Downregulation of NSUN7

(A) NSUN7 expression was detected by qPCR after shNSUN7 transfection. (B) TFRC expression was detected by qPCR following TFRC overexpression vector transfection. MLE-12 cells were transfected with plasmids and treated with LPS, and (C) CCK-8 was carried out to evaluate cell viability; (D) Fe²⁺, (E) GSH, (F) MDA, and (G) lipid ROS levels were measured using commercial kits. p < 0.05 was considered statistically significant.

DISCUSSION

Kaempferol is a promising drug for the treatment of diseases, based on its multiple pharmacological activities.^9,10,20) Importantly, kaempferol is a safe and effective agent with the potential for inhibiting inflammation.²¹⁾ Zhu et al. found that kaempferol attenuates the inflammatory response and vascular endothelial damage in sepsis.²²⁾ Moreover, Sun et al. revealed that kaempferol can suppress inflammation and oxidative stress in the lungs.²³⁾ Additionally, kaempferol can ameliorate lung injury induced by many different factors, such as ischemia–reperfusion, hypoxia, or sepsis.^12,24,25) Kaempferol inhibits oxidative stress in sepsis-ALI by suppressing the inducible nitric oxide synthase and intercellular adhesion molecule-1 pathways. In contrast, in this study, we explored the effect of kaempferol on ferroptosis. The results indicated that kaempferol promoted viability and suppressed ferroptosis in MLE-12 cells, suggesting that kaempferol may alleviate ALI caused by sepsis. Similar to kaempferol, another flavonoid compound, hyperoside, can also inhibit ferroptosis in LPS-induced MLE-12 cells,²⁶⁾ suggesting the therapeutic potential of flavonoid compounds for sepsis-induced ALI. In our future work, we will study the role of other flavonoid compounds in ALI to seek new drugs for its treatment.

Next, the underlying mechanism of kaempferol’s function was investigated in our study. We focused on m5C methylation and found that kaempferol reduced m5C levels as well as NSUN7 expression in LPS-treated cells. Recently, m5C methylation has gradually become a research hotspot. It is implicated in different diseases and may be a therapeutic strategy for the treatment of cardiovascular disease, cancer, infection, and inflammation.^27,28) The members of the NSUN family in sepsis are dysregulated, suggesting that m5C is related to the pathogenesis of sepsis.¹⁸⁾ Therefore, we speculated that m5C is also involved in sepsis-ALI. NSUN7 is an immune-related gene that functions as a biomarker of neonatal sepsis.²⁹⁾ However, whether NSUN7 affects ALI remains unclear. In the present study, the results demonstrated that overexpression of NSUN7 reversed the inhibition of ferroptosis induced by kaempferol, suggesting that NSUN7 promotes ferroptosis and may aggravate sepsis-induced ALI. One limitation of this part is that it is not yet clear how kaempferol regulates the expression of NSUN7. We have only initially discovered that kaempferol can bind to NSUN7 through molecular docking. However, their specific binding domain and whether they affect the activity or function of NSUN7 have not yet been clarified.

As we studied the ferroptosis process, we investigated the m5C modification of ferroptosis-related genes and found that NSUN7 knockdown inhibited m5C methylation of TFRC. TFRC is a ferroptosis regulator that imports iron into the cells.³⁰⁾ Aberrant expression of TFRC is associated with organ dysfunction, including in the lung.³¹⁾ Overexpression of TFRC promotes the progression of lung fibrosis³²⁾ and decelerates lung cancer development.³³⁾ Moreover, TFRC regulates ferroptosis in sepsis-associated encephalopathy³⁴⁾; however, whether TFRC is involved in sepsis-ALI remains unclear. The results of this study showed that NSUN7 stabilized TFRC by facilitating m5C methylation. Overexpression of TFRC counteracted the inhibition of ferroptosis caused by NSUN7 knockdown. Taken together, interfering with NSUN7 suppresses ferroptosis in MLE-12 cells by downregulating TFRC expression, which was modulated by inhibition of m5C methylation. In addition, we found that knockdown of NSUN7 elevated GPX4 and SLC7A11 expression and decreased ACSL4 expression. However, NSUN7 did not affect their m5C modification. It is still not known how NSUN7 affects their expression. We hypothesize that NSUN7 may indirectly affect the transcription or stability of these genes through other factors, or cause changes in their expression levels by regulating RNA metabolic pathways. We will further study in our future work.

In conclusion, kaempferol promotes viability and suppresses ferroptosis in lung epithelial cells. Mechanistically, kaempferol downregulates NSUN7 expression and thereby inhibits m5C methylation of TFRC, reducing TFRC stability. These findings suggest that kaempferol may be used for alleviating sepsis-ALI. Targeting ferroptosis and m5C methylation may be effective strategies for the treatment of sepsis-ALI. However, the effect of kaempferol on the progression of sepsis-ALI will be further investigated using animal studies in our future work.

Funding

The study was supported by the Zhejiang Provincial Administration of Traditional Chinese Medicine (2024KY1390).

Author Contributions

All authors participated in the design, interpretation of the studies, and analysis of the data, as well as review of the manuscript. YZ drafted the work and revised it critically for important intellectual content. WW and PA were responsible for the acquisition, analysis, and interpretation of data for the work. YZ and ZY made substantial contributions to the conception or design of the work. All authors read and approved the final manuscript.

Conflict of Interest

The authors declare no conflict of interest.

Data Availability

The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.

Supplementary Materials

This article contains supplementary materials.

REFERENCES

• 1)  Zhang YY, Ning BT. Signaling pathways and intervention therapies in sepsis. Signal Transduct. Target. Ther., 6, 407 (2021).
• 2)  DeMerle KM, Angus DC, Baillie JK, et al. Sepsis subclasses: A framework for development and interpretation. Crit. Care Med., 49, 748–759 (2021).
• 3)  Zhou X, Liao Y. Gut-lung crosstalk in sepsis-induced acute lung injury. Front. Microbiol., 12, 779620 (2021).
• 4)  Cao Z, Qin H, Huang Y, Zhao Y, Chen Z, Hu J, Gao Q. Crosstalk of pyroptosis, ferroptosis, and mitochondrial aldehyde dehydrogenase 2-related mechanisms in sepsis-induced lung injury in a mouse model. Bioengineered, 13, 4810–4820 (2022).
• 5)  Jiang X, Stockwell BR, Conrad M. Ferroptosis: mechanisms, biology and role in disease. Nat. Rev. Mol. Cell Biol., 22, 266–282 (2021).
• 6)  Wang Y, Zhao Z, Xiao Z. The emerging roles of ferroptosis in pathophysiology and treatment of acute lung injury. J. Inflamm. Res., 16, 4073–4085 (2023).
• 7)  Periferakis A, Periferakis K, Badarau IA, Petran EM, Popa DC, Caruntu A, Costache RS, Scheau C, Caruntu C, Costache DO. Kaempferol: antimicrobial properties, sources, clinical, and traditional applications. Int. J. Mol. Sci., 23, 15054 (2022).
• 8)  Chen M, Xiao J, El-Seedi HR, Wozniak KS, Daglia M, Little PJ, Weng J, Xu S. Kaempferol and atherosclerosis: from mechanism to medicine. Crit. Rev. Food Sci. Nutr., 64, 2157–2175 (2024).
• 9)  Dong X, Zhou S, Nao J. Kaempferol as a therapeutic agent in Alzheimer’s disease: evidence from preclinical studies. Ageing Res. Rev., 87, 101910 (2023).
• 10)  Yang Y, Chen Z, Zhao X, Xie H, Du L, Gao H, Xie C. Mechanisms of Kaempferol in the treatment of diabetes: A comprehensive and latest review. Front. Endocrinol. (Lausanne), 13, 990299 (2022).
• 11)  Harasstani OA, Tham CL, Israf DA. Kaempferol and chrysin synergies to improve septic mice survival. Molecules, 22, 92 (2017).
• 12)  Rabha DJ, Singh TU, Rungsung S, Kumar T, Parida S, Lingaraju MC, Paul A, Sahoo M, Kumar D. Kaempferol attenuates acute lung injury in caecal ligation and puncture model of sepsis in mice. Exp. Lung Res., 44, 63–78 (2018).
• 13)  Chen X, Sun YZ, Liu H, Zhang L, Li JQ, Meng J. RNA methylation and diseases: experimental results, databases, Web servers and computational models. Brief. Bioinform., 20, 896–917 (2019).
• 14)  Bohnsack KE, Hobartner C, Bohnsack MT. Eukaryotic 5-methylcytosine (m⁵C) RNA methyltransferases: mechanisms, cellular gunctions, and links to disease. Genes (Basel), 10, 10 (2019).
• 15)  Zheng L, Duan Y, Li M, Wei J, Xue C, Chen S, Wei Q, Tang F, Xiong W, Zhou M, Deng H. Deciphering the vital roles and mechanism of m5C modification on RNA in cancers. Am. J. Cancer Res., 13, 6125–6146 (2023).
• 16)  Chi L, Delgado-Olguin P. Expression of NOL1/NOP2/sun domain (Nsun) RNA methyltransferase family genes in early mouse embryogenesis. Gene Expr. Patterns, 13, 319–327 (2013).
• 17)  Li M, Tao Z, Zhao Y, Li L, Zheng J, Li Z, Chen X. 5-methylcytosine RNA methyltransferases and their potential roles in cancer. J. Transl. Med., 20, 214 (2022).
• 18)  Zhang Q, Bao X, Cui M, Wang C, Ji J, Jing J, Zhou X, Chen K, Tang L. Identification and validation of key biomarkers based on RNA methylation genes in sepsis. Front. Immunol., 14, 1231898 (2023).
• 19)  Delvaux M, Hague P, Craciun L, Wozniak A, Demetter P, Schoffski P, Erneux C, Vanderwinden JM. Ferroptosis induction and YAP inhibition as new therapeutic targets in gastrointestinal stromal tumors (GISTs). Cancers (Basel), 14, 5050 (2022).
• 20)  Imran M, Salehi B, Sharifi-Rad J, Aslam Gondal T, Saeed F, Imran A, Shahbaz M, Tsouh Fokou PV, Umair Arshad M, Khan H, Guerreiro SG, Martins N, Estevinho LM. Kaempferol: a key emphasis to its anticancer potential. Molecules, 24, 2277 (2019).
• 21)  Alam W, Khan H, Shah MA, Cauli O, Saso L. Kaempferol as a dietary anti-inflammatory agent: current therapeutic standing. Molecules, 25, 4073 (2020).
• 22)  Zhu X, Wang X, Ying T, Li X, Tang Y, Wang Y, Yu T, Sun M, Zhao J, Du Y, Zhang L. Kaempferol alleviates the inflammatory response and stabilizes the pulmonary vascular endothelial barrier in LPS-induced sepsis through regulating the SphK1/S1P signaling pathway. Chem. Biol. Interact., 368, 110221 (2022).
• 23)  Sun Z, Li Q, Hou R, Sun H, Tang Q, Wang H, Hao Z, Kang S, Xu T, Wu S. Kaempferol-3-O-glucorhamnoside inhibits inflammatory responses via MAPK and NF-κB pathways in vitro and in vivo. Toxicol. Appl. Pharmacol., 364, 22–28 (2019).
• 24)  Yang C, Yang W, He Z, He H, Yang X, Lu Y, Li H. Kaempferol improves lung ischemia-reperfusion injury via antiinflammation and antioxidative stress regulated by SIRT1/HMGB1/NF-κB axis. Front. Pharmacol., 10, 1635 (2020).
• 25)  Li N, Cheng Y, Jin T, Cao L, Zha J, Zhu X, He Q. Kaempferol and ginsenoside Rg1 ameliorate acute hypobaric hypoxia induced lung injury based on network pharmacology analysis. Toxicol. Appl. Pharmacol., 480, 116742 (2023).
• 26)  Chen K, Lu S, Shi K, Ali MH, Liu J, Yin F, Yin W. Hyperoside attenuates sepsis-induced acute lung injury by Nrf2 activation and ferroptosis inhibition. Int. Immunopharmacol., 145, 113734 (2025).
• 27)  Wang C, Hou X, Guan Q, Zhou H, Zhou L, Liu L, Liu J, Li F, Li W, Liu H. RNA modification in cardiovascular disease: implications for therapeutic interventions. Signal Transduct. Target. Ther., 8, 412 (2023).
• 28)  Cui L, Ma R, Cai J, Guo C, Chen Z, Yao L, Wang Y, Fan R, Wang X, Shi Y. RNA modifications: importance in immune cell biology and related diseases. Signal Transduct. Target. Ther., 7, 334 (2022).
• 29)  Liao W, Xiao H, He J, Huang L, Liao Y, Qin J, Yang Q, Qu L, Ma F, Li S. Identification and verification of feature biomarkers associated with immune cells in neonatal sepsis. Eur. J. Med. Res., 28, 105 (2023).
• 30)  Zhao Y, Zhang H, Cui JG, Wang JX, Chen MS, Wang HR, Li XN, Li JL. Ferroptosis is critical for phthalates driving the blood-testis barrier dysfunction via targeting transferrin receptor. Redox Biol., 59, 102584 (2023).
• 31)  Dragon AH, Rowe CJ, Rhodes AM, Pak OL, Davis TA, Ronzier E. Systematic identification of the optimal housekeeping genes for accurate transcriptomic and proteomic profiling of tissues following complex traumatic injury. Methods. Protoc., 6, 22 (2023).
• 32)  Pei Z, Qin Y, Fu X, Yang F, Huo F, Liang X, Wang S, Cui H, Lin P, Zhou G, Yan J, Wu J, Chen ZN, Zhu P. Inhibition of ferroptosis and iron accumulation alleviates pulmonary fibrosis in a bleomycin model. Redox Biol., 57, 102509 (2022).
• 33)  Zhang P, Wang S, Chen Y, Yang Q, Zhou J, Zang W. METTL3 attenuates ferroptosis sensitivity in lung cancer via modulating TFRC. Open Med. (Wars.), 19, 20230882 (2024).
• 34)  Wei XB, Jiang WQ, Zeng JH, Huang LQ, Ding HG, Jing YW, Han YL, Li YC, Chen SL. Exosome-derived lncRNA NEAT1 exacerbates sepsis-associated encephalopathy by promoting ferroptosis through regulating miR-9-5p/TFRC and GOT1 axis. Mol. Neurobiol., 59, 1954–1969 (2022).