Cryopreservation of Hepatocyte Organoid-Derived Cells Generated from Human iPS Cells

Abstract

Hepatic organoids (iHOs) generated from human-induced pluripotent stem cell-derived hepatocyte-like cells (HLCs) have attracted attention as a new source of hepatocytes to replace primary human hepatocytes (PHHs) in drug discovery research. Recently, we established iHOs from HLCs, which proliferated for more than 10 passages, and developed a two-dimensional (2D) culture protocol for iHOs, by which the cells showed much higher hepatic functions. In this study, we examined the cryopreservation of iHOs for the purpose of improving their versatility. Cryopreserved iHOs had comparable cell proliferative capacity to fresh iHOs. Hepatocyte marker gene expression levels in the cryopreserved iHOs were comparable to those without cryopreservation. When cryopreserved iHOs were directly matured by our 2D culture protocol, they showed higher hepatocyte marker gene expression levels and higher CYP3A4 activity than HLCs. Some of the hepatic functions in 2D-cultured cryopreserved iHOs were at levels comparable to those in PHHs. These results suggest that cryopreserved iHOs also differentiated into mature hepatocytes by 2D culture. We expect cryopreserved iHOs to be used as a user-friendly cell source for drug discovery research in many laboratories.

INTRODUCTION

Hepatotoxicity is among the most frequent reasons for drug withdrawal from the market.¹⁾ Up to 85% of cardiovascular and gastrointestinal adverse effects and more than 90% of adverse effects related to hematologic toxicity in drug development can be predicted in animal studies,²⁾ and this remains the gold standard for preclinical study.^3,4) However, the predictive accuracy of hepatotoxicity in animal studies is only 50%.^1,5) One of the main reasons is that the expressions and activities of drug-metabolizing enzymes are different in humans and animals.⁶⁾ Therefore, it is important to establish in vitro models that can accurately predict human hepatotoxicity in order to reduce preclinical study costs and enhance safety.

Primary (cryopreserved) human hepatocytes (PHHs) are the best in vitro hepatocyte models in current drug discovery research.^7,8) However, PHHs have several drawbacks. They rapidly lose hepatic functions after seeding and lack proliferative capacity. In addition, long-term culture of PHHs has been considered difficult. Therefore, several research groups, including ours, have developed human-induced pluripotent stem (iPS) cell-derived hepatocyte-like cells (HLCs) as an alternative hepatocyte source to PHHs.^9–14) However, HLCs have lower hepatic function than PHHs and almost no proliferative capacity.¹³⁾

To overcome these challenges in regard to HLCs, we recently established organoids from HLCs.¹⁵⁾ Organoids are three-dimensional (3D) tissue models derived from primary tissues, embryonic stem cells, and human iPS cells.^16,17) These organoids are new tools for studying human development and diseases and are thought to be an alternative to animal models in drug development.^18–20) The hepatic organoids (iHOs) from HLCs maintained high cell proliferative capacity and expression of hepatocyte marker genes for a long time. We also developed highly functional hepatocyte-like cells from iHOs by the two-dimensional (2D) culture protocol using a stepwise optimal culture medium.¹⁵⁾

Culturing of organoids is more technically demanding than culturing conventional cells, and this drawback has hindered the widespread use of organoids and their derivatives. In addition, organoids embedded in Matrigel are difficult to apply to pharmaceutical research due to sequestration of the drugs in the gels, low throughput, and limited available model systems. The simplest way to solve these problems is to establish a cryopreservatioton protocol for iHOs and direct 2D-culture protocol from the cryopreserved organoids. The 2D-cultured cells have wider application for pharmaceutical researches, such as drug metabolism and toxicity tests. Moreover, cryopreservation would facilitate transportation, making iHOs available to a larger number of facilities.

In this study, we examined the effects of cryopreservation on the functions of iHOs and iHOs-derived mature hepatocytes (iHO-Heps) under a 2D culture condition. Cryopreserved iHOs maintained high cell proliferative capacity and showed cell morphology similar to fresh iHOs. They had similar levels of hepatocyte marker and proliferation/stem cell marker gene expressions. Like fresh iHOs, cryopreserved iHOs could be directly differentiated to mature hepatocytes by 2D culture and showed similar levels of CYP3A4 activity and albumin secretion levels as those of fresh iHOs. The protocols developed in this study will contribute to the efficiency of drug discovery research as well as to the versatility of iHOs.

MATERIALS AND METHODS

Human iPS Cells Culture

The human iPS cell line Tic (obtained from the JCRB Cell Bank, JCRB Number: JCRB1331) and YOW-iPS⁹⁾ were maintained on 1 μg/cm² recombinant human laminin 511 E8 fragments (iMatrix-511, Nippi, Tokyo, Japan) with StemFit AK02N medium (Ajinomoto, Tokyo, Japan). To passage human iPS cells, near-confluent human iPS cell colonies were treated with TrypLE Select Enzyme (Thermo Fisher Scientific, Waltham, MA, U.S.A.) for 5 min at 37°C. After centrifugation, human iPS cells were seeded at an appropriate cell density (5 × 10⁴ cells/cm²) onto iMatrix-511 and were then subcultured every 6 d.

Hepatic Differentiation

The differentiation protocol for the induction of definitive endoderm cells, hepatoblast-like cells, and HLCs was based on our previous reports.¹⁵⁾ Briefly, in the definitive endoderm differentiation, human iPS cells were cultured for 4 d with RPMI1640 medium (Sigma-Aldrich, St. Louis, MO, U.S.A.), which contained 100 ng/mL Activin A (R&D Systems, Minneapolis, MN, U.S.A.), 2× GlutaMAX (Thermo Fisher Scientific), and 0.5× B27 Supplement Minus Vitamin A (Thermo Fisher Scientific). For the induction of hepatoblast-like cells, the definitive endoderm cells were cultured for 5 d with RPMI1640 medium containing 20 ng/mL BMP4 (R&D Systems), 20 ng/mL fibroblast growth factor 4 (FGF4; R&D Systems), 2× GlutaMAX, and 0.5× B27 Supplement Minus Vitamin A. To perform hepatic differentiation, the hepatoblast-like cells were cultured for 5 d with RPMI1640 medium containing 20 ng/mL hepatocyte growth factor, 2× GlutaMAX, and 0.5× B27 Supplement Minus Vitamin A. Finally, the cells were cultured for 11 d with hepatocyte culture medium (HCM; Lonza, Basel, Switzerland) without epidermal growth factor (EGF) but with 20 ng/mL oncostatin M (OsM; R&D Systems) and 3× GlutaMAX, generating HLCs.

Establishment of iHOs from Human iPS Cell-Derived HLCs

The protocol for the establishment of iHOs was based on our previous report.¹⁵⁾ Briefly, HLCs were dissociated into single cells using TrypLE Select Enzyme and mechanical disruption with a pipette, and then passed through a 70 μm cell strainer (Falcon, Saitama, Japan). The dissociated HLCs were mixed with Matrigel (Corning, Corning, NY, U.S.A.), seeded in 24 wells, and cultured with Hep-Medium, which was prepared based on the previous report.²¹⁾ During culturing, each medium was refreshed every 2–3 d. The organoids were passaged with a split ratio of 1 : 10 to 1 : 20 every 7 d. The composition of Hep-Medium is listed in Table 1. iHOs that had been passaged 1–5 times were used in the experiment.

Table 1. Composition of Hep-Medium

Components	Hep-medium
Advanced DMEM/F-12	+
Penicillin/streptomycin	1%
GlutaMAX	1%
10 mM HEPES	+
B27 supplement	(1:50, without vitamin A)
R-spodin1-conditioned medium	15%
ChIR99021	3 mm
N-Acetylcysteine	1.25 mM
Nicotinamide	10 mM
Recombinant gastrin	10 nM
Recombinant EGF	50 ng/mL
Recombinant TGFa	20 ng/mL
Recombinant human FGF7	100 ng/mL
Recombinant human FGF10	100 ng/mL
Recombinant human HGF	50 ng/mL
A83-01	2 mM
Y-27632	10 μM

Cryopreservation of iHOs

iHOs were dissociated into single cells using TrypLE Select Enzyme and mechanical disruption with a pipette. The dissociated iHOs were suspended with STEM-CELLBANKER® dimethyl sulfoxide (DMSO) Free GMP grade (ZNQ) and the suspension was placed in a vial. The vial was placed in a Bicell overnight and the temperature was gradually lowered to −80°C. The next day, the vials were transferred to a −150°C freezer, and stored.

2D Culture of iHOs

The protocol for 2D culture of iHO was based on our previous reports.¹⁵⁾ Briefly, iHOs were dissociated into single cells using TrypLE Select Enzyme (Thermo Fisher Scientific) and mechanical disruption with a pipette, and then passed through a 70 μm cell strainer (Falcon). The cells were seeded at 4.2 × 10⁵ cells/cm² in Matrigel-coated plates and cultured with Hep-Medium containing PD0325901 (0.5 μM;FUJIFILM Wako, Osaka, Japan), SB43154 (2 μM; FUJIFILM Wako), and Y-27632 (10 μM; FUJIFILM Wako) for 2 d. On day 2 after seeding, the cells were cultured with HCM (Lonza) without EGF but with 3× GlutaMAX, PD0325901 (0.5 μM; Wako), SB43154 (2 μM; FUJIFILM Wako), Y-27632 (10 μM; FUJIFILM Wako), and BMP7 (50 ng/mL) for 3 d. Next, the cells were cultured with HCM (Lonza) without EGF but with 3× GlutaMAX, PD0325901 (0.5 μM; FUJIFILM Wako), SB43154 (2 μM; FUJIFILM Wako), Y-27632 (10 μM; Wako), and FGF19 (100 ng/mL; PeproTech, Rocky Hill, NJ, U.S.A.) for 3 d. Finally, the cells were cultured with HCM (Lonza) without EGF but with 3× GlutaMAX, PD0325901 (0.5 μM; FUJIFILM Wako), SB43154 (2 μM; FUJIFILM Wako), Y-27632 (10 μM; FUJIFILM Wako), FGF19 (100 ng/mL; PeproTech), and dexamethasone (10 μM; FUJIFILM Wako) for 3 d.

Thawing of Cryopreserved Organoids

Vials stored at −150°C for more than 2 weeks were soaked in a 37°C water bath for 1–2 min and diluted with 10 mL of Advanced DMEM-F12 containing Y-27632 (10 μM; FUJIFILM Wako). The diluted solution was centrifuged to make a cell pellet. The cell pellet was then suspended and cultured with either Hep-Medium for organoid culture or Hep-Medium containing PD0325901 (0.5 μM; FUJIFILM Wako), SB43154 (2 μM; FUJIFILM Wako), and Y-27632 (10 μM; FUJIFILM Wako) for 2 d for 2D culture.

Cell Proliferation Assessment

Organoids were passaged into 96-well plates with 10 μL droplets of organoids Matrigel mixture and 100 μL medium was added to each well. The medium was changed every 2 d. The CellTiter-Glo® 3D Cell Viability Assay (Promega, Madison, WI, U.S.A.) was used to assess organoid growth and viability according to the manufacturer’s instructions. Luminescence was detected using a TriStar2 LB942 (Berthold Technologies, Baden Württemberg, Germany).

Cell Viability Tests

The cell viability of the cryopreserved iHOs was measured by Countess 3 Automated Cell Counter (Thermo Fischer Scientific).

Real-Time RT-PCR

Total RNA was extracted from each cell population using ISOGEN (NIPPON GENE, Tokyo, Japan). cDNA was synthesized from 500 ng of each Total RNA by reverse transcription reaction using Superscript VILO cDNA synthesis kit (Thermo Fisher Scientific). Target mRNA expression levels were quantified relatively using the 2–ΔΔCT method. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as an internal standard gene. Primer sequences used for quantitative RT-PCR (Table 2) were obtained from PrimerBank (https://pga.mgh.harvard.edu/primerbank/).

Table 2. The Primers Used for Real-Time RT-PCR

Gene symbol	For real-time RT-PCR
	Primers (forward/reverse; 5′ to 3′)
GAPDH	GGTGGTCTCCTCTGACTTCAACA/GTGGTCGTTGAGGGCAATG
ALB	TGCAACTCTTCGTGAAACCTATG/ACATCAACCTCTGGTCTCACC
HNF4α	CGTCATCGTTGCCAACACAAT/GGGCCACTCACACATCTGTC
CYP3A4	AAGTCGCCTCGAAGATACACA/AAGGAGAGAACACTGCTCGTG
CYP2C9	GGACAGAGACGACAAGCACA/CATCTGTGTAGGGCATGTGG
CYP2C19	ACTTGGAGCTGGGACAGAGA/CATCTGTGTAGGGCATGTGG
CYP1A2	CAATCAGGTGGTGGTGTCAG/GCTCCTGGACTGTTTTCTGC
CYP3A5	CGGCATCATAGGTAGGTGGT/TATGAACTGGCCACTCACCC
CYP2D6	CTTTCGCCCCAACGGTCTC/TTTTGGAAGCGTAGGACCTTG
CYP2E1	CCCAATCACCCTGTCAATTT/GACCACCAGCACAACTCTGA
CYP2B6	GTCCCAGGTGTACCGTGAAG/CCCTTTTGGGAAACCTTCTG
NTCP	AGAAGGTGGAGCAGGTGGT/ATCTTGGTCTGTGGCTGCTC
UGT1A1	CTGTCTCTGCCCACTGTATTCT/TCTGTGAAAAGGCAATGAGCAT
UGT1A6	CAGCTGTCCTCAAGAGAGATGTGGA/CCACAATTCCATGTTCTCCAG
UGT1A8	TTGATGCCTGTGCGTTAATTGT/GGCAACCTATTCCCCTGGC
UGT1A9	TTCTCCAAACACCTGTTACGGA/CCACAATTCCATGTTCTCCAG
UGT2B17	GCTGCTGGCTGAGCTACTTA/GCCACATTTCAGCTTTCCCC
UGT2B7	CAGCTTCTCTCCTGGCTACACT/CAGGAGTTTCGAATAAGCCATA
MRP2/ABCC2	TGAGCAAGTTTGAAACGCACAT/AGCTCTTCTCCTGCCGTCTCT
BCRP/ABCG2	TGCAACATGTACTGGCGAAGA/TCTTCCACAAGCCCCAGG
Ki67	AGAAGAAGTGGTGCTTCGGAA/AGTTTGCGTGGCCTGTACTAA
LGR5	CTCCCAGGTCTGGTGTGTTG/GTGAAGACGCTGAGGTTGGA
EpCAM	AATCGTCAATGCCAGTGTACTT/TCTCATCGCAGTCAGGATCATAA
CK19	CTCCCGCGACTACAGCCACT/TCAGCTCATCCAGCACCCTG

Measurement of the CYP Enzymatic Activities by LC-MS/MS Analysis

The cells were treated with a cocktail of CYP model substrates (1 μM midazolam, 1 μM diclofenac sodium salt, 1 μM bufuralol) for 24 h and their representative metabolites (1-hydroxy midazolam, 4-hydroxydiclofenac, 1′-Hydroxy-bufuralol) were measured by liquid chromatography tandem mass spectrometry (LC-MS/MS). LC-MS/MS data were obtained by mass spectrometry (Xevo TQ-S, Waters Corp., Milford, MA, U.S.A.) connected to UPLC (ACQUITY UPLC, Waters), using BEH C18 column (1.7 μm, 2.1 × 50 mm, Waters). Mobile phase A = 0.1% formic acid/water, B = 0.1% formic acid/acetonitrile, and gradient system were as follows: 0 min–2% B, 1.0 min–95% B, 1.25 min–95% B, 1.26 min–2% B, and 1.75 min–2% B. The flow rate was 1.0 mL/min.

Fluorescent Assay for CYP3A4 Activity

The CYP3A4 activity was measured using P450-Glo™ CYP3A4 Assay Kits (Promega). Luciferin-IPA was used as a substrate for CYP3A4, and fluorescence intensity was measured with a luminometer (Lumat LB 9507, Berthold Technologies). The CYP3A4 activity was calculated by normalizing to the protein content per well. Protein content was measured using Pierce BCA Protein Assay Kit according to the manufacturer’s instructions.

Immunofluorescence

To perform the immunofluorescence, cells were washed twice with phosphate-buffered saline (PBS) and treated with 4% paraformaldehyde (PFA; FUJIFILM Wako Pure Chemical Corporation) for 10 min at room temperature. The cells were blocked with PBS containing 2% BSA (Sigma-Aldrich) and 0.2% Triton X-100 (Sigma-Aldrich) for 45 min. They were reacted with HNF4α antibody (Santa Cruz Biotechnology, sc-374229, 1 : 75) and E-Cadherin antibody (Abcam, Cambridge, U.K., ab40772, 1 : 500) overnight at 4°C, followed by secondary antibody (Thermo Fisher Scientific) labeled with Alexa Fluor 488 for 1 h at room temperature. Nuclear staining was then performed using 4′,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific), and cells were observed under a fluorescence microscope (BIOREVO BZ-9000, Keyence).

Albumin (ALB) Secretion

The culture supernatants were collected and the amount of ALB secretion was measured using a Human Albumin ELISA Quantitation Set (Bethyl Laboratories, Montgomery, Texas, U.S.A.) according to the manufacturer’s instructions. The amount of ALB secretion was calculated according to each standard followed by normalization to the protein content per well. Protein content was measured using Pierce BCA Protein Assay Kit according to the manufacturer’s instructions.

Urea Secretion

The culture supernatants were collected and analyzed for the amount of urea production. Urea secretion was measured using Urea measurement kits (BioAssay Systems, Hayward, CA, U.S.A.) according to the manufacturer’s instructions. The amount of urea secretion was calculated according to each standard followed by normalization to the protein content per well. Protein content was measured using Pierce BCA Protein Assay Kit according to the manufacturer’s instructions.

Primary Human Hepatocytes (PHHs)

One lot of cryopreserved human hepatocytes (HC4-24, XENOTECH) was used. The vials of hepatocytes were rapidly thawed in a shaking water bath at 37°C, and the contents of each vial were emptied into prewarmed HCM (Lonza) and the suspension was centrifuged at 900 rpm for 10 min at room temperature. The cells were seeded at 1.25 × 10⁵ cells/cm² in HCM containing 10% fetal bovine serum (FBS; Life Technologies) onto type I collagen (Nitta Gelatin)-coated 12-well plates. PHHs cultured for 48 h after plating were used in the experiments.

Statistical Analysis

All results are based on three biological replicates. Statistical analysis was performed using the unpaired two-tailed Student’s t-test. A value of p < 0.05 was considered statistically significant.

RESULTS AND DISCUSSION

Cryopreserved iHOs Could Be Cultured in Organoids

In this study, to improve the versatility of iHOs, we attempted to cryopreserve them. We first examined whether iHOs could be cultured as organoids after cryopreservation. iHOs were prepared from human iPS-derived HLCs according to our previously reported method.¹⁵⁾ Fresh iHOs were dissociated into single cells and suspended in cryopreservation solution. iHOs were then incubated at −80°C for 1 d using Bicell and cryopreserved at −150°C for at least 2 weeks. Then, cryopreserved iHOs were thawed and suspended in Matrigel for organoid culture (Fig. 1A). Cryopreserved iHOs had thick cell layers similar to fresh iHOs (Fig. 1B). The cell viability after cryopreservation was approximately 70% (Fig. 1C). Cell proliferation rates were measured in cryopreserved and fresh iHOs. Cryopreserved iHOs grew to 10⁴-fold in 18 d, suggesting that the cell proliferation rate remained sufficiently high after cryopreservation, although cryopreserved iHOs showed a little slower growth than fresh iHOs (Fig. 1D). To examine the expression levels of various genes in the cryopreserved iHOs, the gene expression levels of hepatocyte markers (albumin, ALB; hepatocyte nuclear factor 4 alpha, HNF4α; cytochrome P450 3A4, CYP3A4; cytochrome P450 2C9, CYP2C9; cytochrome P450 2C19, CYP2C19; Sodium-taurocholate co-transporting polypeptide, NTCP; uridine diphosphate glucuronosyltransferase 1A1, UGT1A1) and proliferation/stem cell markers (marker of proliferation Ki-67, Ki67; leucine-rich orphan G-protein-coupled receptor, LGR5; epithelial cell adhesion molecule, EpCAM; Cytokeratin 19, CK19) were analyzed by real-time RT-PCR. Cryopreserved iHOs showed hepatocyte marker gene expressions comparable to fresh iHOs (Fig. 1E). Furthermore, no significant differences in proliferation/stem cell marker gene expressions were observed between cryopreserved and fresh iHOs (Fig. 1F). We also measured the gene expression levels of other drug-metabolizing enzymes and transporters. Although expression varied depending on the molecular species, in general, expression levels in cryopreserved iHOs were similar to those in fresh iHOs (Supplementary Figs. S1A, S1B). Similar results were obtained in iHOs derived from another iPS cell line, YOW-iPS (Supplementary Fig. S2). These findings suggest that the functions of iHOs were maintained after cryopreservation.

Fig. 1. Cryopreserved iHOs Were Successfully Cultured in Organoid

(A) Schematic overview of the protocol for cryopreservation and thawing of iHOs. (B) Phase-contrast micrographs of fresh iHOs and cryopreserved iHOs. Scale bars = 50 μm. (C) The cell viability of iHOs after cryopreservation and thawing. (D) The cell proliferation rate of fresh iHOs and cryopresereved iHOs. (E, F) The gene expression levels of (E) hepatocytes (ALB, HNF4α, CYP3A4, CYP2C9, CYP2C19, NTCP, UGT1A1) and (F) proliferation/stem cell (Ki67, LGR5, EpCAM, CK19) markers were examined in fresh iHOs and cryopreserved iHOs by real-time RT-PCR. The gene expression levels in HLCs were taken as 1.0. Data represent the means ± standard deviation (S.D.) (n = 3). Statistical significance was evaluated by unpaired two-tailed Student’s t-test (n.s.: not significantly different between Fresh iHOs and Crypreserved iHOs).

2D Culture of Cryopreserved iHOs

Organoid culture embedded in Matrigel is difficult to apply to pharmaceutical research due to sequestration of the drugs into the gels, low throughput, and limited available model systems. To enable wider application of iHOs in pharmaceutical research, we previously established a differentiation protocol for differentiating iHOs into mature hepatocytes (iHO-Heps) under a 2D culture condition.¹⁵⁾ If cryopreserved iHOs could be directly differentiated into iHO-Heps, their versatility would be enhanced. To confirm this, we seeded cryopreserved iHOs into multi-well plates and treated them with our differentiation protocol¹⁵⁾ (Fig. 2A). The resulting iHO-Heps, Cryo-iHO-Heps, showed a hepatocyte-like polygonal morphology similar to Fresh-iHO-Heps without cryopreservation (Fig. 2B). Hepatocyte marker gene expressions were not significantly different between Cryo-iHO-Heps and Fresh-iHO-Heps, although some of the gene expression levels differed depending on the types of genes. Importantly, all of the genes, except for ALB, showed higher expression in Cryo-iHO-Heps and Fresh-iHO-Heps than in the original HLCs (Fig. 2C). Gene expression in other drug-metabolizing enzymes and transporters was maintained at levels equivalent to or higher than those in HLCs (Supplementary Figs. S3A, S3B). Immunofluorescence staining confirmed that the protein expression of HNF4α, one of the most important transcription factor in hepatocytes, exhibited the same levels of nuclear localization in Cryo-iHO-Heps and Fresh-iHO-Heps (Fig. 2D).

Fig. 2. Cryopreserved iHOs Could Be Directly Differentiated without Organoid Culture

(A) Schematic overview of the protocol for Cryo-iHO-Heps. (B) Phase-contrast micrographs of Fresh-iHO-Heps and Cryo-iHO-Heps. Scale bars = 50 μm. (C) The gene expression levels of hepatocyte (ALB, HNF4α, CYP3A4, CYP2C9, CYP2C19, UGT1A1) markers were examined in Fresh-iHO-Heps and Cryo-iHO-Heps by real-time RT-PCR. The gene expression levels in HLCs were taken as 1.0. Data represent the means ± S.D. (n = 3). (D) The expression of hepatocyte (HNF4α) markers in Fresh-iHO-Heps and Cryo-iHO-Heps was examined by immunohistochemistry. Scale bars = 5 μm.

Hepatic Functions of Cryo-iHO-Heps

To further examine the hepatic functions of Cryo-iHO-Heps, their enzymatic activities of multiple cytochrome P450 (CYPs) were analyzed. We used a cocktail of CYP model substrates (midazolam, diclofenac sodium salt, bufuralol) and measured their representative metabolites (1-hydroxy midazolam, 4-hydroxy diclofenac, 1′-hydroxy-bufuralol) by liquid chromatography tandem mass spectrometry (LC-MS/MS). The CYP3A4 activity in Cryo-iHO-Heps was similar to that in Fresh-iHO-Heps, but much higher than that in the original HLCs and comparable to that in PHHs (Fig. 3A). A fluorescent assay for CYP3A4 activity showed that Cryo-iHO-Heps had higher CYP3A4 activity than PHHs (Supplementary Fig. S4A). On the contrary, the CYP2C9 and CYP2D6 activities in Cryo-iHO-Heps were not as high as those in PHHs, although they were higher than those in the original HLCs and similar or higher than those in Fresh-iHO-Heps (Fig. 3A). Similar results were obtained in another set of experiments (Supplementary Fig. S4B). The levels of urea and ALB secretion in Cryo-iHO-Heps were the same as in Fresh-iHO-Heps (Figs. 3B, 3C). The finding that ALB secretion in Cryo-iHO-Heps and Fresh-iHO-Heps was lower than that in HLCs and PHHs, which was also the case in our previous report,¹⁵⁾ warrants further investigation in a future study. Except in regard to ALB secretion, iHOs could be matured into iHO-Heps even after cryopreservation and Cryo-iHO-Heps had the similar or higher levels of hepatic functions as compared with Fresh iHO-Heps and HLCs. Some of the functions in Cryo-iHO-Heps were comparable to those of PHHs.

Fig. 3. Hepatic Functions of Cryo-iHO-Heps

(A) The CYP3A4, CYP2C9, and CYP2D6 activity levels in HLCs, Fresh-iHO-Heps, Cryo-iHO-Heps and PHHs were measured using each specific substrate by LC-MS/MS analysis. Data represent the means ± S.D. (n = 3). Statistical significance was evaluated by unpaired two-tailed Student’s t-test (n.s.: not significantly different between Fresh-iHO-Heps and Cryo-iHO-Heps, ^**: Significantly different at p < 0.01 between Fresh-iHO-Heps and Cryo-iHO-Heps). (B, C) The levels of urea (B) and albumin (C) secretion were examined in HLCs, Fresh-iHO-Heps, Cryo-iHO-Heps and PHHs. Data represent the means ± S.D. (n = 3).

In summary, cryopreserved iHOs maintained high hepatocyte marker gene expressions. The cell proliferation rate of cryopreserved iHOs was also sufficiently high enough. Since the proliferation rate of cryopreserved iHOs was about 10⁴-fold in 18 d, we conclude that a large amount of cryopreserved iHOs can be prepared from a small amount of cryopreserved stock. In addition, cryopreserved iHOs can be directly seeded onto plates and matured with our 2D culture protocol, making it possible to prepare highly functional hepatocytes without complicated manipulations. Therefore, it is expected that cryopreserved iHOs will be used at various facilities and applied to a wide range of pharmaceutical research in the future.

Acknowlegments

This research was financially supported by Japan Agency for Medical Research and development, AMED (Grant Numbers: 25fk0310534, 25mk0121300); Platform Project for Supporting Drug Discovery and Life Science Research (Basis for Supporting Innovative Drug Discovery and Life Science Research (BINDS)) from AMED (Grant Number: JP25ama121054); Japan Science and Technology Agency (JST) SPRING [Grant Number: JPMJSP2138]; and COI-NEXT [JPMJPF2009].

Conflict of Interest

The authors declare no conflict of interest.

Supplementary Materials

This article contains supplementary materials.

REFERENCES

• 1)  Ruoß M, Vosough M, Königsrainer A, Nadalin S, Wagner S, Sajadian S, Huber D, Heydari Z, Ehnert S, Hengstler JG, Nussler AK. Towards improved hepatocyte cultures: progress and limitations. Food Chem. Toxicol., 138, 111188 (2020).
• 2)  Olson H, Betton G, Robinson D, Thomas K, Monro A, Kolaja G, Lilly P, Sanders J, Sipes G, Bracken W, Dorato M, Van Deun K, Smith P, Berger B, Heller A. Concordance of the toxicity of pharmaceuticals in humans and in animals. Regul. Toxicol. Pharmacol., 32, 56–67 (2000).
• 3)  Tralau T, Luch A. Drug-mediated toxicity: illuminating the “bad” in the test tube by means of cellular assays? Trends Pharmacol. Sci., 33, 353–364 (2012).
• 4)  Hartung T, Daston G. Are in vitro tests suitable for regulatory use? Toxicol. Sci., 111, 233–237 (2009).
• 5)  Ware BR, Khetani SR. Engineered liver platforms for different phases of drug development. Trends Biotechnol., 35, 172–183 (2017).
• 6)  Martignoni M, Groothuis GMM, de Kanter R. Species differences between mouse, rat, dog, monkey and human CYP-mediated drug metabolism, inhibition and induction. Expert Opin. Drug Metab. Toxicol., 2, 875–894 (2006).
• 7)  Gómez-Lechón MJ, Tolosa L, Conde I, Donato MT. Competency of different cell models to predict human hepatotoxic drugs. Expert Opin. Drug Metab. Toxicol., 10, 1553–1568 (2014).
• 8)  Yokoyama Y, Sasaki Y, Terasaki N, Kawataki T, Takekawa K, Iwase Y, Shimizu T, Sanoh S, Ohta S. Comparison of drug metabolism and its related hepatotoxic effects in HepaRG, cryopreserved human hepatocytes, and HepG2 cell cultures. Biol. Pharm. Bull., 41, 722–732 (2018).
• 9)  Takayama K, Morisaki Y, Kuno S, Nagamoto Y, Harada K, Furukawa N, Ohtaka M, Nishimura K, Imagawa K, Sakurai F, Tachibana M, Sumazaki R, Noguchi E, Nakanishi M, Hirata K, Kawabata K, Mizuguchi H. Prediction of interindividual differences in hepatic functions and drug sensitivity by using human iPS-derived hepatocytes. Proc. Natl. Acad. Sci. U.S.A., 111, 16772–16777 (2014).
• 10)  Tricot T, Verfaillie CM, Kumar M. Current status and challenges of human induced pluripotent stem cell-derived liver models in drug discovery. Cells, 11, 442 (2022).
• 11)  Blaszkiewicz J, Duncan SA. Advancements in disease modeling and drug discovery using iPSC-derived hepatocyte-like cells. Genes, 13, 573 (2022).
• 12)  Inui J, Ueyama-Toba Y, Mitani S, Mizuguchi H. Development of a method of passaging and freezing human iPS cell-derived hepatocytes to improve their functions. PLoS One, 18, e0285783 (2023).
• 13)  Song Z, Cai J, Liu Y, Zhao D, Yong J, Duo S, Song X, Guo Y, Zhao Y, Qin H, Yin X, Wu C, Che J, Lu S, Ding M, Deng H. Efficient generation of hepatocyte-like cells from human induced pluripotent stem cells. Cell Res., 19, 1233–1242 (2009).
• 14)  Si-Tayeb K, Noto FK, Nagaoka M, Li J, Battle MA, Duris C, North PE, Dalton S, Duncan SA. Highly efficient generation of human hepatocyte-like cells from induced pluripotent stem cells. Hepatology, 51, 297–305 (2010).
• 15)  Inui J, Ueyama-Toba Y, Imamura C, Nagai W, Asano R, Mizuguchi H. Two-dimensionally cultured functional hepatocytes generated from human induced pluripotent stem cell-derived hepatic organoids for pharmaceutical research. Biomaterials, 318, 123148 (2025).
• 16)  Clevers H. Modeling development and disease with organoids. Cell, 165, 1586–1597 (2016).
• 17)  Rossi G, Manfrin A, Lutolf MP. Progress and potential in organoid research. Nat. Rev. Genet., 19, 671–687 (2018).
• 18)  Brooks A, Liang X, Zhang Y, Zhao CX, Roberts MS, Wang H, Zhang L, Crawford DHG. Liver organoid as a 3D in vitro model for drug validation and toxicity assessment. Pharmacol. Res., 169, 105608 (2021).
• 19)  Olgasi C, Cucci A, Follenzi A. iPSC-derived liver organoids: a journey from drug screening, to disease modeling, arriving to regenerative medicine. Int. J. Mol. Sci., 21, 6215 (2020).
• 20)  Harrison SP, Baumgarten SF, Verma R, Lunov O, Dejneka A, Sullivan GJ. Liver organoids: recent developments, limitations and potential. Front. Med., 8, 574047 (2021).
• 21)  Hu H, Gehart H, Artegiani B, LÖpez-Iglesias C, Dekkers F, Basak O, van Es J, Chuva de Sousa Lopes SM, Begthel H, Korving J, van den Born M, Zou C, Quirk C, Chiriboga L, Rice CM, Ma S, Rios A, Peters PJ, de Jong YP, Clevers H. Long-term expansion of functional mouse and human hepatocytes as 3D organoids. Cell, 175, 1591–1606 (2018).