Astragaloside IV Inhibits the Pyroptosis in the Acute Kidney Injury through Targeting the SIRT1/FOXO3a Axis

Abstract

Acute kidney injury (AKI) is a commonly encountered critical condition in clinical settings, often resulting from sepsis, infections or ischemia. Astragaloside IV (AS-IV) is the primary active component of Astragalus. The functions of Astragalus are mainly related to AS-IV, showing remarkable therapeutic effects in anti-inflammatory, antioxidant, immune-enhancing, and anti-tumor aspects. This study aimed to explore the role of AS-IV in AKI development. Lipopolysaccharide (LPS) was used to stimulate the HK-2 cells and rats to establish the AKI model in vivo and in vitro. After AS-IV treatment, the cell viability, pyroptosis rate, lactate dehydrogenase (LDH) activity, interleukin (IL)-18 and IL-1β contents, and cleaved-caspase-1, GSDMD-N, SIRT, FOXO3a protein levels were detected. Caspase-1 levels were analyzed by immunofluorescence staining. Additionallly, the acetylation levels of FOXO3a were detected by immunoprecipitation and Western blot assays. AS-IV treatment promoted the cell viability, and inhibited the pyroptosis, LDH activity, caspase-1 levels in the LPS stimulated HK-2 cells. AS-IV treatment decreased the IL-18 and IL-1β contents, cleaved-caspase-1 and GSDMD-N protein levels in both LPS stimulated HK-2 cells and rats. Furthermore, after EX527 treatment, a Sirtuin 1 (SIRT1) inhibitor, the role of AS-IV in the LPS stimulated HK-2 cells were reversed. AS-IV treatment increased the protein levels and decreased the acetylation levels of FOXO3a, which was reversed after EX527 treatment. Co-immunoprecipitation (CO-IP) assay and immunofluorescence staining confirmed that SIRT1 interacted with FOXO3a. In conclusion, this research demonstrated that AS-IV treatment inhibited the pyroptosis occurrence in LPS stimulated HK-2 cells and rats. This may be related to the SIRT1 mediated deacetylation of FOXO3a.

Introduction

Acute kidney injury (AKI) is a commonly encountered critical condition in clinical settings, often resulting from sepsis, infections, or ischemia.¹⁾ AKI progresses rapidly, with mortality rates reaching up to 70%.²⁾ Presently, an increasing body of research indicates that AKI not only involves a rapid decline or loss of kidney filtration function and a swift deterioration in other organ functions but is also accompanied by significant inflammatory responses.³⁾ This encompasses various etiologies, including acute glomerulonephritis, acute interstitial nephritis, and acute renal failure.⁴⁾ Recent studies have highlighted a close association between the occurrence of pyroptosis (known as necroinflammation) and the progression of kidney injury, as seen in AKI, diabetes, and kidney stones.^5,6) Pyroptosis, associated mainly with infectious diseases, metabolic disorders, atherosclerosis, and diabetic nephropathy, represents a crucial natural immune mechanism.⁷⁾ Pyroptotic cells form pyroptosis bodies that create pores on the cell membrane, leading to cell rupture. Subsequently, intracellular contents and inflammatory cytokines are released into the tissue interstitium, triggering local immune responses that recruit immune cells to clear the source of infection.⁸⁾ Additionally, this process stimulates the activation of corresponding pattern recognition receptors, resulting in the production of more inflammatory mediators, thereby amplifying and prolonging the immune response against pathogens.⁹⁾ Numerous studies have now demonstrated the crucial role of necroinflammatory factors associated with pyroptosis in the occurrence and progression of AKI.^5,10,11) Targeting the regulation of pyroptosis during the development of AKI might represent a promising avenue for future AKI therapies.

Astragalus, a leguminous plant, possesses various effects such as Yiqi solid form, and Water swelling role.¹²⁾ Traditional Chinese medicine formulations predominantly featuring Astragalus play a significant role in kidney disease treatment, with Astragalus being one of the most frequently used medicinal herbs in core prescriptions for chronic kidney disease.¹³⁾ Astragalus targets multiple metabolic pathways, suggesting its therapeutic mechanism in treating chronic kidney disease might involve the mutual regulation of multiple components and targets.¹⁴⁾ Modern pharmacological research has found that Astragalus contains various active components such as glycosides and flavonoids, which exhibit anti-inflammatory,¹⁵⁾ antioxidant properties,¹⁶⁾ and can also improve metabolic functions in the body.¹⁷⁾ Astragaloside IV (AS-IV) is the primary active component of Astragalus, and the functions of Astragalus are mainly related to AS-IV, showing remarkable therapeutic effects in anti-inflammatory, antioxidant, immune-enhancing, and anti-tumor aspects.^18–20) Currently, there is considerable research on Astragalus and its main active components in the treatment of chronic kidney disease, but its specific mechanism in AKI remains unclear.

Sirtuin 1 (SIRT1) participates in regulating processes such as DNA damage repair, oxidative stress, inflammatory responses, cell apoptosis, and proliferation by deacetylating target proteins.^21,22) Recent studies have demonstrated that SIRT1 can deacetylate FOXO3a, enhancing its transcriptional activity and inducing cell cycle arrest and antioxidative effects.²³⁾ Several studies have confirmed that traditional Chinese medicine can promote the expression of SIRT1 to alleviate the progression of AKI.^24–26) However, it is currently unclear whether AS-IV can regulate the expression of SIRT1 to alleviate AKI. Therefore, this study aims to investigate the therapeutic mechanism of AS-IV in AKI progression by establishing in vitro and in vivo AKI models. We hypothesized that AS-IV might alleviate the occurrence of pyroptosis and ultimately inhibit AKI progression by modulating the acetylation modification of FOXO3a mediated by SIRT1.

Experimental

Animal Experiment

Sprague–Dawley (SD) rats (SPF, Male, 4 weeks, 150–200 g) were provided by Charles River Experimental Animal Technology Co., Ltd. (Beijing, China). After one week of adaptive feeding, rats were divided in to Control group, AKI group, AKI + 5 mg/kg AS-IV group, AKI + 10 mg/kg AS-IV group, six rats in each group. For AKI model establishment, rats were intraperitoneally injected with 10 mg/kg of lipopolysaccharide (LPS) (single injection), while control group rats were intraperitoneally injected with 0.9% NaCl. Forty-eight hours after LPS treatment, rats were euthanized by intraperitoneal injection of 160 mg/kg pentobarbital sodium, and renal tissues were collected for next experiment. The blood urea nitrogen (BUN) and serum creatinine (SCR) levels of all rates were evaluated using Hitachi 7180 automatic analyzer. As for AS-IV treatment, the LPS stimulated rats were gavaged with 5 mg/kg AS-IV or 10 mg/kg AS-IV once a day for two weeks. After treatment, rats were euthanized by intraperitoneal injection of 160 mg/kg pentobarbital sodium, and renal tissues were collected for next experiment. The BUN and SCR levels of all rates were evaluated using Hitachi 7180 automatic analyzer.

Hematoxylin–Eosin (H&E) Staining

The left renal tissues of each group of rats were collected, fixed with 10% formalin and embedded in paraffin. Then, the paraffin sections (5 µm) were deparaffined and rehydrated. After staining with hematoxylin and eosin (Beyotime, Nantong, China) in turn, the results were viewed using a light microplate.

Cell Culture and Treatment

Human renal tubular epithelial cells (HK-2) were purchased from Procell (Wuhan, China). The cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM)/F12 (Procell) containing 10% fetal bovine serum (FBS, Procell) and 1% penicillin/streptomycin (Procell). Cells were incubated at 37 °C in a humidified atmosphere containing 5% CO₂. For AKI cell model establishment, HK-2 cells were seeded into a 6 well plated at a density of 2 × 10⁵ cells/mL, with 100 µL per well. Then DMEM/F12 containing 5 µg/mL LPS (Procell) was added, and the cells were cultured for 24 h. For AS-IV treatment, the HK-2 cell were cultured in DMEM/F12 containing with 5 µg/mL LPS and different dose of AS-IV (5, 10, 20, 40, 80 µM) for 24 h. For SIRT1 inhibition, the cells were cultured in DMEM/F12 containing with 5 µg/mL LPS, 20 µM AS-IV and 1 µM EX527 for 24 h.

Cell Viability Determination

Cell viability of HK-2 cells was measured using the cell counting kit-8 (CCK-8, Beyotime). In brief, HK-2 cells were seeded into a 96 well plated at a density of 1 × 10⁴ cells/well. After LPS, AS-IV and EX527 treatments, the cells were treated with 10 µL of CCK-8 solution for 2 h. Then the cell viability was assessed by detecting the optical density value at 450 nm using a microplate reader.

Cell Pyroptosis Determination

The HK-2 cells were stained using FLICA 660-YVAD-FMK (Bloomington, MN, U.S.A.) and with propidium iodide (Beyotime) according to manufacturer’s instructions. In brief, HK-2 cells were treated with 1 × FLICA 660 for 1 h in the dark. Next, HK-2 cells were washed with  1× Cellular Wash Buffer and stained with 3 µM PI for 15 min. Finally, the pyroptosis rate of HK-2 cells was analyzed using a FlowJo software (BD Biosciences). The output images included four fields, of which the field with active caspase-1⁺PI⁺ represents pyroptotic cells.

Lactate Dehydrogenase (LDH), Interleukin (IL)-18 and IL-1β Determination

The cells were centrifuged for 10 min (1.6 × 10⁴ ×g) to cell culture supernatant. Then the IL-18 and IL-1β contents were measured by using the IL-18/IL-1β ELISA kit (Solarbio, Beijing, China) as per manufacturer’s instructions. Finally, the absorbance was assessed at 450 nm within 30 min. For LDH activiaty determination, the LDH activity kit was used according to manufacturer’s instructions. The absorbance was assessed at 440 nm within 30 min.

Immunofluorescence (IF) Staining

For IF staining performance, 4% paraformaldehyde was used to fix the HK-2 cells. Next, HK-2 cells were fixed and incubated in primary antibodies (anti-caspase-1, 1 : 1500). Following overnight primary antibody incubation, HK-2 cells were washed with PBS and incubated with secondary antibodies for 1.5 h. Then HK-2 cells were mounted onto slides using Fluoromount Aqueous Mounting Medium (Sigma, U.S.A.). DAPI counter staining was used to visualize the nuclei. Samples were visualized using an inverted fluorescence microscope (TE-2000U, Nikon, Japan).

Western Blot

Western blot assay was carried out to evaluate the Cleaved-caspase-1 (C-caspase-1), GSDMD-N, SIRT1, and FOXO3a protein levels in the HK-2 cells or renal tissues. The protein of cells of tissues were obtained using RIPA solution (Beyotime). After detecting protein concentration with BCA kit (Beyotime), proteins (30 µg) were separated in 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to polyvinylidene difluoride (PVDF) membranes (Beyotime). The membranes were incubated with primary antibodies (anti-C-caspase-1, 1 : 1500; anti-GSDMD-N, 1 : 2000; anti-SIRT1, 1 : 1000; anti-FOXO3a, 1 : 1200; anti-GAPDH, 1 : 3000; Abcam, U.S.A.; anti-acetylated lysine, Arigo Biolaboratories Cor, Shanghai, China) at 4 °C for 12 h, and incubated with secondary antibody at room temperature for 1 h. Finally, the protein bands were visualized using the high sensitive ECL luminescence reagent (Beyotime).

Quantitative Real-Time PCR (qPCR)

Total RNA of HK-2 cells of each group was isolated using Trizol reagent (Invitrogen, Waltham, MA, U.S.A.). Then, a cDNA synthesis kit (TaKaRa, Shiga, Japan) was used to synthesize cDNA. The obtained cDNA samples were used for qPCR by SYBR green master mix (Thermo Scientific, Waltham, MA, U.S.A.). Relative mRNA expression was calculated using the 2^−ΔΔCt method as normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The primers for qPCR are presented as follows (5′–3′): SIRT1 forward primer CGGACAAACGGCTCACTCT, reverse primer GGACCCGCATGAATCGACTAT; FOXO3a forward primer CGGACAAACGGCTCACTCT, reverse primer GGACCCGCATGAATCGACTAT; GAPDH forward primer GGAGCGAGATCCCTCCAAAAT, reverse primer GGCTGTTGTCATACTTCTCATGG.

Immunoprecipitation (IP) Assay

For detecting the acetylation levels of FOXO3a, HK-2 cells were lysed using the IP lysis buffer and the supernatant was collected. The lysate was incubated with 1 µg anti-FOXO3a and 50 µL protein A agarose beads overnight at 4 °C. The beads were eluted and washed with lysis buffer. After adding 15 µL 2 × SDS buffer, the samples were boiled for SDS-PAGE. Western blot was used to measure the acetylation levels of FOXO3a.

Co-immunoprecipitation (Co-IP)

The endogenous binding of SIRT1 with FOXO3a was detected by Co-IP. SIRT1 and FOXO3a gene sequences were amplified by PCR using primers containing EcoRI/XhoI cleavage sites, and Flag (ab205606, Abcam) and HA tag (ab236632, Abcam) sequences were introduced at the 5′ end. PCR products are purified using a DNA purification kit (Qiagen QIAquick PCR Purification Kit, QIAGEN, Venlo, the Netherlands) to remove primers, deoxyribonucleotide triphosphates (dNTPs), and enzymes. T4 DNA ligase was used to connect the fragments of Flag-SIRT1 and HA-FOXO3a to pcDNA3.1 vector, respectively. At 70–80% confluence, HK-2 cells were transfected with Flag-SIRT1 and HA-FOXO3a plasmids, either individually or co-transfected, using Lipofectamine 3000 reagent following the manufacturer’s instructions. Cells were incubated for 48 h post-transfection to allow protein expression. Transfected cells were harvested and lysed in ice-cold IP lysis buffer (containing protease and phosphatase inhibitors) using gentle agitation. Lysates were centrifuged to remove debris. Cleared lysates were incubated overnight at 4 °C with anti-Flag magnetic beads to pull down Flag-SIRT1 along with any interacting proteins. Control samples included beads incubated with lysate from cells expressing HA-FOXO3a alone to assess nonspecific binding. Beads were washed extensively with lysis buffer to remove unbound proteins. Interacting proteins were eluted using Flag peptide or denaturing conditions, depending on downstream analysis requirements. Eluates were subjected to SDS-PAGE and transferred to PVDF membranes for Western blot analysis.

Molecular Docking Analysis

The three-dimensional structure of SIRT1 was downloaded from the protein database (http: www.rcsb.org/pbd) and imported into Discovery Studio 3.0 software. The water molecules around the protein were then removed and the incomplete amino acid residues in the protein crystal was filled, and defined as the receptor, Then the three-dimensional structure of AS-IV was constructed in the software and defined as a ligand. Finally, CB-DOCK software (http://clab.Labshare.cn/cb-dock/php/blinddock.php) was used to perform molecular docking between AS-IV and SIRT1.

SIRT1 Promoter Activity Detection

Cloning of SIRT1 gene promoter region (chromosome 10, 67882656bp to 67884656) into luciferase reporter gene vector pGL3-Basic. The constructed luciferase reporter gene vector was transfected into cells using Lipofectamine 3000 (Thermo Scientific). Renilla luciferase plasmid (pRL-TK) was transfected as an internal parameter to standardize transfection efficiency. Twenty-four through forty-eight hours after transfection, cells were divided into control group and AS-IV treatment group to detect SIRT1 promoter activity under different conditions. Luciferase Reporter Assay System (Promega, Madison, WI, U.S.A.) was used to detect luciferase activity according to kit instructions.

Statistical Analysis

Statistical analyses were conducted with GraphPad Prism 8.0 software (GraphPad, La Jolla, CA, U.S.A.). Data were represented as the mean ± standard deviation (S.D.). Quantitative data were compared using two-tail Student t-test or one-way ANOVA. Statistical significance was defined as p < 0.05

Results

Screening of AS-IV Concentration in Vitro

First, the HK-2 cells were treated with different dose of AS-IV (5, 10, 20, 40, 80 µM) to selected the optimal dose. The chemical structure of AS-IV was showed in Fig. 1A. After 40 µM and 80 µM AS-IV treatment, the cell viability of HK-2 cells was significantly decreased, and 5, 10, 20 µM AS-IV has no significant effect on cell viability (Fig. 1B). Therefore, 5, 10, 20 µM AS-IV was used for next experiments.

Fig. 1. Screening of AS-IV Concentration in Vitro

(A) The chemical structure of AS-IV. (B) The cell viability of HK-2 cells was detected by CCK-8 assay after AS-IV (5, 10, 20, 40, 80 µM) treatment, n = 3.

AS-IV Inhibited the Pyroptosis of LPS Stimulated HK-2 Cells

Then, HK-2 cells were stimulated with LPS to establish the AKI model in vitro. After LPS stimulation, the cell viability (Fig. 2A) of HK-2 cells was significantly decreased, while pyroptosis rate (Figs. 2B, C) and LDH activity (Fig. 2D) were significantly increased. After AS-IV treatment, the cell viability (Fig. 2A) of LPS stimulated HK-2 cells was significantly increased, and pyroptosis rate (Figs. 2B, C) and LDH activity (Fig. 2D) were significantly decreased. Besides, IF staining showed that LPS stimulated decreased the Caspase-1 levels in the HK-2 cells, while AS-IV treatment increased it (Fig. 2E). Furthermore, we found LPS stimulation significantly increased the protein levels of C-caspase-1 and GSDMD-N (Figs. 2F, G), and IL-1β (Fig. 2H) and IL-18 (Fig. 2I) contents in the HK-2 cells, while AS-IV treatment significantly decreased them. Importantly, we found that 5 µM AS-IV had no significant effect on pyroptosis of LPS stimulated HK-2 cells, and 20 µM AS-IV had the best inhibitory effect on pyroptosis of LPS stimulated HK-2 cells.

Fig. 2. AS-IV Inhibited the Pyroptosis of LPS Stimulated HK-2 Cells

The HK-2 cells were stimulated with 5 µg/mL LPS and treated with 5, 10, 20 µM AS-IV. (A) The cell viability was detected by CCK-8 assay, n = 3. (B, C) The pyroptosis was determined by flow cytometry, n = 3. (D) LDH activity was detected by kit, n = 3. (E) Caspase-1 levels were detected by immunofluorescence staining, n = 3. (F, G) Protein levels of C-caspase-1 and GSDMD-N were detected by Western blot, n = 3. The IL-1β (H) and IL-18 (I) contents were detected by ELISA kits, n = 3.

AS-IV Inhibited the Pyroptosis in Vivo

Subsequently, we further explored the role of AS-IV in vivo. The HE staining results showed that the structure of glomeruli and renal tubules in control group rats is clear and complete, and there are no abnormalities in morphological structure. Compared with the control group, the kidney tissue of AKI group rats showed significant pathological changes, mainly manifested as renal tubular dilation and necrosis, protein precipitation, and inflammatory cell infiltration in the renal interstitium. After AS-IV treatment, the necrosis of renal tubular epithelial cells was decreased and no significant inflammatory infiltration was observed (Fig. 3A). Furthermore, BUN and SCR levels, indicative of kidney dysfunction, increased in AKI group were markedly decreased in the treatment groups, suggesting preserved renal function (Fig. 3C). Besides, the protein levels of IL-1β (Fig. 3D), IL-18 (Fig. 3E), C-caspase-1 and GSDMD-N (Figs. 3F, G) were significantly increased in the renal tissues of AKI rats, while AS-IV treatment significantly decreased them. These results further conformed the inhibitory effect of AS-IV on pyroptosis in vivo.

Fig. 3. AS-IV Inhibited the Pyroptosis in Vivo

The AKI rats were treated with 5 mg/kg and 10 mg/kg AS-IV. (A) The pathological structure of renal tissue was analyzed by HE staining; blue arrow: tubular epithelial necrosis, yellow arrow: massive inflammatory infiltration of the peritubular interstitium, red arrow: tubular leukocyte types (neutrophils, monocytes). (B, C) BUN and SCR levels, indicative of kidney dysfunction, were measured, n = 3. The IL-1β (D) and IL-18 (E) contents in the renal tissues were detected by ELISA kit, n = 3. (F, G) The protein levels of C-caspase-1 and GSDMD-N in the renal tissues were detected by Western blot, n = 3.

AS-IV Relieved the Injury of LPS Stimulated HK-2 Cells through Upregulating the SIRT1 Levels

SIRT1 has been demonstrated to relieve the AKI progression by many researches.^27–29) Here, we further analyzed the effects of AS-IV on the SIRT1 levels. The molecular docking analysis demonstrated that AS-IV could bind to SIRT1 (GLU-416, ASP-204, ALA-262) (Figs. 4A–C). AS-IV treatment significantly elevated the luciferase activity of SIRT1 (Fig. 4D). Furthermore, LPS stimulation significantly decreased the mRNA (Fig. 4E) and protein (Figs. 4F, G) levels in the HK-2 cells, while AS-IV treatment significantly increased them. Additionally, in order to further verify the implication of the SIRT1 in LPS stimulated HK-2 cells, EX527, a known specific SIRT1 inhibitor,³⁰⁾ was used to treat the cells. The results showed after EX527 treatment in the AS-IV treated and LPS stimulated HK-2 cells, the cell viability was decreased (Fig. 5A), while pyroptosis rate (Figs. 5B, C), LDH activity (Fig. 5D), Caspase-1 levels (Fig. 5E), protein levels of C-caspase-1 and GSDMD-N (Figs. 5F, G), and IL-1β (Fig. 5H) and IL-18 (Fig. 5I) contents were significantly decreased. These results indicated that AS-IV treatment inhibited pyroptosis rate of LPS stimulated HK-2 cells through targeting SIRT1, and SIRT1 inhibition reversed the role of AS-IV.

Fig. 4. AS-IV Regulated SIRT1 Levels

(A–C) The molecular docking analysis between AS-IV and SIRT1. The HK-2 cells were stimulated with 5 µg/mL LPS and treated with 20 µM AS-IV. (D) The luciferase activity of SIRT1 in HK-2 cells treated with or without AS-IV, n = 3. The mRNA (E) and protein (F, G) levels of SIRT1 were detected by RT-qPCR and Western blot assays, n = 3.

Fig. 5. SIRT1 Inhibition Reversed the Role of AS-IV in LPS Stimulated HK-2 Cells

The HK-2 cells were treated with 5 µg/mL LPS, 20 µM AS-IV and 1 µM EX527. (A) The cell viability was detected by CCK-8 assay, n = 3. (B, C) The pyroptosis was determined by flow cytometry, n = 3. (D) LDH activity was detected by kit, n = 3. (E) Caspase-1 levels were detected by immunofluorescence staining, n = 3. (F, G) Protein levels of C-caspase-1 and GSDMD-N were detected by Western blot, n = 3. The IL-1β (H) and IL-18 (I) contents were detected by ELISA kits, n = 3.

AS-IV Regulated SIRT1 Mediated Acetylation Levels of FOXO3a

The deacetylase activity of SIRT1 has been confirmed to be a key factor in its involvement in disease progression. Previous study found SIRT1 could regulate the downstream expression of FOXO3a, thereby participating in the regulation of cellular biological behavior.^23,31) Here, we found that FOXO3a was decreased in the LPS stimulated HK-2 cells, while AS-IV treatment increased it (Fig. 6A). In addition, the protein levels of FOXO3a were decreased, while acetylation levels of FOXO3a were increased in the LPS stimulated HK-2 cells. AS-IV treatment increased the protein levels of FOXO3a and decreased acetylation levels of FOXO3a (Figs. 6B–D). Besides, EX527 treatment reversed the effects of AS-IV on the protein and acetylation levels of FOXO3a in LPS stimulated HK-2 cells (Figs. 6E–G). Furthermore, CO-IP (Fig. 6H) and IF (Fig. 6I) assays confirmed that SIRT1 interacted with FOXO3a. These results indicated that AS-IV increased the FOXO3a levels through targeting SIRT1 mediated acetylation modification.

Fig. 6. AS-IV Regulated SIRT1 Mediated Acetylation Levels of FOXO3a

(A) The mRNA levels of FOXO3a in the 5 µg/mL LPS and 20 µM AS-IV treated HK-2 cells were detected by RT-qPCR, n = 3. (B–D) The protein and acetylation levels of FOXO3a in the 5 µg/mL LPS and 20 µM AS-IV treated HK-2 cells were detected by Western blot, n = 3. (E–G) The protein and acetylation levels of FOXO3a in the 5 µg/mL LPS, 20 µM AS-IV and 1 µM EX527 treated HK-2 cells were detected by Western blot, n = 3. The relationship between SIRT1 and FOXO3a was demonstrated by CO-IP assay (H) and immunofluorescence staining (I).

Discussion

Currently, the pathogenesis of AKI is complex and inconclusive. Many researches confirmed excessive inflammatory response was the core link in the occurrence and development of AKI, which further led to the occurrence of cell pyroptosis.^11,32) Here, we found that AS-IV treatment inhibited the pyroptosis occurrence in LPS stimulated HK-2 cells and rats through regulating the SIRT1 mediated deacetylation of FOXO3a.

Both acute and chronic kidney injury have special aseptic inflammation, which is closely related to the body’s immune system.³³⁾ The unique feature of cell pyroptosis is the induction of a cascade of amplified inflammatory responses.³⁴⁾ In the past decade, many studies have found that inhibiting the occurrence of cell pyroptosis can alleviate the progression of AKI induced by various factors. For instance, Lan et al.³⁵⁾ demonstrated that WTAP knockdown decreased the m6A methylation of NLRP3 and inhibited NLRP3 inflammasome activation, which further relieved cell pyroptosis and inflammation in Diabetic nephropathy induced kidney injury. Ding et al.³⁶⁾ found that bufalin attenuates pyroptosis generated AKI by inhibiting pyroptosis-related markers expression. In ischemia-reperfusion induced AKI, Wang et al.³⁷⁾ found Inhibiting miR-92a-3p can suppress protein expression levels of IL-18, IL-1β, Caspase-1, and GSDMD-N in vitro and in vivo, which further decreased pyroptosis rate of renal tubular epithelial cell and alleviated AKI progression. AS-IV was demonstrated to inhibited pyroptosis in myocardial infarction,³⁸⁾ PM2.5-caused lung toxicity,³⁹⁾ doxorubicin-induced myocardial injury,¹⁹⁾ etc. In AKI progression, Gui et al. reported that AS-IV might be a novel therapeutic approach to treat AKI through inhibiting oxidative stress and apoptosis.⁴⁰⁾ However, whether AS-IV can inhibit cell pyroptosis in the development of AKI has not been reported yet. Here, we found that AS-IV treatment inhibited the pyroptosis in vivo and in vitro, which was manifested as inhibition of pyroptosis marker protein expression (C-caspase-1 and GSDMD-N), IL-1β and IL-18 contents. These findings further indicated other therapeutic mechanisms of AS-IV in the progression of AKI.

Subsequently, we further analyzed the specific mechanism by which AS-IV inhibits pyroptosis. SIRT1, a class III histone deacetylase, is widely expressed in a variety of cell types, and affects the physiological activities of cells by regulating deacetylation status of proteins.⁴¹⁾ AS-IV has been demonstrated to increase the SIRT1 levels in cerebral ischemia/reperfusion injury,⁴²⁾ vascular endothelial dysfunction,⁴³⁾ subcortical ischemic vascular dementia,²⁰⁾ etc. Similarly, here, we also demonstrated AS-IV treatment increased the SIRT1 levels in the LPS stimulated HK-2 cells. The targeted regulation of AS-IV on SIRT1 was further confirmed by molecular docking. The SIRT1 promoter activity was significantly promoted after AS-IV treatment. Increasing the activity of SIRT1 promoter helps to enhance the regulation of SIRT1. For example, it has been reported that the enhancement of SIRT promoter activity is related to the growth traits of chickens.⁴⁴⁾ Additionally, after EX527 treatment, the effects of AS-IV on pyroptosis of LPS stimulated HK-2 cells were reversed. Recently, the deacetylation modification of target proteins is key to SIRT1’s involvement in disease progression.⁴⁵⁾ It has been confirmed that SIRT1 activated transcriptional activity of FOXO3a through deacetylation modification, thus regulating cell growth and death.^46,47) Here, we further confirmed that AS-IV treatment increased the FOXO3a levels in the LPS stimulated HK-2 cells, which was reversed after EX527 treatment. Besides, at the same time as the expression of FOXO3a increased, we detected a decrease in its acetylation level. We speculated that this might be due to increased expression of SIRT1 after AS-IV treatment. As we hypothesized, the acetylation level of FOXO3a was significantly increased after EX527 treatment. Furthermore, the interaction relationship between SIRT1 and FOXO3a was confirmed by CO-IP assay. All these results indicated that AS-IV ultimately participated in the regulation of HK-2 cell pyroptosis by regulating SIRT1 mediated FOXO3a deacetylation modification.

In conclusion, this study demonstrated AS-IV inhibited the occurrence of pyroptosis in the LPS stimulated HK-2 cells, and relieved the AKI progression in the LPS stimulated rats. Inhibition the SIRT1 reversed the role of AS-IV in LPS stimulated HK-2 cells, this may be related to the SIRT1 mediated deacetylation of FOXO3a. The development of this study provides a solid theoretical basis for the future application of AS-IV in the clinical treatment of AKI.

Funding

The work was supported by The Regional Science Foundation Project of National Natural Science Foundation of China under Grant Number 82360884; Key Project of Gansu Provincial Administration of Traditional Chinese Medicine under Grant Number: GZKZ-2022-3.

Author Contributions

All authors participated in the design, interpretation of the studies and analysis of the data and review of the manuscript. C Z and Y Q drafted the work and revised it critically for important intellectual content; F X was responsible for the acquisition, analysis and interpretation of data for the work; J L made substantial contributions to the conception or design of the work. All authors read and approved the final manuscript.

Conflict of Interest

The authors declare no conflict of interest.

Data Availability

The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.

References

• 1) Peerapornratana S., Manrique-Caballero C. L., Gómez H., Kellum J. A., Kidney Int., 96, 1083–1099 (2019).
• 2) Farah R. I., Alfuqaha O. A., Younes A. R., Mahmoud H. A., Al-Jboor A. M., Karajeh M. M., Al-Masadeh M. Z., Murad O. I., Obeidat N., Schiavoni L., Crit. Care Res. Pract., 2023, 9966760 (2023).
• 3) Wang B., Xu J., Ren Q., Cheng L., Guo F., Liang Y., Yang L., Tan Z., Fu P., Ma L., Cell Death Dis., 13, 333 (2022).
• 4) Katsoulis O., Georgiadou A., Cunnington A. J., Front. Immunol., 12, 651739 (2021).
• 5) Sun J., Ge X., Wang Y., Niu L., Tang L., Pan S., Pharmacol. Res., 176, 105962 (2022).
• 6) Song Z., Zhang Y., Gong B., Xu H., Hao Z., Liang C., J. Cell. Biochem., 120, 10452–10462 (2019).
• 7) Wang K., Sun Q., Zhong X., Zeng M., Zeng H., Shi X., Li Z., Wang Y., Zhao Q., Shao F., Ding J., Cell, 180, 941–955.e20 (2020).
• 8) Robinson N., Ganesan R., Hegedűs C., Kovács K., Kufer T. A., Virág L., Redox Biol., 26, 101239 (2019).
• 9) Wei X., Xie F., Zhou X., Wu Y., Yan H., Liu T., Huang J., Wang F., Zhou F., Zhang L., Cell. Mol. Immunol., 19, 971–992 (2022).
• 10) Baatarjav C., Komada T., Karasawa T., Yamada N., Sampilvanjil A., Matsumura T., Takahashi M., Cell Death Differ., 29, 2487–2502 (2022).
• 11) Xia W., Li Y., Wu M., Jin Q., Wang Q., Li S., Huang S., Zhang A., Zhang Y., Jia Z., Cell Death Dis., 12, 139 (2021).
• 12) Li Z., Qi J., Guo T., Li J., J. Ethnopharmacol., 305, 116086 (2023).
• 13) Yoshino T., Horiba Y., Mimura M., Watanabe K., Front. Pharmacol., 13, 775798 (2022).
• 14) Lu L., Lu J., Chen J., Wang B., Peng H., Peng J., Liu X., Lin F., Xiong G., Front. Pharmacol., 14, 1103527 (2023).
• 15) Chen G., Jiang N., Zheng J., Hu H., Yang H., Lin A., Hu B., Liu H., Int. J. Biol. Macromol., 241, 124386 (2023).
• 16) Liu S., Wang W., Chen J., Ma Z., Xiao Y., Chen Z., Zhang Y., Du X., Mu Y., Front. Plant Sci., 13, 1013443 (2022).
• 17) Liu P., Peng Q. H., Tong P., Li W. J., Mol. Med., 25, 21 (2019).
• 18) Wang L., Liu C., Wang L., Tang B., Eur. J. Pharmacol., 944, 175516 (2023).
• 19) Chen X., Tian C., Zhang Z., Qin Y., Meng R., Dai X., Zhong Y., Wei X., Zhang J., Shen C., Astragaloside I. V., Front. Biosci. (Landmark Ed.), 28, 45 (2023).
• 20) Ma J., Chen T., Wang R., Neurochem. Int., 167, 105535 (2023).
• 21) Yang Y., Liu Y., Wang Y., Chao Y., Zhang J., Jia Y., Tie J., Hu D., Front. Immunol., 13, 831168 (2022).
• 22) Shen P., Deng X., Chen Z., Ba X., Qin K., Huang Y., Huang Y., Li T., Yan J., Tu S., Front. Immunol., 12, 779177 (2021).
• 23) Bordbari S., Morchen B., Pylaeva E., Siakaeva E., Spyra I., Domnich M., Droege F., Kanaan O., Lang K. S., Schadendorf D., Lang S., Helfrich I., Jablonska J., Int. J. Cancer, 150, 1198–1211 (2022).
• 24) Li L., Liu X., Li S., Wang Q., Wang H., Xu M., An Y., Ren. Fail., 43, 1028–1040 (2021).
• 25) Gao D., Wang H., Xu Y., Zheng D., Zhang Q., Li W., Int. Urol. Nephrol., 51, 351–358 (2019).
• 26) Zhang J., Yang S., Chen F., Li H., Chen B., Cell Biosci., 12, 100 (2022).
• 27) Deng Z., Sun M., Wu J., Fang H., Cai S., An S., Huang Q., Chen Z., Wu C., Zhou Z., Hu H., Zeng Z., Cell Death Dis., 12, 217 (2021).
• 28) Qiongyue Z., Xin Y., Meng P., Sulin M., Yanlin W., Xinyi L., Xuemin S., Front. Pharmacol., 13, 857067 (2022).
• 29) Raji-amirhasani A., Khaksari M., Darvishzadeh Mahani F., Hajializadeh Z., Clin. Exp. Nephrol., 25, 807–821 (2021).
• 30) Sun H., Xiong S., Cao X., Cao L., Zhu M., Wu Z., Bian J., Redox Biol., 38, 101813 (2021).
• 31) Dilmac S., Kuscu N., Caner A., Yildirim S., Yoldas B., Farooqi A. A., Tanriover G., Int. J. Mol. Sci., 23, 10227 (2022).
• 32) Jiao Y., Zhang T., Zhang C., Ji H., Tong X., Xia R., Wang W., Ma Z., Shi X., Crit. Care, 25, 356 (2021).
• 33) Abdulla M. H., Johns E. J., Acta Physiol. (Oxf.), 220, 404–416 (2017).
• 34) Guerrero-Mauvecin J., Villar-Gómez N., Rayego-Mateos S., Ramos A. M., Ruiz-Ortega M., Ortiz A., Sanz A. B., Front. Immunol., 14, 1324996 (2023).
• 35) Lan J., Xu B., Shi X., Pan Q., Tao Q., Cell. Mol. Biol. Lett., 27, 51 (2022).
• 36) Ding L., Yin J., Xu X., Xie D., Xiang D., Tong P., Liu S., Yang X., Apoptosis, 28, 539–548 (2023).
• 37) Wang R., Zhao H., Zhang Y., Zhu H., Xiao C., Front. Genet., 11, 616947 (2021).
• 38) Zhang X., Qu H., Yang T., Liu Q., Zhou H., Cell Cycle, 21, 2309–2322 (2022).
• 39) Huang D., Shi S., Wang Y., Wang X., Shen Z., Wang M., Pei C., Wu Y., He Y., Wang Z., Biomed. Pharmacother., 150, 112978 (2022).
• 40) Gui D., Huang J., Liu W., Guo Y., Xiao W., Wang N., Apoptosis, 18, 409–422 (2013).
• 41) Lu C., Zhao H., Liu Y., Yang Z., Yao H., Liu T., Gou T., Wang L., Zhang J., Tian Y., Yang Y., Zhang H., Int. J. Biol. Sci., 19, 484–501 (2023).
• 42) Shi Y. H., Zhang X. L., Ying P. J., Wu Z. Q., Lin L. L., Chen W., Zheng G. Q., Zhu W. Z., Front. Pharmacol., 12, 639898 (2021).
• 43) Zhao F., Meng Y., Wang Y., Fan S., Liu Y., Zhang X., Ran C., Wang H., Lu M., Front. Pharmacol., 13, 920977 (2022).
• 44) Liu D., Liu X., Ma X., Li C., Li J., Li Q., Zhang N., Cao Y., Li Z., Kang X., Tian Y., Li W., Br. Poult. Sci., 63, 445–453 (2022).
• 45) Chen H., Lin X., Yi X., Liu X., Yu R., Fan W., Ling Y., Liu Y., Xie W., Int. J. Hyperthermia, 39, 977–986 (2022).
• 46) Dusabimana T., Kim S. R., Kim H. J., Park S. W., Kim H., Exp. Mol. Med., 51, 1–16 (2019).
• 47) Chen L., Li S., Zhu J., You A., Huang X., Yi X., Xue M., J. Cell. Mol. Med., 25, 2944–2955 (2021).