Inhibition of adenosine monophosphate-activated protein kinase suppresses bone morphogenetic protein-2-induced mineralization of osteoblasts via Smad-independent mechanisms

Abstract

Previous studies showed that adenosine monophosphate-activated protein kinase (AMPK), which plays as an intracellular energy sensor, promotes the differentiation and mineralization of osteoblasts via enhancing expression of bone morphogenetic protein (BMP)-2, which is a potent inducer of osteoblastogenesis. Thus, the aim of this study was to examine the roles of AMPK in BMP-2-induced osteoblastogenesis. We used a murine osteoblastic cell line MC3T3-E1 and a murine marrow stromal cell line ST2. BMP-2 (50 and 100 ng/mL) stimulated alkaline phosphatase (ALP) activity and enhanced mineralization of MC3T3-E1 cells, while the effects of BMP-2 were partly abolished by an inhibitor of AMPK, ara-A (0.1 mM). Real-time PCR showed that BMP-2 significantly increased the mRNA expressions of Alp, osteocalcin (Ocn), Runx2, Osterix and Dlx-5 in MC3T3-E1 cells, while co-incubation of ara-A significantly decreased the BMP-2-stimulated expression of Alp, Ocn, and Runx2. Moreover, co-incubation of ara-A suppressed the BMP-2-induced upregulation of Alp and Ocn in ST2 cells. Western blot analysis showed that BMP-2 phosphorylated Smad1/5 although it did not affect AMPK phosphorylation in MC3T3-E1 cells. Furthermore, a BMP receptor inhibitor LDN-193189 inhibited the phosphorylation of Smad1/5, but did not affect AMPK. In addition, co-incubation of ara-A did not affect BMP-2-induced phosphorylation of Smad1/5. These findings suggest that the inhibition of AMPK activation reduces the osteo-inductive effects of BMP-2 by decreasing the expression of Alp, Ocn, and Runx2 through Smad-independent mechanisms in osteoblastic cells.

BONE MORPHOGENETIC PROTEINS (BMPs) belong to transforming growth factor-β superfamily, bind to BMP receptors and transduce signals [1, 2]. BMPs are known to be powerful osteo-inductive cytokines, and numerous studies have shown that BMP-2, one of BMP family members, enhances osteoblastic differentiation and mineralization through Smad signals and non-Smad pathways such as mitogen-activated protein kinase (MAPK) [1, 2]. BMP-2 increases expressions of transcription factors such as runt-related transcription factor 2 (Runx2), osterix (Osx) and Dlx-5, which are essential regulators of osteoblast differentiation, resulting in promoting osteoblastic differentiation [1, 2].

Adenosine monophosphate-activated protein kinase (AMPK) is a serine/threonine kinase and associated with regulation of energy homeostasis [3, 4]. Accumulating evidence has shown that AMPK is involved in bone remodeling. AMPK is activated during early osteoblast differentiation, and it is reported that the AMPK activation is required for normal bone formation and remodeling [5-7]. We and other researchers have previously demonstrated that AMPK activation promotes osteoblast differentiation and mineralization [5, 8-13]. Moreover, the effect of AMPK on osteoblast differentiation is mediated by increasing expression of BMP-2 [9, 10, 14]. Huang et al. showed that adiponectin, an adipokine, increased the expression of BMP-2, but not other BMPs, through AMPK activation in human osteoblast-like cell lines MG-63 and hFOB [14]. We also demonstrated that AMPK activation induced the phosphorylation of ERK and Akt signaling pathways and inhibited the cholesterol synthetic mevalonate pathway to increase BMP-2 expression [9]. Furthermore, Jang et al. reported that AMPK activation induced the phosphorylation of Smad1/5/8, which is an important downstream molecule of BMP-2 signal, and increased the expression of Dlx-5, Runx2, and Osx, resulting in promotion of osteoblast differentiation in MC3T3-E1 cells [15]. These results indicate that AMPK may stimulate osteoblast differentiation by not only increasing expression of BMP-2 but also enhancing its signaling molecule Smad1/5/8. However, there are no studies investigating whether AMPK signal is involved in the osteo-inductive effect of BMP-2 and vice versa. In this study, we thus aimed to investigate whether AMPK is required for BMP-2-induced osteogenic effects in osteoblastic differentiation and mineralization.

Materials and Methods

Reagents

Cell culture medium and supplements were purchased from GIBCO-BRL (Rockville, MD). Recombinant hu­man BMP-2 was purchased from Peprotech (Offenbach, Germany). An AMPK inhibitor, ara-A, and an inhibitor of BMP type I receptors, LDN-193189 hydrochloride, were purchased from Sigma-Aldrich (St. Louis, MO). Antibodies against phospho-AMPKα (Thr172), total AMPKα, phopsho-Smad1/5 and total Smad1 were purchased from Cell Signaling (Beverly, MA). Anti-β actin antibody, and horseradish peroxidase-coupled anti-rabbit and anti-mouse IgG were purchased from Sigma-Aldrich. All other chemicals were of the highest grade available commercially.

Cell cultures

MC3T3-E1 cells, a clonal osteoblastic cell line iso­lated from calvaria of late stage mouse embryo, and ST2 cells, a mouse bone mallow-derived stromal cell line, were obtained from RIKEN Cell Bank (Tsukuba, Japan). The cells were cultured in α-minimum essential medium (α-MEM) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin in 5% CO₂ at 37°C. The medium was changed twice a week, and the cells were passaged when they were 80% confluence. For mineralization assay of MC3T3-E1, cells were cultured in α-MEM supplemented with 10% FBS, 1% penicillin-streptomycin, 10 mM β-glycerophosphate, and 50 mg/L ascorbic acid for 14 and 21 days after reaching confluence.

Mineralization stainings

The mineralization of MC3T3-E1 cells was determined in 6-well plates using von Kossa staining and Alizarin red staining. The cells were stained with 2% AgNO₃ and fixed with 2.5% NaS₂O₃ by the von Kossa method to detect phosphate deposits in bone nodules [4]. At the same time, the order plates were fixed with ice-cold 70% ethanol and stained with Alizarin red to detect calcification [4].

Assay of alkaline phosphatase activity

Alkaline phosphatase (ALP) activity was measured by using LabAssay^TM ALP kit (Wako pure chemical industries, Osaka, Japan). MC3T3-E1 cells were plated in 6-well plates and cultured. After reaching confluence, the cells were treated with BMP-2 and/or ara-A for 5 days. Then, the cells were washed twice with phosphate buffered sa­line (PBS) and 0.05% Triton X-100 200 μL was added to each well. Freezing and thawing were repeated twice. The solution in the wells were collected in tubes and centrifuged for 15 min at 15,000 rpm. The sample 20 μL and working assay solution 100 μL was added to a well of a 96-well plate. Then, the plate was shaken for 1 min, thereafter incubated for 15 min at 37°C. Stop solution 80 μL was added and the absorbance at 405 nm was mea­sured with a microplate reader. The results are expressed as relative to control.

Western blot analysis

For western blot analysis, MC3T3-E1 cells were plated in 6-well plates and cultured. After reaching con‍fluence, the cells were treated with BMP-2 and/or ara-A for up to 24 h. The cells were rinsed with ice-cold PBS and scraped on ice into lysis buffer (BIO-RAD, Her‍cules, CA) containing 65.8 mM Tris-HCl (pH 6.8), 26.3% (w/v) glycerol, 2.1% SDS, and 0.01% bromophenol blue to which 2-mercaptoethanol was added to achi­eve a final concentration of 5%. The cell lysates were sonicated for 20 s. The cell lysates were electrophoresed using 10% SDS-PAGE and transferred to a nitrocellulose membrane (BIO-RAD, Hercules, CA). The blots were blocked with TBS containing 1% Tween 20 (BIO-RAD) and 3% bovine serum albumin (BSA) for 1 h at 4°C. Then, the blots were incubated overnight at 4°C with gentle shaking with antibodies at a dilution of 1:1,000. These blots were extensively washed with TBS containing 1% Tween 20 and were further incubated with a 1:5,000 dilution of horseradish peroxidase-coupled anti-rabbit and anti-mouse IgG in TBS for 50 min at 4°C. The blots were then washed, and the signal was visualized using an enhanced chemiluminescence technique.

Quantification of gene expression using real-time PCR

We used SYBR green chemistry to determine the mRNA levels of Alp, type 1 collagen (Col-I), osteocalcin (Ocn), Runx2, Osx and Dlx-5. The primer sequences are described in Table 1. Real-time PCR was performed using 1 μL of cDNA in a 25 μL reaction volume with ABI PRISM 7000 (Applied Biosystems, Waltham, MA). The double-stranded DNA-specific dye SYBR Green I was incorporated into the PCR buffer provided in the SYBR Green Real-time PCR Master Mix (Toyobo Co. Ltd., Tokyo, Japan) to enable quantitative detection of the PCR product. The PCR conditions were 95°C for 15 min, 40 cycles of denaturation at 94°C for 15 s, and annealing and extension at 60°C for 1 min. 36B4, a housekeeping gene, was used to normalize the differences in the efficiencies of reverse transcription.

Table 1

Gene name	primers	Accession no.
36b4	AAGCGCGTCCTGGCATTGTCT CCGCAGGGGCAGCAGTGGT	NM_007475
Alp	CCGATGGCACACCTGCTT GAGGCATACGCCATCACATG	X13409
Col-1	AACCCGAGGTATGCTTGATCT CAGTTCTTCATTGCATTGC	NM_007742
Ocn	TGCTTGTGACGAGCTATCAG GAGGACAGGGAGGATCAAGT	L24431
Runx2	AAGTGCGGTGCAAACTTTCT TCTCGGTGGCTGGTAGTGA	NM_009820
Osx	CCCTTCTCAAGCACCAATGG AGGGTGGGTAGTCATTTGCATAG	AF184902
Dlx-5	CACCACCCGTCTCAGGAATC GCTTTGCCATAAGAAGCAGAGG	U67840.1

Statistics

Results are expressed as means ± standard error (SE). Statistical evaluations for differences between groups were performed using one-way ANOVA followed by Fisher’s protected least significant difference. For all statistical tests, a value of p < 0.05 was considered a sta­tistically significant difference.

Results

The effects of BMP-2 and an AMPK inhibitor, ara-A, on the mineralization and ALP activity of MC3T3-E1 cells

We examined the effects of BMP-2 and an AMPK inhibitor, ara-A, on the mineralization of MC3T3-E1 cells by using von Kossa and Alizarin Red stainings (Fig. 1A, B). Treatment with ara-A 0.1 mM alone decreased mineralization at days 14 and 21. Treatments with BMP-2 (50 and 100 ng/mL) enhanced the mineralization at days 14 and 21, which was partially inhibited by co-incubation with ara-A. The higher magnification (×100) of Alizarin red staining at days 21 also showed that BMP-2 100 ng/mL markedly increased formation of calcified nodules, and that ara-A 0.1 mM suppressed the formation of calcified nodules regardless of the presence of BMP-2 (Fig. 1C).

Fig. 1

The effects of BMP-2 and an AMPK inhibitor, ara-A, on the mineralization and ALP activity in MC3T3-E1 cells

Representative pictures of von Kossa and Alizarin red stainings (A and B). After reaching confluence, MC3T3-E1 cells were incubated in osteo-inductive medium with BMP-2 (50 and 100 ng/mL) and/or ara-A (0.1 mM). Mineralization was examined by von Kossa staining and Alizarin red staining at days 14 (A) and 21 (B). The higher magnification (×100) of Alizarin red staining at day 21 was also shown (C). For measurement of ALP activity (D), the cells were cultured in 96-well plates. After reaching confluence, the cells were incubated with BMP-2 (50 and 100 ng/mL) and/or ara-A 0.1 mM for 5 days, then measurement procedures were performed. The results are expressed as mean ± SE (n = 11). *; p < 0.05, **; p < 0.01, ***; p < 0.001.

We examined ALP activity at day 5. BMP-2 significantly and dose-dependently increased ALP activity. Ara-A 0.1 mM significantly suppressed the ALP activity regardless the presence of BMP-2 (Fig. 1D). The effect of ara-A on ALP activity was very similar to those of mineralization stainings.

The effects of BMP-2 and an AMPK inhibitor, ara-A, on expressions of osteoblast differentiation markers in MC3T3-E1 cells and ST2 cells

Next, we examined the expressions of osteoblast differentiation markers Alp, Col-1 and Ocn in MC3T3-E1 cells. Treatment with BMP-2 (25 and 50 ng/mL) for 48 h significantly increased the mRNA expressions of Alp and Ocn (Fig. 2A, C), but not Col-I (Fig. 2B). Although ara-A alone had no effects on the expressions of Alp, Col-1 and Ocn mRNA expressions, co-incubation with ara-A significantly suppressed BMP-2-induced up-regulation of Alp and Ocn (Fig. 2A, C). Moreover, we examined the effects of BMP-2 and ara-A on the expressions of crucial regulators of osteoblast differentiation, Runx2, Osx and Dlx-5. Treatment with BMP-2 significantly increased the expressions of Runx2, Osx and Dlx-5 mRNA although ara-A alone had no effects on their expressions (Fig. 2D–F). Co-incubation with ara-A significantly suppressed the BMP-2-induced up-regulation of Runx2 (Fig. 2D), but not Osx or Dlx-5 (Fig. 2E, F).

Fig. 2

The effects of BMP-2 and ara-A on expressions of osteoblast differentiation markers, Runx2, Osx and Dlx-5 in MC3T3-E1 cells

After reaching confluence, the cells were treated with BMP-2 (25 and 50 ng/mL) and/or ara-A (0.1 mM) for 48 h. The expression levels of Alp (A), Col-1 (B), Ocn (C), Runx2 (D), Osx (E) and Dlx-5 (F) mRNA were examined by real-time PCR. The results are expressed as mean ± SE (n ≧ 7). *; p < 0.05, **; p < 0.01, ***; p < 0.001.

Moreover, we examined the effects of BMP-2 and ara-A on the expressions of osteoblast differentiation in a marrow stromal cell line, ST2. BMP-2 50 ng/mL significantly increased the mRNA expressions of Alp, Ocn and Osx, but not Col-1, Runx2, or Dlx-5 (Fig. 3A–F). Co-incubation of ara-A with BMP-2 significantly suppressed the BMP-2-induced increase in Alp and Ocn expressions (Fig. 3A, C), but not Osx (Fig. 3E).

Fig. 3

The effects of BMP-2 and ara-A on expressions of osteoblast differentiation markers, Runx2, Osx and Dlx-5 in ST2 cells

After reaching confluence, the cells were treated with BMP-2 (50 ng/mL) and/or ara-A (0.1 mM) for 48 h. The expression levels of Alp (A), Col-1 (B), Ocn (C), Runx2 (D), Osx (E) and Dlx-5 (F) mRNA were examined by real-time PCR. The results are expressed as mean ± SE (n ≧ 7). *; p < 0.05, **; p < 0.01, ***; p < 0.001.

The association between BMP-2 and AMPK signals in MC3T3-E1 cells

As Smad1/5/8 are important signaling molecules of BMP-2 cascades, we examined whether Smad1/5 or AMPK enhances phosphorylation of the other molecule in MC3T3-E1 cells. At first, we examined the effects of BMP-2 50 ng/mL on phosphorylation of Smad1/5 and AMPK. Treatment with BMP-2 clearly phosphorylated Smad1/5 from 1 to 24 h, whereas it did not affect AMPK phosphorylation during 24 h (Fig. 4A). We examined the dose-dependent effects of BMP-2 (50 to 250 ng/mL) after 12 h treatment and found that 50 ng/mL of BMP-2 was enough to enhance phosphorylation of Smad1/5 (Fig. 4B). However, even high concentration of BMP-2 did not affect phosphorylation of AMPK (Fig. 4A, B). We further examined the effect of a BMP receptor inhibitor, LDN-193189, on the phosphorylation of Smad1/5 and AMPK. Treatments with LDN-193189 suppressed the phosphorylation of Smad1/5 with and without BMP-2 co-incubation (Fig. 4C), indicating that inhibition of BMP receptor suppressed the effects of endogenous and exogenous BMP-2. In contrast, LDN-193189 did not affect AMPK phosphorylation (Fig. 4C). Finally, we examined whether AMPK is involved in the BMP-2-Smad signaling. The inhibition of AMPK by ara-A did not affect BMP-2 induced phosphorylation of Smad1/5 (Fig. 4D).

Fig. 4

The effect of BMP-2, a BMP receptor inhibitor LDN-193189 and ara-A on the phosphorylation of Smad1/5 and AMPK in MC3T3-E1 cells

Western blot analysis was performed to examine the association between BMP-2-Smad and AMPK signaling. (A) After reaching confluence, MC3T3-E1 cells were incubated with BMP-2 50 ng/mL for up to 24 h. (B) The cells were incubated with various concentration of BMP-2 from 50 to 250 ng/mL for 12 h. (C) The cells were incubated with BMP-2 (50 ng/mL) and/or LDN-193189 (1 and 10 μM) for 12 h. (D) The cells were incubated with BMP-2 (25 and 50 ng/mL) and/or ara-A (0.1 mM) for 12 h. The results are representative of at least three different experiments.

Discussion

In this study, an AMPK inhibitor, ara-A, decreased the BMP-2-stimulated ALP activity and mineralization in osteoblastic MC3T3-E1 cells. Moreover, ara-A suppressed the BMP-2-induced increase in Alp and Ocn mRNA expressions in MC3T3-E1 cells and ST2 cells. These findings suggest that AMPK activity is needed for BMP-2-induced mineralization of osteoblasts. On the contrary, BMP-2 did not affect AMPK phosphorylation and an AMPK inhibitor also had no effects on Smad1/5 phosphorylation in MC3T3-E1 cells. Moreover, an AMPK inhibitor did not affect BMP-2-induced upregulation of Runx2, Osx, and Dlx-5, all of which are known to play roles in the downstream of BMP-2 signal, except for Runx2 in MC3T3-E1 cells. Taken together, these findings suggest that AMPK plays important roles in BMP-2-induced mineralization of osteoblasts via Smad-independent mechanisms.

Runx2 and Osx are important transcription factors for osteoblast differentiation and bone formation [16-18]. BMP-2 signal is known to increase expressions of Runx2 and Osx in osteoblasts [1, 2], and in our study, we also confirmed that BMP-2 significantly increased both Runx2 and Osx in MC3T3-E1 cells. Interestingly, AMPK inhibition significantly reversed the expression of Runx2, whereas it did not affect the expression of Osx. Although the association of Runx2 and Osx is not fully understood, Osx was previously considered to be a downstream molecule of Runx2 [18]. However, several recent studies showed independent relationships of Runx2 and Osx with the BMP-2 signaling pathway in osteoblasts. Dlx-5 is also a crucial transcription factor which is regulated by BMP-2 signals [1, 19, 20]. Lee et al. reported that BMP-2 stimulated Runx2 expression, and that Dlx-5 may be an indispensable mediator of BMP-2-induced Runx2 expression [19]. On the other hand, same research group demonstrated that BMP-2 treatment significantly enhanced Osx expression in Runx2 null cells, and that the Osx expression by BMP-2 was completely inhibited by the blocking Dlx-5 function [20]. Furthermore, Matsubara et al. showed that BMP-2 treatment induced Osx expression and ALP activity in mesenchymal cells derived from Runx2-deficient mice [21]. These findings suggest that BMP-2 upregulates Osx via both Runx2-dependent and -independent mechanisms including Dlx-5. In the present study, AMPK inhibition significantly decreased BMP-2-induced Runx2 expression, but not Dlx-5 or Osx, in MC3T3-E1 cells, suggesting that AMPK may be involved in BMP-2-induced Runx2 expression independently of Dlx-5 and Osx expressions.

In the present study, BMP-2 enhanced expressions of osteoblastic markers Alp and Ocn, which were suppressed by AMPK inhibition in not only MC3T3-E1 cells but also marrow stromal ST2 cells. However, treatment with BMP-2 did not change expressions of Runx2 and Dlx-5 in ST2 cells. It has been reported that, in addition to upregulation of Runx2, phosphorylation of Runx2 is important for its osteo-inductive effects [22-24]. Shui et al. reported that BMP-2 did not affect expression of Runx2, but increased phosphorylation of Runx2, which promoted osteoblast differentiation in human bone marrow stromal cells [25]. Therefore, BMP-2 may exert osteo-inductive effect by phosphorylation of Runx2 without increasing Runx2 and Dlx-5 in ST2 cells. Furthermore, we found that AMPK activation was not associated with at least Runx2 mRNA expression in ST2 cells. Thus, roles of AMPK in the association with BMP-2 might be different during the stages of osteoblast differentiation.

In conclusion, the present study showed that AMPK activity is important for the osteoblastogenic action of BMP-2 in osteoblast lineage cells. However, we found that AMPK is not involved in the BMP-2-induced Smad phosphorylation in the cells, suggesting that AMPK may play roles in downstream of Smad or non-Smad pathways, but not phosphorylation of Smad itself. Therefore, further studies are necessary to clarify the interaction between BMP-2 and AMPK.

Acknowledgements

This study was partly supported by a Grant-in-Aid for Scientific Research (C) (15K09433). The authors thank Keiko Nagira for technical assistance.

Disclosures

There are no conflicts of interest.

References

• 1   Sanchez-Duffhues  G,  Hiepen  C,  Knaus  P,  Ten Dijke  P (2015) Bone morphogenetic protein signaling in bone homeostasis. Bone 80: 43–59.
• 2   Rahman  MS,  Akhtar  N,  Jamil  HM,  Banik  RS,  Asaduzzaman  SM (2015) TGF-beta/BMP signaling and other molecular events: regulation of osteoblastogenesis and bone formation. Bone Res 3: 15005.
• 3   Lage  R,  Dieguez  C,  Vidal-Puig  A,  Lopez  M (2008) AMPK: a metabolic gauge regulating whole-body energy homeostasis. Trends Mol Med 14: 539–549.
• 4   Kola  B,  Boscaro  M,  Rutter  GA,  Grossman  AB,  Korbonits  M (2006) Expanding role of AMPK in endocrinology. Trends Endocrinol Metab 17: 205–215.
• 5   Kim  EK,  Lim  S,  Park  JM,  Seo  JK,  Kim  JH, et al. (2012) Human mesenchymal stem cell differentiation to the osteogenic or adipogenic lineage is regulated by AMP-activated protein kinase. J Cell Physiol 227: 1680–1687.
• 6   Xi  G,  Rosen  CJ,  Clemmons  DR (2016) IGF-I and IGFBP-2 stimulate AMPK activation and autophagy, which are required for osteoblast differentiation. Endocrinology 157: 268–281.
• 7  Kanazawa I, Takeno A, Tanaka K, Notsu M, Sugimoto T (2017) Osteoblast AMP-activated protein kinase regulates postnatal skeletal development in male mice. Endocrinology in press.
• 8   Kanazawa  I,  Yamaguchi  T,  Yano  S,  Yamauchi  M,  Yamamoto  M, et al. (2007) Adiponectin and AMP kinase activator stimulate proliferation, differentiation, and mineralization of osteoblastic MC3T3-E1 cells. BMC Cell Biol 8: 51.
• 9   Kanazawa  I,  Yamaguchi  T,  Yano  S,  Yamauchi  M,  Sugimoto  T (2009) Activation of AMP kinase and inhibition of Rho kinase induce the mineralization of osteoblastic MC3T3-E1 cells through endothelial NOS and BMP-2 expression. Am J Physiol Endocrinol Metab 296: E139–E146.
• 10   Kanazawa  I,  Yamaguchi  T,  Yano  S,  Yamauchi  M,  Sugimoto  T (2008) Metformin enhances the differentiation and mineralization of osteoblastic MC3T3-E1 cells via AMP kinase activation as well as eNOS and BMP-2 expression. Biochem Biophys Res Commun 375: 414–419.
• 11   Shah  M,  Kola  B,  Bataveljic  A,  Arnett  TR,  Viollet  B, et al. (2010) AMP-activated protein kinase (AMPK) activation regulates in vitro bone formation and bone mass. Bone 47: 309–319.
• 12   Wang  YG,  Han  XG,  Yang  Y,  Qiao  H,  Dai  KR, et al. (2016) Functional differences between AMPK alpha1 and alpha2 subunits in osteogenesis, osteoblast-associated induction of osteoclastogenesis, and adipogenesis. Sci Rep 6: 32771.
• 13   Wang  YG,  Qu  XH,  Yang  Y,  Han  XG,  Wang  L, et al. (2016) AMPK promotes osteogenesis and inhibits adipogenesis through AMPK-Gfi1-OPN axis. Cell Signal 28: 1270–1282.
• 14   Huang  CY,  Lee  CY,  Chen  MY,  Tsai  HC,  Hsu  HC, et al. (2010) Adiponectin increases BMP-2 expression in osteoblasts via AdipoR receptor signaling pathway. J Cell Physiol 224: 475–483.
• 15   Jang  WG,  Kim  EJ,  Lee  KN,  Son  HJ,  Koh  JT (2011) AMP-activated protein kinase (AMPK) positively regulates osteoblast differentiation via induction of Dlx5-dependent Runx2 expression in MC3T3E1 cells. Biochem Biophys Res Commun 404: 1004–1009.
• 16   Komori  T,  Yagi  H,  Nomura  S,  Yamaguchi  A,  Sasaki  K, et al. (1997) Targeted disruption of Cbfa1 results in a complete lack of bone formation owing to maturational arrest of osteoblasts. Cell 89: 755–764.
• 17   Komori  T (2003) Requisite roles of Runx2 and Cbfb in skeletal development. J Bone Miner Metab 21: 193–197.
• 18   Nakashima  K,  Zhou  X,  Kunkel  G,  Zhang  Z,  Deng  JM, et al. (2002) The novel zinc finger-containing transcription factor osterix is required for osteoblast differentiation and bone formation. Cell 108: 17–29.
• 19   Lee  MH,  Kim  YJ,  Kim  HJ,  Park  HD,  Kang  AR, et al. (2003) BMP-2-induced Runx2 expression is mediated by Dlx5, and TGF-beta 1 opposes the BMP-2-induced osteoblast differentiation by suppression of Dlx5 expression. J Biol Chem 278: 34387–34394.
• 20   Lee  MH,  Kwon  TG,  Park  HS,  Wozney  JM,  Ryoo  HM (2003) BMP-2-induced Osterix expression is mediated by Dlx5 but is independent of Runx2. Biochem Biophys Res Commun 309: 689–694.
• 21   Matsubara  T,  Kida  K,  Yamaguchi  A,  Hata  K,  Ichida  F, et al. (2008) BMP2 regulates Osterix through Msx2 and Runx2 during osteoblast differentiation. J Biol Chem 283: 29119–29125.
• 22   Ge  C,  Xiao  G,  Jiang  Q,  Yang  Q,  Hatch  NE, et al. (2009) Identification and functional characterization of ERK/MAPK phosphorylation sites in the Runx2 transcription factor. J Biol Chem 284: 32533–32543.
• 23   Ge  C,  Yang  Q,  Zhao  G,  Yu  H,  Kirkwood  KL, et al. (2012) Interactions between extracellular signal-related kinase 1/2 and p38 MAP kinase pathways in the control of RUNX2 phosphorylation and transcriptional activity. J Bone Miner Res 27: 538–551.
• 24   Li  Y,  Ge  C,  Long  JP,  Begun  DL,  Rodriguez  JA, et al. (2012) Biochemical stimulation of osteoblast gene expression requires phosphorylation of the RUNX2 transcription factor. J Bone Miner Res 27: 1263–1274.
• 25   Shui  C, Spelsberg, TC,  Riggs  BL,  Khosla  S (2003) Changes in Runx2/Cbfa1 expression and activity during osteoblastic differentiation of human bone marrow stromal cells. J Bone Miner Res 18: 213–221.