Body mass index and C-peptide are important for the promptly differential diagnosis of maturity-onset diabetes from familial type 2 diabetes in outpatient clinic

Abstract

Type 2 diabetic patients are becoming younger and having a tendency to family aggregation, they are easily suspected as maturity-onset diabetes of young (MODY) in the outpatient clinic and send to genetic testing. 9 diabetic families were compared in our outpatient clinic who met the primary diagnosis criteria of MODY. Detailed clinical features and laboratory data including gene sequence were collected and analyzed. The patients met the primary clinical diagnostic criteria of MODY for genetic testing at the first look. However, members of families A1 to A3 had normal Body mass index (BMI) and a lower C-peptide level which indicated impaired pancreatic islet function. In contrast, the members with diabetes of families B1 to B6 had normal or increased C-peptide level which indicated insulin resistance and were overweight with BMI. Genetic testing showed that the mutations in HNF1A, INS, KCNJ11 and so on in families A were consistent with the diagnosis of MODY. No pathogenic mutation was found in the members of families B which were diagnosed with familial T2D. Before the clinical laboratory testing and the further gene test, BMI and the concentration of C-peptide are important for the promptly differential diagnosis of MODY from familial type 2 diabetes and medication instruction in the outpatient clinic which could help to alleviate the burden of genetic testing for them.

DIABETES is a group of metabolic diseases characterized by hyperglycemia and hypoglycemia. Hyperglycemia results from defects of insulin secretion or insulin resistance. Diabetes is associated with chronic damage, dysfunction and failure of multiple organs, which can be classified into the following general categories: type 1 diabetes, type 2 diabetes, gestational diabetes mellitus (GDM), and specific types of diabetes due to other causes, e.g., monogenic diabetes syndromes [1]. In clinic, specific types of diabetes was misdiagnosed as type 1 or 2 diabetes, resulting in initial improper therapy on patients because of relatively rare condition and awareness of the clinical phenotype and availability of testing, especially Maturity-onset diabetes of the young (MODY), one of the most popular specific type of diabetes resulting from monogenic mutation [2].

MODY is a rare, young-onset, dominantly-inherited and non-insulin-dependent type of diabetes resulting from β-cell dysfunction. The term MODY was first mentioned in a case report published in 1974, before which MODY was often defined as type 2 diabetes, resulting in misdiagnosis [3, 4]. Previous studies agree that the diagnostic criteria of MODY are: autosomal dominant inheritance, insulin independence within two years of onset and at least one family member was diagnosed with diabetes before the age of 25 [4]. Genetic testing for MODY patients has been possible since the major genetic causes were identified in the 1990s [5]. Since then, 14 different genes have been identified as being responsible for MODY [6-8]. These genes encode the transcription factor HNF4α hepatocyte nuclear factor 4α (MODY1), GCK glycolytic enzyme glucokinase (MODY2), HNF1α hepatocyte nuclear factor 1α (MODY3), IPF insulin promoter factor (MODY4), HNF1β hepatocyte nuclear factor 1β (MODY5) and NEUROD1 neurogenic differentiation factor (MODY6), KLF11 Kruppel-like factor 11 (MODY7), CEL carboxyl ester lipase (MODY8), PAX4 paired box 4 (MODY9), INS insulin (MODY10), BLK proto-oncogene (MODY11), ABCC8 ATP binding cassette subfamily C member 8 (TNDM2), KCNJ11 the potassium voltage-gated channel subfamily J member 11 (TNDM3) and APPL1 the adaptor protein phosphotyrosine interacting with PH domain and leucine zipper 1 (MODY14).

Mutations in each of 14 genes lead to the development of different MODY subtypes, differing in population distribution, clinical features, prevalence and management strategies [9-11]. The prevalence rate of MODY subtypes varies in different countries. MODY3 and MODY2 account for more than 90% of MODY patients [12], mostly in Caucasians patients. In contrast, only 7–11% of Asian patients are diagnosed with MODY2 , MODY3 and MODY12 [10, 13-16].

Further genes related to MODY are likely to be found since most MODY patients have unknown mutations. This group is defined as MODYX. MODYX is responsible for 80%–90% of MODY in China which is different from other populations from 30% to 45% [14, 15, 17, 18]. A lack of awareness of MODY, as well as similar clinical features to other types of diabetes, means that clinicians cannot often easily differentiate MODY from type 2 diabetes without genetic testing. This is often based on a single, dated gene which might easily cause misdiagnosis. Accurate diagnosis of MODY requires a detailed history as well as genetic screening, which is nearly 3,000–7,000 yuan ($431.7–1,007.4) equaling with a common family monthly profits in China. In conclusion, there are two dominantly reasons for a Chinese diabetic patient difficulty to make a decision on genetic testing. On one hand, more than 80% genes responsible for MODY patients in China were unclear and genetic screening only covered part of candidate genes. On the other hand, genetic testing was expensive for the average class and was not covered by Chinese medical insurance institution at present.

Precise judgment for an outpatient clinician plays an important role in initial differential diagnosis and therapy. However, Chinese diabetes practitioners faced hundreds of patients every day and were challenging to make a quick first differential diagnosis in a very limited time. They tried to figure outpatients who needed genetic testing at first sight out in order to minimized expenses. Therefore, new criteria relied on family history, physical signs and simple routine blood testing were essential for outpatient physicians. This study showed that BMI and the concentration of C-peptide might be important indexes except for three classical diagnostic indexes in considering the genetic testing of MODY, which help to differentiate MODY from familial type 2 diabetes more precisely before genetic testing.

Materials and Methods

Subjects

Nine probands were recruited from unrelated families admitted to the Second Hospital of Xiangya, the Second People’s Hospital of Shenzhen and the First People’s hospital of Huai-hua outpatient clinic. There were 19 subjects in all who indicated their willingness to participate. All these 9 families with a suspected MODY diagnosis fulfilled the following criteria: age of onset up to 25 years, family history of diabetes indicating autosomal dominant inheritance, negative autoimmune antibody and at least two years of insulin independence [4]. The study was approved by the Ethics Committee of the National Clinical Research Center for Metabolic Disease, Second Xiangya Hospital of Central South University and registered at Chinese clinical trial registry with registration number of ChiCTR1800019030. Informed consent was obtained from all patients for being included in the study.

Family history

Clinical data were collected by professional physicians and included: 1) gestational age and age of onset; 2) height and weight at the time of reporting; 3) family history of diabetes; 4) medication; and 5) complications.

Laboratory testing

The blood samples were centrifuged for serum isolation, frozen, and the fasting C-peptide and blood glucose were analyzed by the chemiluminescent method. The isolated serum was sent to the Diabetes Center of Central South University for further screening of ZnT8A, GADA, and IA-2A [19]. Three biochemical measurements were taken. The concentration of pancreatic autoimmune antibody was detected by radioligand binding assay (RLA). The detailed process of antibody assay was described previously [20]. The concentration of C-peptide, tested by a Bayer Centaur Immunoassay System; HbA1c, tested by ion-exchange HPLC with the normal range of 3.9–6.1% [20].

Genetic testing

Genomic DNA was extracted from peripheral blood samples taken from two probands. DNA samples were amplified using PCR with primers covering all exons and exon-intron junctions of the HNF1A, HNF4A, and HNF1B because of the drug history and hypoglycemia symptoms tending to MODY1, 3 and 5. The forward and reverse primers are listed in Table 1. PCR was conducted using 50 μL of amplification reaction mixture which contained 1.5 μL of 100 ng genomic DNA, 1.0 μL of 1.0 μM of each primer and 25 μL of 2 × GreenMaster Mix. Cycling conditions were as follows: 95°C for 5 min followed by 35 cycles of amplification (94°C denaturation for 30 s, 60°C annealing for 30 s, 68°C elongation for 30 s) and a final extension at 68°C for 5 min, then a hold at 4°C. The cycling program took place in an Applied BioSystems thermocycler and the PCR products were determined using an ABI 700 (Applied BioSystems) sequencer extraction kit. Probands with a negative result for MODY1, 3, 5 were further screened with 45 genes known to be associated with monogenic forms of diabetes. The target genes are shown in Table 2. The screening was carried out via next-generation sequencing by BGI Dx in Shenzhen, China.

Table 1 Nucleotide sequences of DNA primers for PCR

Exon-fragments	Forward primer (5'-3')	Reverse primer (5'-3')
HNF4A_e1a	GGGCACTGGGAGGAGGCAGT	GCCTGTAGGACCAACCTACC
HNF4A_e1b	TCTGGTGTGCACGACTGCAC	CTGGAGCTGCAGCCTCATAC
HNF4A_e1c	CACAGGTGTTGCCAAGTGAAGC	CACCGAGAAATGCGGTTATGTC
HNF4A_e2	AAGGCTCCCTTAGATGCCTG	CCACTCAGGGAGAAGACAGACCT
HNF4A_e3	CCTAGTTCTGTCCTAAGAGG	GTCATAAAGTGTGGCTACAG
HNF4A_e4	CCACCCCCTACTCCATCCCTGT	CCCTCCCGTCAGCTGCTCCA
HNF4A_e5	GTGCAGGGGACAGAGAATGC	AATCAAGCCAGTCCACGGCTAT
HNF4A_e6	GCCCAGCGTCACTGAGTTGGCTA	TTGCCTGGGTGAGTGCCATG
HNF4A_e7	GCACCAGCTATCTTGCCAAC	AGGAGAAGTCTGGCAGAGCG
HNF4A_e8	GGGACATCTGGGTCTTGACTCC	TCACTGTGTGAGGCCTGTCTCC
HNF4A_e9	TGGTTGATTGGCCACGCCTG	ATCCTGGTTCTACCTTCTAG
HNF4A_e10	CATTTACTCCCACAAAGGCT	GACCACGTGATCACCAGGTG
HNF1A_e1	GGCAGGCAAACGCAACCCACG	GAAGGGGGGCTCGTTAGGAGC
HNF1A_e2	CATGCACAGTCCCCACCCTCA	CTTCCAGCCCCCACCTATGAG
HNF1A_e3	GGGCAAGGTCAGGGGAATGGA	CAGCCCAGACCAAACCAGCAC
HNF1A_e4	CAGAACCCTCCCCTTCATGCC	GGTGACTGCTGTCAATGGGAC
HNF1A_e5	GGCAGACAGGCAGATGGCCTA	GCCTCCCTAGGGACTGCTCCA
HNF1A_e6	TGGAGCAGTCCCTAGGGAGGC	GTTGCCCCATGATCCCAC
HNF1A_e7	GGTCTTGGGCAGGGGTGGGAT	CCCCTGCATCCATTGACAGCC
HNF1A_e8	GAGGCCTGGGACTAGGGCTGT	CTCTGTCACAGGCCGAGGGAG
HNF1A_e9	CAGAGCCCCTCACCCCCACAT	CGGACAGCAACAGAAGGGGTG
HNF1A_e10	GTACCCCTAGGGACAGGCAGG	ACCCCCCAAGCAGGCAGTACA
HNF1B_e1	GGGTGGAGGGGTTCCTGGAT	CGGGCGCAGTGTCACTCAGG
HNF1B_e2	CTCCCACTAGTACCCTAACC	GAGAGGGCAAAGGTCACTTCAG
HNF1B_e3	AGTGAAGGCTACAGACCCTATC	TTCCTGGGTCTGTGTACTTGC
HNF1B_e4	CCCCTTCATACTCCCAACCAA	AAACCAGATAAGATCCGTGGC
HNF1B_e5	TGCCGAGTCATTGTTCCAGG	CCTCTTATCTTATCAGCTCCAG
HNF1B_e6	CCATGCCCAGCCAATAATTGTTA	GGTGAGTTTGAAGGAGACCTACA
HNF1B_e7	ATCCACCTCTCCTTATCCCAG	ACTTCCGAGAAAGTTCAGACC
HNF1B_e8	TTTGCCTGTGTATGCACCTTG	GCCGAGTCCATGCTTGCCAC
HNF1B_e9	GGGCATCATCTCCCTTAGAGAA	ACGTCCGTCAGGTAAGCAG

Table 2 Catalogue of high-throughput sequencing genes

Gene	Gene ID	Diseases	Gene	Gene ID	Diseases
HNF4A	3172	MODY/CHI	HNF1A	6927	MODY
GCK	2645	MODY/PNDM/CHI	HNF1B	6928	MODY/TNDM/PNDM
PDX1	3651	MODY/PNDM	NEUROD1	4760	MODY/PNDM
KLF11	8462	MODY	CEL	1056	MODY
PAX4	5078	MODY	INS	3630	MODY/TNDM/PNDM
BLK	640	MODY	ABCC8	6833	MODY/TNDM/CHI
KCNJ11	3767	MODY/TNDM/PNDM/CHI	ZFP57	346171	TNDM
PLAGL1	5325	TNDM	HYMAI	57061	TNDM
PTF1A	256297	PNDM	GLIS3	169792	PNDM
RFX6	222546	PNDM	SLC19A2	10560	PNDM
GATA6	2627	PNDM	IER3IP1	51124	PNDM
NEROG3	50674	PNDM	PAX6	5080	PNDM
INSR	3643	CHI	GLUD1	2746	CHI
UCP2	7351	CHI	FOXA2	3170	CHI
SLC16A1	6566	CHI	HADH	3033	CHI
SLC2A2	6514	Fanconi-Bickel syndrome	FOXP3	50943	Immunodysregulation Polyendocrinopathy Enteropathy X-linked syndrome
WFS1	7466	Wolfram syndrome	CISD2	493856	Wolfram syndrome
LMNA	4000	Mandibuloacral Dysplasia with type A Lipodystrophy (MADA)	ZMPSTE24	10269	Mandibuloacral Dysplasia with type A Lipodystrophy (MADA)
AGPAT2	10555	congenital generalized lipodystrophy (CGL)	BSCL2	26580	congenital generalized lipodystrophy (CGL)
CAV1	857	congenital generalized lipodystrophy (CGL)	PTRF	284119	congenital generalized lipodystrophy (CGL)
EIF2AK3	9451	Wolcott-Rallison syndrome	HFE	3077	Haemochromatosis

Statistics

Statistical analysis was performed using Statistical package for Social Sciences (SPSS for Windows, version 22.0), Levene’s test and Independent sample t test were used for comparison between MODY and T2D groups. Data are presented as mean ± SD and p values <0.05 were considered statistically significant.

Results

Family history

Family A consisted of 3 families (from A1–A3) and B was 6 (from B1–B6). There are 6 and 13 diabetic patients in families A and families B respectively, and at least two of them in each family were diagnosed with diabetes and at least one of their age of onset was before 25. Genetic analysis indicated that they were autosomal dominant inheritance (Seen Figs. 1 and 2).

Fig. 1

Family A1–A3 diagnosed as MODY. The arrow indicates the proband. Squares represent males and circles females, patients are indicated with filled symbols.

Fig. 2

Family B1–6 diagnosed as familial T2D. The arrow indicates the proband. Squares represent males and circles females, patients are indicated with filled symbols.

Medications, complications and laboratory tests

The detailed clinical characteristics of the families are listed in Tables 3 and 4. In family A1, the proband was a 27-year-old female diagnosed with diabetes at the age of 18. Her brother was diagnosed at the age of 21. Their mother was found to have diabetes at the age of 49. BMI and C-peptide values in this family ranged from 16.45–19.96 kg/m² and 114.9–341.3 pmol/L, respectively, and had no significant differences with the initial values while diabetes occurred. The families A1 proband has been receiving glipizide, a kind of oral sulfonylureas, and dimethylbiguanide treatment. The proband has been receiving long-acting insulin glargine injection (10 units per night) with occasional blurred sight. Her brother has been receiving gliclazide treatment without any complications. In family A2, the proband was a 41-year-old male, his daughter was 20 years old, that he and his daughter were diagnosed with diabetes at age of 36 and 16 respectively. And they have not suffered any complication. Family A3 proband was a 22-year-old female diagnosed with diabetes at her 15 whom mother and grandma also suffered from hyperglycemia without complication at age of 35 and 55.

Table 3 Clinical characteristics of 6 subjects from family A1–3

Subject	Gender	Age at diagnosis (yrs)	Age at reporting (yrs)	0 minute blood glucose (mmol/L)	120 minute blood glucose (mmol/L)	0 minute C-peptide (pmol/L)	BMI (kg/m2)	Hb1Ac (%)
A1	M	49	56	3.34	None	153.7	18.9	5.3
A1	F	18	27	6.09	11.65	114.9	16.4	5.6
A1	M	21	22	8.32	20.02	341.3	19.9	7.1
A2	M	36	41	11.80	10.40	21.40	20.40	11.3
A2	F	16	20	11.71	12.96	179.20	24.10	11.6
A3	F	15	22	12.02	22.94	115.80	23.30	12.3

Table 4 Clinical characteristics of 15 subjects from family B1–6

Subject	Gender	Age at diagnosis (yrs)	Age at reporting (yrs)	0 minute blood glucose (mmol/L)	120 minute blood glucose (mmol/L)	0 minute C-peptide (pmol/L)	BMI (kg/m2)	Hb1Ac (%)
B1	F	41	46	8.74	N	578.2	27.3	7.3
B1	M	38	41	6.92	N	891.7	32.2	6.0
B1	M	21	22	3.93	N	791.9	30.1	5.8
B1	M	12	13	7.34	N	1,076.2	27.8	7.3
B2	F	44	44	7.87	N	697.3	30	7.8
B2	M	39	52	7.63	N	763.6	29.4	6.9
B2	F	21	32	6.87	N	644.7	30.0	7.2
B3	F	34	42	8.42	N	659.2	25.8	10.1
B4	M	15	19	7.65	N	666	26.9	7.2
B5	M	40	40	6.97	N	722.6	26.8	7.3
B5	M	39	39	7.86	N	682.6	27.9	7.7
B5	F	16	16	7.14	N	629.4	28.7	6.9
B6	M	32	37	10	N	798.6	28.7	7.6

In family B1, the proband was a 22-year-old male diagnosed with diabetes at the age of 21. His cousin was diagnosed at 12. BMI and C-peptide values ranged from 23.4–32.2 kg/m² and 309.2–1,076.2 pmol/L, respectively. All patients with diabetes in this family were untreated and did not suffer any complications. In family B2, the proband was a 52-year-old male suffered from diabetes and gouty arthritis for nearly 13 years. His parents, sisters, daughter had diabetes and his daughter was diagnosed with diabetes at age of 22. The proband has received remedy of glibenclamide and dimethylbiguanide for 12 years without any chronic complication including diabetic nephropathy, retinopathy and so on. Family B3 proband was a 42 year-old female suffered from diabetes and then received glibenclamide for 8 years. Her father died of diabetes and 2 little sisters and a brother all had diabetes with insulin treatment after at least 4 years diabetic diagnosis, and her sisters and brother were diagnosed with diabetes at the age no more than 25. The proband of family B4 was a 19 year-old male with 4 years hyperglycemia and received glibenclamide for 2 years. His mother and grandparents also suffered from diabetes. In family B5, the proband was a 16 year-old female diagnosed with diabetes recently. His grandpa died from diabetes and his father and father’s brother also suffered diabetes several years. The proband of family B6 was 37 years old and had been diagnosed with diabetes 5 years ago without any treatment and complication. His mother and 2 little sisters were found hyperglycemia before 25 years old.

All members were negative for pancreatic autoimmune antibodies, including GADA-Ab, ZnT8-Ab, and IA-2A. We concluded that the nine families fulfilled the following conventional clinical diagnosis criteria: age of onset of fewer than 25 years, a family history of diabetes complying with autosomal dominant inheritance, negative autoimmune antibody and insulin independence of at least two years.

Genetic testing

Genome sequencing showed that families A1 had a c.779 C>T (ACG 260 ATG) heterozygous missense mutation in HNF1A in three patients, which was reported strongly associated with HNF1A-MODY. Two polymorphisms c.1375C>T (L459L), c.1460G>A (S487N) in exon7 of HNF1A gene were detected, too. Members of A2 had a c.1423T>C (Tyr475His) heterozygous mutation in ABCC8 (TNDM2) which was a novel mutation. Members of A3 had a c.212dupG heterozygous mutation in INS (MODY10). No mutation was detected in families B.

Comparison of Clinical characters in probands of Families A and Families B

The prevalence of diabetic complications from family A and B, including retinopathy, nephropathy and so on, was 1/6 (16.7%) and 2/13 (15.4%), respectively. From Tables 3 and 4, we concluded and analyzed the age of diagnosis, fasting blood glucose, 0-minute C-peptide concentration, body mass index and HbA1c through SPSS 22 with Levene’s test and Independent-Samples T test. The results (Table 5) showed that BMI and concentration of C-peptide had homogeneity variance and significance (p < 0.05) of which BMI was divided from 20.5 to 28.6 kg/m² as well as C-peptide from 154.4 to 738.6 pmol/L.

Table 5 Comparative issues from families A to B

Items	Family A (n = 6)	Family B (n = 13)	p value
Age at diagnosis (Mean, yrs)	25	30	0.441
FBG (Mean, mmol/L)	8.8	7.5	0.232
Fasting C-peptide (Mean, pmol/L)	154.4	738.6	0.000
BMI (Mean, kg/m2)	20.5	28.6	0.000
Hb1Ac (Mean, %)	8.8	7.3	0.124

Discussion

Monogenic diabetes is caused by a single gene defect or mutation and includes MODY, neonatal diabetes, congenital hyperinsulinism and Wolcott-Rallison syndrome. Diagnosis of monogenic diabetes could help to understand the pathogenesis of diabetes, insulin resistance and β-cell function [1].

Single gene mutations that primarily affect pancreatic β-cell function account for approximately 1–2% of all cases of diabetes. MODY is the most common form of monogenic diabetes, accounting for about 2–5% of patients. The 14 genes identified as being responsible for MODY include HNF4A, GCK, HNF1A, PDX1, HNF1B, NEUROD1, KLF11, CEL, PAX4, INS, BLK, ABCC8, KCNJ11 and APPL1 [6, 7, 21]. However, most MODY patients in China have unknown mutations, meaning that only 5–20% of patients with MODY are correctly diagnosed [2, 21, 22]. Several clinical features of MODY overlap with common forms of diabetes, making a diagnosis of MODY a challenge [2]. Genetic testing plays a significant role in the prediction, prognosis, progression and treatment of the disease as well as implications for other family members. Effective genetic testing for monogenetic diabetes usually involves high-throughput nucleotide sequencing, which improves the sensitivity and accuracy of results by greatly increasing the number of nucleotides sequenced. However, this technique is expensive, leading to a heavy economic burden when diagnosing diabetes type from many know or unknown genes. Hence, the new standard before genetic testing has proved crucial for accurate diagnosis of MODY. And for the outpatient clinical physicians’ purposes, they need more effective and convenient methods to make a quick decision on whether genetic testing is recommended or not apart from detailed family history. Once cases of monogenic diabetes were confirmed, such as that caused by defects in MODY3, are treatable by oral sulfonylureas since they act on ATP-sensitive potassium channels [6].

Previous studies agree that the diagnostic criteria for genetic testing are autosomal dominant inheritance, insulin independence after two years and at least one family member diagnosed before the age of 25 [4]. Adopting these criteria, we screened the DNA from patients of all these families who had been diagnosed with MODY. Families A1 showed transmission of diabetes over three generations due to a c.779 C>T (ACG 260 ATG, p.T260M) missense mutation in the exon 4 of HNF-1A gene which was first time to be detected by our research team in the Chinese population [23] causing a substitution in position 487 from serine to asparagine [24]. Family A2 showed a variation on ABCC8 (TNDM2) c.1423T>C (Tyr475His) heterozygous mutation which was a novel mutation. Family A3 had a c.212dupG heterozygous mutation in INS (MODY10). Families B was also clinically suspected to have MODY according to the criteria. However, no mutation was found in 45 genes known to be associated with monogenic forms of diabetes. Interestingly, we found a Medical Examination Report of the B1 proband’s grandfather which showed that his fasting blood glucose was normal at the age of 65, and consequently families B was diagnosed as familial T2D.

From Table 5, we found differences in terms of BMI and C-peptide (Tables 3, 4): patients with T2D in families B had higher BMI and C-peptide, which indicated higher pancreatic islet secretion and insulin resistance at present.

Due to the existence of MODYX and overwhelming expenses for genetic testing, precise and quick judgment for an outpatient clinician plays a role in initial differential diagnosis and therapy. The diabetes practitioners try to figure outpatients who need genetic testing at first sight in order to minimized expenses. Therefore, we recommend that physicians who use genetics to make a diagnosis should also take BMI and C-peptide into consideration. As to OGTT (oral glucose tolerance test) curve, it depended upon a group of digestive, hepatic, hormonal and nervous processes. It is complicated on preparing and testing in outpatient clinic despite partly assistance on distinguishing MODY from T2D [25]. Comparing to OGTT curve, BMI and C-peptide cost less time and suffering.

As well as plasma glucose and clinical features of the proband, detailed family history and lifestyle were also crucial to determine the type of diabetes. By analyzing the history of patients from families B and published articles from other clinical centers, we found that the age of onset of impaired glucose tolerance and T2D was younger in overweight patients, which was mainly related to unhealthy habits, such as sedentary lifestyle, over-eating and lack of exercise [26]. Families may have similar eating and exercise habits, which might play an important role in the onset of familial T2D. They have higher C-peptide level and BMI. However, most types of MODY, loss function of genes gives rise to defects of insulin synthesis, transporting and secretion manner [6, 7, 21]. Hence, MODY patients show lower C-peptide level and BMI. Under the common condition of autosomal dominant inheritance, insulin independence after two years and at least one family member diagnosed before the age of 25, we recommended out-patient clinic physician that the range of value in BMI 25–26 kg/m² and C-peptide 550–600 pmol/L could help to fortify the incidence of MODY diagnosis before genetic testing. By virtue of the range of value we mentioned was the low limitation value of familial T2D which was interestingly still greater than the upper limitation of MODY from our research. And we chose the range from MODY (family A) patients’ maximum values to familial T2D (family B) patients’ minimum value for recommendation. This emphasizes the importance of BMI and insulin resistance when differentiating MODY from T2D. And we need larger sample size to validated the specific cut-off value.

In summary, the procedure of diagnosing MODY requires a detailed history and clinical characteristics of the proband and family members to be known subsequently undergoing genetic screening. As well as age at diagnosis, insulin independence and autosomal dominant inheritance, BMI and C-peptide might be used as inclusion criteria in the outpatient clinic when considering genetic testing. As the T2D patients become younger, it becomes more important to have specific criteria to diagnose MODY as distinguished from familial T2D.

Also, our study has several limitations. Firstly, more clinical data of the patients needed to be included. Secondly, the amount of sample is not enough to define the standard of differential diagnosis, but this study could be a pilot study for the future larger case studies. The last but not least, we need further follow-up study for these families for the purpose of deeply understanding the process of MODY progression to help differential diagnosis and provide instruction on treatment.

Acknowledgements

This work was supported by grants from the National Natural Scientific Foundation of China [grant numbers 81770880, 81370975, 81070278] and the Hunan Provincial Natural Science Foundation of China [grant numbers 2015JC3012] and the Shenzhen Municipal Science and Technology Innovation Committee [grant numbers JSGG‌20160331103247408].

All authors have contributed significantly and in keeping with the latest guidelines of the International Committee of Medical Journal Editors. Hui-Xuan WU collected clinical information and wrote the article. Jun TANG and Long LI extracted DNA and sequenced it. Shi-Ping LIU, Zhi-Guang ZHOU, Hou-De ZHOU and De-Wen YAN provided patients information. Jian-Xing YANG helped to sequence. The work was conducted by Hou-De ZHOU. And all authors are in agreement with the content of the manuscript.

The datasets during and/or analyzed during the current study are available from the corresponding author on reasonable request. At last, we showed deep appreciation on probands and their families for their support.

Disclosure

No competing financial interests exist.

References

• 1  American Diabetes Association (2018) 2. Classification and diagnosis of diabetes: standards of medical care in diabetes-2018. Diabetes Care 41(Suppl 1): S13–S27.
• 2   Shields  BM,  Hicks  S,  Shepherd  MH,  Colclough  K,  Hattersley  AT, et al. (2010) Maturity-onset diabetes of the young (mody): how many cases are we missing? Diabetologia 53: 2504–2508.
• 3   Ellard  S,  Bellanne-Chantelot  C,  Hattersley  AT,  Mg European Molecular Genetics Quality  Network (2008) Best practice guidelines for the molecular genetic diagnosis of maturity-onset diabetes of the young. Diabetologia 51: 546–553.
• 4   Stride  A,  Hattersley  AT (2002) Different genes, different diabetes: lessons from maturity-onset diabetes of the young. Ann Med 34: 207–216.
• 5   Frayling  TM,  Evans  JC,  Bulman  M,  Pearson  E,  Allen  L, et al. (2001) Beta-cell genes and diabetes: molecular and clinical characterization of mutations in transcription factors. Diabetes 50 Suppl 1: S94–S100.
• 6   Kavvoura  FK,  Owen  KR (2012) Maturity onset diabetes of the young: clinical characteristics, diagnosis and management. Pediatr Endocrinol Rev 10: 234–242.
• 7   Prudente  S,  Jungtrakoon  P,  Marucci  A,  Ludovico  O,  Buranasupkajorn  P, et al. (2015) Loss-of-function mutations in appl1 in familial diabetes mellitus. Am J Hum Genet 97: 177–185.
• 8   Horikawa  Y (2018) Maturity-onset diabetes of the young (mody) as a model for elucidating the multifactorial origin of type 2 diabetes mellitus. J Diabetes Investig 9: 704–712.
• 9   Taneera  J,  Mussa  B,  Saber-Ayad  M,  Dhaiban  S,  Aljaibeji  H, et al. (2017) Maturity-onset diabetes of the young: an overview with focus on the middle east. Curr Mol Med 17: 549–562.
• 10   Mohan  V,  Radha  V,  Nguyen  TT,  Stawiski  EW,  Pahuja  KB, et al. (2018) Comprehensive genomic analysis identifies pathogenic variants in maturity-onset diabetes of the young (mody) patients in south india. BMC Med Genet 19: 22.
• 11  Thanabalasingham G, Pal A, Selwood M, Dudley C, Fisher K, et al. (2012) Systematic assessment of etiology in adults with a clinical diagnosis of young-onset type 2 diabetes is a successful strategy for identifying maturity-onset diabetes of the young. Diabetes Care 35: 1206–1212.
• 12   Thanabalasingham  G,  Owen  KR (2011) Diagnosis and management of maturity onset diabetes of the young (mody). BMJ 343: d6044.
• 13   Hwang  JS,  Shin  CH,  Yang  SW,  Jung  SY,  Huh  N (2006) Genetic and clinical characteristics of Korean maturity-onset diabetes of the young (mody) patients. Diabetes Res Clin Pract 74: 75–81.
• 14   Ng  MC,  Cockburn  BN,  Lindner  TH,  Yeung  VT,  Chow  CC, et al. (1999) Molecular genetics of diabetes mellitus in chinese subjects: identification of mutations in glucokinase and hepatocyte nuclear factor-1alpha genes in patients with early-onset type 2 diabetes mellitus/mody. Diabet Med 16: 956–963.
• 15   Xu  JY,  Dan  QH,  Chan  V,  Wat  NM,  Tam  S, et al. (2005) Genetic and clinical characteristics of maturity-onset diabetes of the young in chinese patients. Eur J Hum Genet 13: 422–427.
• 16   Hu  C,  Jia  W (2018) Diabetes in china: epidemiology and genetic risk factors and their clinical utility in personalized medication. Diabetes 67: 3–11.
• 17   Velho  G,  Robert  JJ (2002) Maturity-onset diabetes of the young (mody): genetic and clinical characteristics. Horm Res 57 Suppl 1: 29–33.
• 18   Dusatkova  P,  Fang  M,  Pruhova  S,  Gjesing  AP,  Cinek  O, et al. (2014) Lessons from whole-exome sequencing in modyx families. Diabetes Res Clin Pract 104: e72–e74.
• 19   Huang  G,  Zhou  ZG,  Peng  J (2003) quality control of radioligand assay for glutamic acid decarboxylase antibody. Hunan Yi Ke Da Xue Xue Bao 28: 597–600 (In Chinese).
• 20   Huang  G,  Wang  X,  Li  Z,  Li  H,  Li  X, et al. (2012) Insulin autoantibody could help to screen latent autoimmune diabetes in adults in phenotypic type 2 diabetes mellitus in Chinese. Acta Diabetol 49: 327–331.
• 21   Steck  AK,  Winter  WE (2011) Review on monogenic diabetes. Curr Opin Endocrinol Diabetes Obes 18: 252–258.
• 22   Gat-Yablonski  G,  Shalitin  S,  Phillip  M (2006) Maturity onset diabetes of the young—review. Pediatr Endocrinol Rev 3 Suppl 3: 514–520.
• 23   Tang  J,  Tang  CY,  Wang  F,  Guo  Y,  Tang  HN, et al. (2017) Genetic diagnosis and treatment of a chinese ketosis-prone mody 3 family with depression. Diabetol Metab Syndr 9: 5.
• 24   Ellard  S,  Colclough  K (2006) Mutations in the genes encoding the transcription factors hepatocyte nuclear factor 1 alpha (hnf1a) and 4 alpha (hnf4a) in maturity-onset diabetes of the young. Hum Mutat 27: 854–869.
• 25   Lestradet  H (1980) the oral glucose tolerance test (author’s transl). Ann Med Interne (Paris) 131: 103–112 (In French).
• 26   Ogden  CL,  Carroll  MD,  Curtin  LR,  Lamb  MM,  Flegal  KM (2010) Prevalence of high body mass index in us children and adolescents, 2007–2008. JAMA 303: 242–249.