2022 Volume 69 Issue 1 Pages 23-33
Chronic stress affects the reproductive health of mammals; however, the impact of adrenocorticotropin hormone (ACTH) level elevation during chronic stress on the reproduction of weaned sows remains unclear. In this study, nine weaned sows with the same parturition date were randomly divided into control group (n = 4) and ACTH group (n = 5). Each group received intravenous administration of ACTH three times daily for 7 days. Blood samples were collected every 3 h after injection. A radioimmunoassay was used to measure the concentrations of cortisol, luteinizing hormone (LH), follicle-stimulating hormone (FSH), progesterone (P4) and estradiol-17β (E2) in the blood. Estrus was determined according to changes in the vulva and the boar contact test. The mRNA expressions of glucocorticoid receptor, FSH receptor, LH receptor (LHR) in the corpus luteum (CL) were detected by qRT-PCR. The results showed that ACTH administration substantially delayed the initiation of estrus and the pre-ovulatory LH peak. The sows of control group ovulated within 10 days and the ovulation rate was 100%, while it was 60% in the ACTH group. Two sows of ACTH group showed pseudo-estrus. The E2 concentrations significantly decreased in the ACTH group at 36 h, 42 h and 66 h of the experimental period. The P4 concentrations in the ACTH group significantly decreased at 132, 138, and 147 h of the experimental period. ACTH significantly reduced the LHR mRNA expression in CLs. In conclusion, long-term repeated ACTH administration affects the endocrinology, estrus onset, and ovarian function of weaned sows.
WEANED SOWS should become pregnant as soon as possible to achieve the best reproductive performance of a pig herd. However, some sows show estrus but do not ovulate (pseudo-estrus) or fail to resume the estrous cycle after weaning, which seriously shortens the sow’s reproductive lifespan and causes huge economic losses. Stress is an important environmental factor that disrupts the reproduction of sows [1, 2]. Stress is defined as a biological response to events that threaten the homeostasis of an individual. In the intensive production of livestock, sows are often subjected to severe stress due to their sexual and maternal behaviors, which are usually strongly restricted [3, 4]. During the stress response, the hypothalamus-pituitary-adrenal (HPA) axis is activated and induces the sequential release of corticotropin releasing hormone, adrenocorticotropin hormone (ACTH), and glucocorticoids. The increase in ACTH and glucocorticoid levels may influence the regulating function of the hypothalamus (affects gonadotropin-releasing hormone (GnRH) secretion) and the pituitary gland (affects gonadotropin secretion) in reproductive processes [5, 6]. However, the exact regulatory mechanism underlying this complex progress remains unknown.
As an important stress hormone, ACTH administration is used to study the role of stress hormones in several reproductive processes [7, 8]. The administration of ACTH to sows replicates the effects of various chronic stressors, including restraint, heat [7, 9, 10], unpredictable noise [11], and transportation [12]. Previous studies have revealed the effects of sharp increases or short-term repeated ACTH administration on reproduction in sows (Table 1). Large multiple cystic ovarian follicles were induced by injections of ACTH for 48 h during the follicular phase of the estrous cycle, which lead to elevated progesterone (P4) levels [13]. ACTH treatment for 48 h during estrus disturbed the duration of standing estrus and increased the concentrations of P4 in sows [14]. The onset of estrus in ACTH-administered multiparous sows during the follicular phase was delayed by 2.5 days compared with the control cycle [15]. Follicles and oocytes from ACTH-treated sows showed signs of early degenerative changes, including the disorganization of cumulus cells and large lipid droplets in the cytoplasm of oocytes [16]. However, studies on sows related to ACTH administration are limited to the follicular or estrus phases. However, the dynamical changes in hormone secretion and development of follicles accompany follicle recruitment, selection, dominance, and atresia during the estrous cycle of female animals [17-19]. Experiments performed at different phases of the estrous cycle may have different results. For this reason, we believe that the effect of long-term ACTH administration on the reproduction of sows may be different from that of short-term ACTH administration. However, the effect of long-term repeated ACTH administration on sows, especially weaned sows, remains unclear. Long-term ACTH administration is required to adequately reflect the impact of stress hormones on sow reproduction.
| References | Replication (n) | Breeds | ACTH administration time | Dose of ACTH | Effect of ACTH on reproduction of sows |
|---|---|---|---|---|---|
| Gonzalez et al., 2015 | Control n = 3, ACTH n = 3 | — | Exposed for 24 hours to plasma from ACTH-treated | 5 μg/kg | Affect the sperm fertilizing ability through alterations in the acrosome reaction and correct sequence of PTP patterns. |
| Gonzalez et al., 2013 | Control n = 3, ACTH n = 3 | — | Oocytes were matured for 46 hours in the presence of plasma from ACTH-treated sows | 5 μg/kg | Induced alterations in actin cytoskeleton and mitochondrial patterns in oocytes |
| Lay et al., 2011 | Control n = 22, ACTH n = 21 | Landrace × Yorkshire | Once per week, for five weeks | 1 IU/kg | Exposing a sow to stress would alter the response of the offspring to lipopolysaccharide (LPS) at 2 mon of age or their response to mixing stress at 4 mon of age |
| Brandt et al., 2009 | Control n = 7, ACTH n = 7 | Swedish Landrace × Swedish Yorkshire | Every 2 h for 48 h | 2.5 μg/kg | Progesterone level↑; Interval between the peaks of oestradiol and LH to ovulation was prolonged; |
| Einarsson et al., 2008 | n = 4 | Landrace × Yorkshire | Every 2 h for 48 h | 2.5 μg/kg | Oocytes/embryos↓; Numbers of spermatozoa at the zona pellucida and retarded cleavage rate of fertilized ova ↓ |
| Einarsson et al., 2007 | n = 4 | Landrace × Yorkshire | Every 2 h for 48 h | 2.5 μg/kg | Prolongation of the oestrous cycle (2.5 days); |
| Brandt et al., 2007a | Control n = 8, ACTH n = 7 | Swedish Landrace × Swedish Yorkshire | Every 4 h for 48 h | 5 μg /kg | Stopped displaying signs of standing estrus sooner after ovulation ; Progesterone level ↑; Inhibin α level ↑ |
| Gee et al., 1991 | Control n = 5, ACTH n = 5 | Landrace × Yorkshire | For 48 h | 2 IU/kg | Pyknotic and karyorrhectic nuclei were seen in the ACTH treatment group. Follicles and oocytes from ACTH-treated sows showed signs of early degenerative changes including disorganization of cumulus cells and large lipid droplets in the cytoplasm of oocytes. |
To better understand the impact of long-term chronic stress on weaned sows, we administered synthetic ACTH at an 8 h interval for 7 days. Serum hormone levels, estrus onset time, ovarian morphology, and corpus luteum (CL) formation were analyzed. The results reflected the effect of long-term repeated ACTH administration on the reproductive steroid hormones and ovarian activity in weaned sows, which will aid in understanding the effects of ACTH and cortisol on the reproductive performance of sows during chronic stress.
This study was performed at Huaiyin Pig Breeding Farm in the Jiangsu province, China. Nine Suhuai sows approximately 38 months old, weighting 140.36 kg ± 4.73 kg, 4 parity, and with the same parturition dates were selected and housed in individual stalls after weaning. The experimental protocols were designed in accordance with the Guidance for the Care and Use of Laboratory Animals prepared by the Institutional Animal Care and Use Committee of Nanjing Agricultural University, Nanjing, China [20].
Experimental designThe sows were randomly divided into the two following groups, the control group (n = 4/group) and the ACTH group (n = 5/group). On the first day after weaning, jugular vein cannulation was performed as previously described [21]. Based on the methods of previous studies, from day three after weaning, the experimental group was injected intravenously with ACTH (1 IU/kg) three times daily for seven days (at 0800, 1600, and 2400 h), while the control group was injected with physiological saline [22, 23]. ACTH injection was performed as follows: a normal saline flush, followed by the injection of ACTH, followed by a normal saline flush (S), and finally heparin. The sows were euthanized on day 10 after weaning, and ovarian samples from both groups were removed and collected in physiological saline for follicle morphological analysis.
Estrus detectionEstrus was detected in the sows by examination of the vulva and boar contact test. Estrus detection was carried out twice daily (at 0800 and 1600 h) in the presence of a boar, beginning from day three after weaning. All sows received 5 min of daily fence-line boar contact, and estrus was defined by the exhibition of a standing reflex in response to the manual application of pressure to the back of the sow. Another sign of estrus was an enlarged, reddened vulva. The time interval between weaning and the first expression of standing estrus was recorded.
Blood collectionBlood samples were collected using a jugular cannula. Before observing the estrus signs, blood samples were collected 3 h after each injection three times a day for seven days. When the estrus signs were observed, blood samples were collected every 1 h for a total of 48 h. Blood samples were collected into 9 mL heparin-lithium-coated collection tubes, immediately placed on ice, and centrifuged at 1,500 × g for 15 min. The plasma was stored at –20°C until assaying for luteinizing hormone (LH), follicle-stimulating hormone (FSH), P4, and estradiol-17β (E2).
Hormones analysesThe concentrations of LH, FSH, E2 and P4 were detected by using RIAs [24]. Plasma samples were sent to the General Hospital of the Nanjing Military Region for the assay according to the manufacturer’s instructions (Beijing North Biotechnology Institute, Beijing, China). The competitive RIA was used as follows: The radiolabeled and non-labeled antigens were tested in a competitive manner with a limited amount of specific antibody. The unbound labeled antigen was isolated, and the radioactivity counts of the labeled antigen-antibody complexes were determined. The content of the substance in the samples was calculated using a standard curve and the mathematical model of RIA. The range of the LH standard was 5–200 mIU/mL and the range of the FSH standard was 2.5–100 mIU/mL. The sensitivity of LH and FSH was 1.0 mIU/mL. The sensitivity of the total E2 and P4 determinations was 5 pg/mL. The intra-assay variation was 5.5% for LH, 6.4% for FSH, 6.8% for E2 and 6.2% for P4, while the intra-assay variation was 10.2%, 10.4%, 9.8%, and 10.6%, respectively.
Morphological analysis of ovariesThe ovaries were weighed, and the ovarian organ index was calculated (ovary weight/sow weight). The Canon EOS 700 D camera was used to photograph the ovaries. The ISO speed was 640 and the focal length was 76 mm. The number of ovulated follicles (included the corpus rubrum and CL) was counted.
Quantitative real-time polymerase chain reaction (qRT-PCR)Total RNA was extracted from the CL using Trizol, as previously described (Invitrogen). RNase-free DNase I (TaKaRa) was used to remove genomic DNA from the RNA samples. cDNA was synthesized using the PrimeScript RT Master Mix kit (TaKaRa). qRT-PCR was performed using the SYBR Premix Ex Taq kit (TaKaRa) on a QuantStudio® 5 Real-Time PCR Detection system (Applied Biosystems). The primer sequences used for qPCR are shown in Table 2. The cycling parameters were as follows: 95°C for 5 min, followed by 40 amplification cycles, each at 95°C for 10 s, then 60°C for 30 s. All measurements contained a negative control (no cDNA template), and each RNA sample was analyzed in triplicate. The melting curve of each gene was checked, and there was non-specific reaction. Porcine β-actin was used as an endogenous control. Relative expressions of the target mRNAs were calculated using the 2–ΔΔCt method [25].
| Gene | NCBI Landing number | Primer pair sequence (5'→3') |
|---|---|---|
| β-actin | XM_003124280.4 | F: CCTGGACTTCGAGCAGGAGATGG R: TGTCGGCGATGCCTGGGTA |
| GR | NM_001008481.1 | F: CTCAGCAGCAACGGGACCAC R: TGAAGACACTTTCTGTAGCGGCAT |
| LHR | NM_214449.1 | F: TGGAGCATTTACAAATCTACCTCG R: TGGATTCGTTATTCATCCCTTG |
| FSHR | NM_214386.3 | F: GAACCTTCCCAACCTCCG R: GTATTTCTCGAATCCCATTCTTACT |
Statistical analysis was performed using the SPSS software (SPSS version 20.0). The independent sample t-test was performed to test the differences between treatment groups for estrus time, LH peak appearance time, ovarian organ index, ovulation number, and mRNA expression of the LH receptor (LHR), FSH receptor (FSHR), and glucocorticoid receptor (GR) in the CL. To analyze the pattern of hormone secretion, blood samples were split into the following two subsets:
(1) Before the estrus period, blood samples were collected 3 h after each injection from the beginning of the experiment to the appearance of estrus.
(2) Estrus period, blood samples were collected every 1 h for a total of 48 h from the onset of estrus.
Hormone concentrations were analyzed using repeated measures of ANOVA. The statistical models included the fixed effects of the time of sampling, treatment, and interaction between the time of sampling and treatment. One sow (sow 9) in the ACTH group had unique high hormone concentrations and was excluded, while repeated measures of ANOVA analysis were performed. LH secretion patterns were plotted using the GraphPad Prism software.The LH peak was identified using moving averages based on three recordings [14]. The proportions of sows in estrus were compared using the chi-square test. Data are presented as the mean ± standard error of the mean. p < 0.05 was considered statistically significant; p < 0.01 was considered statistically very significant.
All sows displayed normal estrus behavior and a standing response to the back-pressure test. The cumulative proportion of sows exhibiting estrus is shown in Fig. 1A. At 72 h (0 = onset of treatment), two control sows exhibited signs of estrus, but none of the sows exhibited estrus before 84 h in the ACTH group. All the control sows exhibited estrus for 96 h, while this was 120 h in the ACTH group. There was a significant difference (Fig. 1B) in the average time of first observed estrus between the ACTH group (99.00 ± 1.22 h) and the control group (84.00 ± 4.95 h).
Sows exhibited estrus relative to the time after treatment. A) Cumulative proportion of sows exhibiting estrus relative to the time after treatment (0 = onset of treatment). B) The estrus initiation time of the control and adrenocorticotropin hormone (ACTH) groups. The data are presented as the mean ± standard error of the mean, * p < 0.05 was considered statistically significant.
Repeated measures of ANOVA were used to analyze whether ACTH administration affected hormone secretion during the experiment or during estrus. For FSH (Fig. 2A, 3A) and LH (Fig. 2B, 3B), there was no significant difference in the treatment, time, and interaction between the treatment and time during the experiment and during estrus. For E2 and P4, there was no significant difference in the interaction between treatment and time during the experiment (Fig. 2C, 2D). However, the concentrations of E2 and P4 were significantly different at different times during the experimental period (p = 0.012 and 0.009, respectively). The concentrations of E2 in the ACTH group were significantly lower than those in the control group at 36, 42, and 66 h of the experimental period (Fig. 3C). The concentrations of P4 in the ACTH group were significantly lower than those in the control group at 132, 138, and 147 h of the experimental period (Fig. 3D).
The secretion pattern of follicle-stimulating hormone (FSH), luteinizing hormone (LH), estradiol-17β (E2), and progesterone (P4) in the control (n = 4) and ACTH groups (n = 4) during the experimental period. A) The FSH secretion pattern of the control and ACTH groups during the experimental period. B) The LH secretion pattern of the control and ACTH groups during the experimental period. C) The E2 secretion pattern of control and ACTH groups during the experimental period. D) The P4 secretion pattern of control and ACTH groups during the experimental period. Results are shown as the mean ± standard error of the mean. * p < 0.05 was considered statistically significant.
The secretion pattern of FSH, LH, E2 and P4 during the period of estrus in the control (n = 4) and ACTH groups (n = 4). A) The secretion pattern of FSH during the period of estrus in the ACTH and control groups. B) The secretion pattern of LH during the period of estrus in the ACTH and control groups. C) The secretion pattern of E2 during the period of estrus in the ACTH and control groups. D) The secretion pattern of P4 during the period of estrus in the ACTH and control groups. Results are shown as mean ± standard error of the mean.
All control sows showed an expected LH surge after weaning (Fig. 4A). Three sows in the ACTH group showed an LH surge, but no surge was observed in sow 6 and 8 (Fig. 4B). The LH surge in the control group appeared at 108.80 ± 5.54 h, while the LH peaks in the ACTH group appeared at 136.30 ± 3.75 h, the difference was statistically significant (Fig. 4C).
The LH surge of each sow in the control (sow 1–4, n = 4) and ACTH groups (sow 5–9, n = 5) at 3–160 h after treatment (0 = onset of treatment). A) The LH surge of each sow in the control group. B) The LH surge of each sow in the ACTH group. C) The mean time of LH peak appearance in the control and ACTH groups. The star (★) indicates the appearance of the LH peak.
No anatomical abnormalities, signs of infection, or ovarian cysts were found in the postmortem macroscopic examination of the reproductive organs of the sow. All ovaries obtained from control sows were ovulated and CLs were observed; however, two sows in the ACTH group did not ovulated. Interestingly, the ovarian morphology of the non-ovulated sows was similar to that of the ovaries of sows after weaning (Fig. 5A). The sows of the control group all ovulated within 10 days, and the ovulation rate in the control group was 100%, while it was 60% in the ACTH group (Fig. 5B). There was no significant difference between the two groups in either the average organ index (ACTH group ovulated sows, 8.85 ± 0.88; control group, 7.81 ± 0.57; Fig. 5C) or the numbers of ovulated follicles (ACTH group ovulated sows, 18.50 ± 1.32; control group, 17.33 ± 1.45; Fig. 5D).
Comparisons of ovarian morphology in sows of the control and ACTH groups. A) Photos of the ovarian morphology of the control and ACTH groups. B) The ovulation rate of sows in the control and ACTH groups. C) The organ index of the control (n = 4) and ACTH groups (n = 5). D) The numbers of ovulated follicles of sows in the control (n = 4) and ACTH groups (sows ovulated, n = 3). E) The mRNA expression of GR, FSHR and LHR in corpus luteum of sows after weaning. The data are presented as the mean ± standard error of the mean. * p < 0.05 was considered statistically significant.
To further investigate the potential mechanism of the reduction of P4 regulated by ACTH administration, hormones receptors were detected. The results showed that the mRNA expression of LHR in the CL was significantly lower in the ACTH-ovulated sows than in the control sows. There was no difference in the mRNA expression of FSHR and GR between the ACTH and control groups (Fig. 5E).
This study investigated the impact of long-term repeated ACTH administration on patterns of hormone secretion and ovarian function in weaned sows during the period of follicle development, dominance, and ovulation. The results indicated that long-term repeated ACTH administration decreased the concentrations of estrogen during the estrus phase, reduced the secretion of P4 after ovulation, and delayed the LH peak and estrus onset. Two sows of the ACTH group showed pseudo-estrus. Furthermore, three ovulated sows in the ACTH group had lower LHR expression in the CL than in the control group. ACTH administration did not affect the ovary weight or the number of ovulated follicles.
Cortisol is secreted during stress as a result of the activation of the HPA axis [26]. The administration of 1 IU/kg of body weight (BW) of ACTH effectively increased plasma cortisol concentrations for a minimum of 2 h [7]. The cortisol concentrations decreased to very low concentrations beginning 8 h after the last injection, which might be due to the impact of negative feedback from cortisol [14]. In accordance with the results of previous studies, the cortisol concentrations in the ACTH group (1 IU/kg BW) were three times higher than those in the control group on the first day of the experiment. Following the experiment, although the cortisol concentration in the ACTH group was reduced, it remained significantly higher than that in the control group [27], which could be attributed to the iterations of ACTH.
The ACTH-dose used (1 IU/kg BW, equivalent to 0.08 ug/kg BW and approximately 200–250 IU per sow) was, however, lower and the administration less frequent, but occurred over a longer period of time, than those of previous studies (Table 1). When ACTH (2.5 μg/kg) was administered every 2 h for 48 h before the onset of estrus, the intervals between the peaks of estradiol and LH to ovulation were prolonged [28]. However, administration of ACTH (5 μg/kg) repeated every 4 h for 48 h had no significant influence on the intervals between the LH peak and ovulation as well as E2 [29]. Consistent with the findings of Brandt et al. (2009), we found that the estrus time and LH peak of weaned sows were significantly delayed by ACTH administration (1 IU/Kg) repeated every 8 h for 7 days. Furthermore, our results showed that two sows did not exhibit an LH peak. The interference of ACTH administration on the pulsatile pattern of LH and the delay of the LH peak may be a result of the direct inhibition of cortisol on GnRH [19, 29]. LH surge, estrus, and ovulation were all inhibited when cortisol elevation was sustained [30].
The effects of short-term repeated stress occurred 48 h before the onset of estrus, indicated that ACTH administration had no effect on E2 patterns [15]. However, E2 levels were lower in the ACTH group than in the control group at 36, 42, and 66 h of the experimental period. Thus, our results are in contrast to those of a previous study that used short-term ACTH administration. Granulosa cells treated with ACTH in vitro may be characterized by lower E2 secretion [31]. Therefore, besides GnRH-dependent regulation, ACTH may directly affect the secretion of E2 which provides feedback to regulate secretion of the FSH and LH. FSH and E2 could increase the expression of LH receptors in the antral follicles and promote the maturation of follicles. A sufficiently high E2 level triggers the LH peak and leads to ovulation [32]. In this study, long-term repeated ACTH administration interfered with the timely generation of E2 in the follicular phase of sows and, consequently, failed to activate the LH surge during the estrus phase.
The secretion of P4 was increased in ACTH-induced short acute stress models during estrus [14, 28]. The results of the present study showed that P4 levels in the ACTH group were lower than those in the control group at 132, 138 and 147 h of the experimental period, during which ovulation had already occurred and CL had already formed. Furthermore, the mRNA expression of LHR in the CL significantly decreased. LHR plays a pivotal role in CL function through its interaction with LH, and luteal P4 production is dependent on LHR stimulation [33]. These results indicated that long-term repeated ACTH administration seriously affected the function of CL in weaned sow. The attenuated LH surge may have an adverse effect on the luteinization of ovulated follicles [34, 35]. Therefore, the reduction of P4 levels in the ACTH group might be partly due to the delayed LH surge, which may cause delayed ovulation and subsequent delayed CL development, resulting in lower expression of LHR mRNA and P4 synthesis in the CL. Nevertheless, another study reported that melanocortin type 2 receptor (MC2R) and GR were detected in rabbit luteal cells, indicating that ACTH and cortisol may exert direct action on CL [36]. However, our results showed that the GR and FSHR mRNA expression of sow CL was not influenced by long-term ACTH administration. This result indicated that the influence of ACTH on the P4 synthesis of CLs may be independent of GR pathway. However, the molecular mechanism of ACTH administration on P4 secretion in CL requires further study.
This study demonstrated that ACTH treatment three times daily for 1 week decreased E2 secretion in the follicular phase, delayed LH peak and estrus onset, and even caused pseudo-estrus and reduced the P4 secretion of CL. Furthermore, ACTH administration reduced the mRNA expression of LHR in the CL, but didn not influence the mRNA expression of GR. The results indicated that prolong ACTH administration plays a different role in the reproductive performance of sows compared with short-term ACTH administration. Furthermore, our study comprehensively reflected the dynamic changes in gonadotrophins and gonadal hormones during the period from weaning to ovulation under long-term repeated ACTH administration. Our results suggested that hypersecretion of ACTH or cortisol caused by long-term stressful stimuli may induce pseudo-estrus in weaned sows, which is associated with the alteration in LH secretion and follicle development, and possibly influenced CL function via the GR-independent pathway.
ACTH, Adrenocorticotropin hormone; BW, Body weight; CL, Corpus luteum; CRH, Corticotropin releasing hormone; EBPs, European breeding pigs; E2, Estradiol-17β; FSH, Follicle-stimulating hormone; FSHR, Receptor of FSH; GnRH, Gonadotropin-releasing hormone; GR, Receptor of glucocorticoid; HPA, Hypothalamus-pituitary-adrenal; LH, Luteinizing hormone; LHR, Receptor of LH; MC2R, Melanocortin type 2 receptor; P4, Progesterone; qPCR, Quantitative real–time PCR; RIA, Radioimmunoassay
This work was supported by the Natural Science Foundation of China (32002183 and 31972565) and the National Key Basic Research Program of China (973 Program) (2014CB138502).
Not applicable
Zhao Fang, Wei Quan-wei participated in data analysis, data interpretation and manuscript preparation. Wu Wang-jun, Liu Hong-lin participated in study design. Wu Wang-jun, Li Bo-jiang, Jiang Yi, Weng Qian-nan, Liu Kai-qing and Ning Cai-bo participated in data collection. All authors read and approved the final manuscript.
The experimental protocols were designed in accordance with the Guidance for the Care and Use of Laboratory Animals prepared by the Institutional Animal Care and Use Committee of Nanjing Agricultural University, Nanjing China [20].
Not applicable.
The authors declare that they have no competing interests.
