Effect of Di-(2-ethylhexyl) phthalate on the hypothalamus-pituitary-thyroid axis in adolescent rat

Abstract

Di-(2-ethylhexyl) phthalate (DEHP) is extensively used in many personal care and consumer products, which results in widespread human exposure. Limited studies have suggested that exposure to DEHP may affect thyroid function, but little is known about the effect and mechanisms of DEHP exposure on the hypothalamic-pituitary-thyroid axis (HPTA). The present study was conducted to elucidate the potential mechanisms underlying DEHP disrupting the function of the HPTA. DEHP was administered to Wistar rats by gavage at 0, 5, 50, and 500 mg/kg/day for consecutive 28 days and then the rats were sacrificed within 24 h following the last dose. The hormone levels of HPTA were quantified with radioimmunoassay and enzyme-linked immunosorbent assay, the protein levels of thyrotropin-releasing hormone receptor (TRHR) and thyroid-stimulating hormone receptor (TSHR) were analyzed by Western blot and immunohistochemistry, and the expression levels of TRHR and TSHR mRNA were measured by quantitative real-time PCR. The low dose of DEHP increased the body weights of rats. Serum levels of T3, T4, FT3 and FT4 as well as protein and mRNA levels of TSHR decreased in rats treated with 50 mg/kg or 500 mg/kg DEHP compared with those of controls. Although the protein levels of TRH in the hypothalamus or protein and mRNA levels of TRHR in pituitary were up-regulated, serum levels of TSH did not change statistically in rats treated with DEHP. Therefore, DEHP can produce thyroid toxicity and may interfere with the secretion of pituitary TSH. In conclusion, DEHP could interfere with the balance of HPTA of adolescent rats, and disturb the homeostasis of thyroid related hormones and the expression levels of receptors.

PHTHALIC ACID ESTERS (PAEs) are extensively used as a softener to increase the ductility and softness for polyvinyl chloride (PVC) products, including medical devices, plastic toys, beverage containers, and daily necessities [1-4]. Moreover, a variety of PAEs were found in all environmental media, including indoor and ambient air, water sources, and sediments [5-7]. Human exposure to PAEs mainly occurs through food consumption due to the use of PVC in wrapping materials and food processing [1, 8]. Once entrance of human body through contaminated food, di-(2-ethylhexyl)phthalate (DEHP), one of the most widely used and studied phthalates esters, is quickly metabolized to its monoester equivalent mono-(2-ethylhexyl)phthalate] (MEHP), which is preferentially absorbed into blood [9, 10]. The biological effects of MEHP are hence of major concern. In the past, researches about DEHP mainly focused on reproductive defects [11-13]. Currently, the thyroid toxic effects of DEHP is gaining the attention of the researchers.

The thyroid is the largest endocrine organ in human body. Its primary function is to secrete thyroid hormones (THs), which include T3, T4, free T3 (FT3), and free T4 (FT4) [14]. THs are critical regulating factors in the process of the growth and differentiation of most organs, especially for the nervous system, reproductive system and endocrine system. More importantly, they are also essential for energy homeostasis and many crucial metabolic pathways. Interestingly, it is reported that minor changes in THs may also produce direct and adverse effects on human health, including chronic fatigue syndrome, hypomnesia, goiter, and osteoporosis [15-17]. Limited studies suggest that exposure to DEHP may be associated with altered thyroid function. Some studies have observed an inverse association between MEHP urinary concentrations and free T4 and T3 serum levels in men and similar negative correlations have been found in pregnant women [18, 19]. In animal studies, rats and fishes fed with diets contaminated with DEHP were found to have thyroid alterations and lower plasma T4 concentrations [20, 21]. But the detailed mechanisms involved in this process are unclear.

The levels of THs are regulated by thyrotropin-releasing hormone (TRH) and thyroid-stimulating hormone (TSH). Thyroid related hormones are regulated by a feedback mechanism through the hypothalamic-pituitary-thyroid axis (HPTA) to keep internal environment of in vivo stable. Those factors, which can influence the balance of the HPTA, may cause abnormality of thyroid related hormone levels. Whether DEHP as an endocrine disruptor affects thyroid function by influencing the balance of HPTA remains unknown. In the present study, we explored the effects of DEHP on HPTA in adolescent rats by detecting and analyzing the changes of HPTA related protein and mRNA levels after DEHP exposure. It is important to investigate the DEHP toxicity comprehensively and systematically in order to offer scientific foundation for the human endocrine system.

Materials and Methods

Animals and treatments

Healthy Wistar rats of 21-d-old were acquired from the Experimental Animal Center of Jilin University, Changchun, China, and acclimatized for one week before exposure. Eighty rats (40 males and 40 females) were randomly divided into four groups (n = 20, 10 males 10 females each group), and different sex rats were put into separate cages. All rats were housed individually at 23 ± 1°C, in humidity set at 55 ± 5% in a 12 h cycle lighting control system room, with uninterrupted food and water supply. The changes of rats were observed and recorded twice a day. Animals were daily conducted by intragastric administration for 28 days with DEHP (Sinopharm Chemical Reagent, Shanghai, China, purity >99%) at 0 (control), 5, 50, and 500 mg/kg body weight in 5 mL/kg of corn oil.

Twenty-four hours after the last dose, rats were hocussed with chloral hydrate (10%) anesthesia. Blood was then collected and centrifuged at 1,500 rpm for 10 min to separate the serum. The separated serum was stored at –20°C for measurement. The detached hypothalamus, pituitary and thyroid were washed with physiological saline and weighed after removal from the rats. Then we rapidly dissected them into two parts: one was frozen immediately in liquid nitrogen and then kept at –80°C; another was fixed with 10% formalin for immunohistochemistry. All procedures on animals were in agreement with the Guide for the Care and Use of Laboratory Animals published by the Ministry of Health of People’s Republic of China.

Radioimmunoassay for T4, T3, FT4, FT3 and TSH

Thyroid hormones of T4, T3, FT4, and FT3 as well as TSH in serum were measured by radioimmunoassay kits (3V Biological Technology, Shandong, China). The tracer of radioimmunoassay kits was ¹²⁵I. Experimental operation was carried out in strict accordance with the instructions. There were no apparent cross reactions observed while conducting the experiment. All samples were done in duplicate.

ELISA for TRH

The level of TRH in hypothalamus was measured by enzyme-linked immunosorbent assay (ELISA) kits (R&D Systems China Co. Ltd., Shanghai, China). The total protein was extracted from the hypothalamus under asepsis condition. Microporous plate coated with TRH-antibody was prepared by adding 10-μL diluted sample and incubated at 37°C for 30 min. After five washes with distilled water, the samples were added with 50-μL horseradish peroxidase-labeled streptavidin and incubated at 37°C for 30 min. The samples were washed five times, and then covered chromogenic solution (50-μL A and 50-μL B) from the kit for 10 min at 37°C in darkness. In the end, the 50-μL stop solution was injected into holes to stop the reaction. Microplate Reader (BioTek Instruments, Inc., Vermont, USA) was used to measure the absorbance at 450 nm wavelength within 15 min of quenching the reaction.

Immunohistochemistry for protein expression of TRHR and TSHR

The paraffin sections of specimens of pituitary and thyroid after deparaffinization and rehydration were processed by antigen retrieval in 0.1 M citric acid solution in a microwave oven for 5 min. The sections were then incubated with 3% H₂O₂ in methanol for 10 min at room temperature to quench the endogenous peroxidase activity. The sections were blotted with normal serum blocking solution at 37°C for 30 min, and incubated with goat polyclonal anti-TRHR primary antibody (Santa Cruz Biotechnology, Heidelberg, Germany) and rabbit polyclonal anti-TSHR primary antibody (Santa Cruz Biotechnology) (1:200 by PBS) in a moist chamber overnight at 4°C. After washing three times in PBS, the treated specimens were combined with peroxidase-conjugated secondary antibody (Bioss Biotechnology Company, Beijing, China) (1:200 dilution by PBS) for 30 min at 37°C. After above steps, the staining of TRHR and TSHR was visualized by rat immunohistochemistry kits (Bioss Biotechnology Company). Histological sections were observed and photographed by the optical microscope (Nikon Instruments Co. Ltd, Tokyo, Japan).

Western blot analysis for protein levels of TRHR and TSHR

The pituitary and thyroid of rats were homogenized with cell lysis buffer (Beyotime Biotech Inc., Beijing, China). The concentrations of total tissue protein were measured by BCA Protein Assay Kit (Beyotime Biotech Inc.). Thirty micrograms of proteins were separated by 12% sodium dodecyl sulfate polyacrylamide gel and the isolated proteins were transferred to a nitrocellulose membrane. The membranes were put into blocking buffer containing 5% nonfat dry milk for 2 h at room temperature and then incubated with primary antibodies (Santa Cruz Biotechnology, dilution: 1:100) and anti-β-actin (Proteintech Inc., Chicago, USA, dilution: 1:2,000) overnight at 4°C. Then, the membranes were put into horseradish peroxidase conjugated secondary antibody and incubated for 45 min at 37°C. The up side of the membrane was covered with detection solution (ECL chemiluminescence Kit, Proteintech Inc.) for 5 min to react. The protein side of the membrane was exposed to X-ray films, which were used to scan and analyze. Image-ProPlus 6.0 (Media Cybernetics) was used to calculate grey value.

Quantitative real-time PCR for mRNA levels of TRHR and TSHR

Total RNA was extracted from the pituitary and thyroid with Trizol reagent (TaKaRa Biotechnology, Dalian, China). Quantitative real-time PCR (QPCR) was used to detect gene expression with Real-Time System (Stratagene MX3000p, California, USA). Reverse transcription was carried out with 500 ng total RNA in a 10-μL reaction (TaKaRa Biotechnology). Then we added 10-μL cDNA into 25-μL mixture, which contained primers and SYBR-Green Supermix (SYBR premix Ex Tap II, TaKaRa Biotechnology). The amplification program was carried out in 45 cycles of 95°C for 20 s and 60°C for 20 s. Beta-actin gene of rat was reference gene. The mRNA levels were quantified via the 2^–ΔΔCt method. The primers were listed in Table 1.

Table 1 Description of primers used in the present study

Primer	Type	Primer sequence
TRHR	Forward	GCCACTGTGCTTTACGGGTTTA
	Reverse	CCACTGCAAGCATCTTGGTGA
TSHR	Forward	TTTCGAGCCTGCCCAATATTTC
	Reverse	AAGCTTCTGGTGTTCCGGATTTC
β-actin	Forward	CCCATTGAACACGGCATTG
	Reverse	GGTACGACCAGAGGCATACA

Statistical analysis

The experimental results were listed as mean ± standard deviation. SPSS 13.0 statistical software (SPSS Inc. Chicago, Illinois, USA) was used for statistical analysis. According to normality and homogeneity of variance, experimental data were tested for one-way ANOVA or non-parametric test in SPSS. P < 0.05 was considered that the difference was statistically significant.

Results

Effect of DEHP on body weight

As shown in Table 2, the mean weight of rats administered with 5 mg/kg/d DEHP for four weeks was significantly higher than those of other groups (p < 0.05).

Table 2 Body weight of rats treated with DEHP during the administration period (g)

DEHP dosage (mg/kg/d)	week
	1	2	3	4
control	85.59 ± 12.27	123.42 ± 12.76	160.52 ± 19.20	190.05 ± 24.90
5	92.05 ± 13.66	128.28 ± 14.63	167.18 ± 20.48	215.35 ± 23.18*
50	90.50 ± 12.66	124.40 ± 15.25	156.24 ± 13.09	176.55 ± 23.45#
500	91.38 ± 12.42	126.45 ± 13.53	160.70 ± 15.37	181.68 ± 20.80#

* p < 0.05, compared to control; ^# p < 0.05, compared to 5 mg/kg/d.

Effect of DEHP on hormone levels

As shown in Fig. 1, TRH levels in the hypothalamus of rats treated with 500 mg/kg/d DEHP were significantly higher than those of control group and 5 mg/kg/d DEHP group (p < 0.05). There was no significant difference in serum TSH level among the various groups (p > 0.05). The serum levels of T3, T4, FT3 and FT4 in the group treated with 500 mg/kg/d DEHP were significantly lower compared with the control group (p < 0.05).

Fig. 1

Effects of DEHP on the levels of hormones (A) TRH in hypothalamus, (B) serum TSH , (C) serum T3, (D) serum T4, (E) serum FT3 and (F) serum FT4. N = 20, the levels of hormones were expressed as the mean value ± standard error. ^a p < 0.05 vs. Control group, ^b p < 0.05 vs. 5 mg/kg/d group.

Protein expression levels of TRHR and TSHR

Fig. 2 was the photos of immunohistochemistry sections of TRHR and TSHR staining. In the pituitary, positive staining for TRHR was found in the cytoplasm and membranes of cells (Fig. 2A). In the thyroid, positive staining for TSHR was found in the cytoplasm and membranes of cells (Fig. 2B).

Fig. 2

Immunohistochemical staining of TRHR expression in the pituitary (A) and TSHR expression in the thyroid (B) (200×).

Fig. 3 shows the protein bands of western blot and the contrast situation of gray values. In the pituitary, the protein expression of TRHR treated with 500 mg/kg/d group was significantly higher than those of other groups (p < 0.05, Fig. 3A, Fig. 3C). In the thyroid, the protein expression of TSHR of rats treated with 50 or 500 mg/kg/d group was significantly lower than those of the control and 5 mg/kg/d groups (p < 0.05, Fig. 3B, Fig. 3D).

Fig. 3

Protein bands of TRHR expression in the pituitary (A) and TSHR expression in the thyroid (B). Protein expression levels of TRHR in the pituitary (C) and TSHR in the thyroid (D). ^a p < 0.05 vs. Control group, ^b p < 0.05 vs. 5 mg/kg/d group, ^c p < 0.05 vs. 50 mg/kg/d group.

Gene expression levels of TRHR and TSHR

Fig. 4 shows the mRNA expression levels of TRHR and TSHR. In the pituitary, TRHR mRNA expression levels of rats treated with 50 or 500 mg/kg/d group was significantly higher than that of control (p < 0.05, Fig. 4A). Furthermore, the mRNA expression levels of TSHR in the thyroid of rats treated with 500 mg/kg/d were significantly lower than those of control and 5 mg/kg/d groups (p < 0.05, Fig. 4B).

Fig. 4

mRNA expression levels of TRHR in the pituitary (A) and TSHR in the thyroid (B). ^a p < 0.05 vs. Control group, ^b p < 0.05 vs. 5 mg/kg/d group.

Discussion

As a kind of environmental endocrine disruptors (EEDs), DEHP is a huge potential hazard. More and more researchers pay attention to DEHP. Studies about the threshold of DEHP had shown that 5 mg/kg/day was the no observed adverse effect level (NOAEL) of DEHP; 500 mg/kg/day DEHP levels can cause obvious toxicity in rats; 600 mg/kg was the threshold for the occurrence of acute toxicity in Wistar rat for the short term; and the LD50 of DEHP for rats was about 30 g/kg/day [22-25]. In order to better observe the toxic effects and mechanisms, our dosage was selected as follows: 500 mg/kg/day (1/60 LD50), 50 mg/kg/day (1/600 LD50), 5 mg/kg/day (1/6,000 LD50).

Adolescence is the key period to the growth and development. Compared with adults, adolescents are more sensitive to EEDs. Han-Bin Huang et al. found that the free T4 level was positively associated with urinary mono benzyl phthalate levels among minors, while there was not positive association among adult [26]. Therefore we chose 4 weeks old adolescent rats to explore the effects of DEHP on the hypothalamus-pituitary-thyroid axis.

In the present study, our experimental data show that a low dose of DEHP exposure resulted in increased body weight. DEHP could up-regulate TRH in the hypothalamus, up-regulate the protein and mRNA expression of TRHR in the pituitary, and down-regulate the protein and mRNA expression of TSHR in the thyroid, while THs levels in serum were decreased compared with control.

Body weight is the most important indicator for developmental changes among adolescents. The adolescent rats exposed to a low dose of DEHP had higher body weight, which is consistent with others studies. The available data verified that treatment with a low dose of endocrine disruptors during adolescent development could interfere with the normal homeostasis of the endocrine system, and may lead to the occurrence of overweight and obesity [27-29]. Since the function of THs is to regulate energy metabolism, it is possible that the decreased level of THs caused by DEHP exposure could induce fat accumulation. Since the specific mechanism is not clear, further studies are necessary to deeply study whether other mechanisms are responsible for fat metabolism disorders.

DEHP may cause many adverse effects, in addition to reproductive toxicity or embryo toxicity [11-13]. A possible regulating mechanism in the HPTA could account for the influence of thyroid. As previously demonstrated in growth of rats, TRH, regulated by the hypothalamic system, is released into the pituitary to stimulate TSH production. This hormone in serum has an effect on the thyroid and causes the thyroid to secrete THs. With the decreasing of the levels of T4 and T3 in serum, the thyroid will negatively regulate the biosynthesis and secretion of TRH and TSH [30, 31]. The results of our study showed that DEHP could directly influence the adolescent rat thyroid and could contribute to the lack of hormones. In the hypothalamus, the lowered circulating levels of T4 and T3 in the DEHP-treated rats primarily due to thyroid toxicity result in the increase TRH levels. These results that DEHP down-regulates the levels of THs and increases TRH expression in rats are consistent with a previous study [20]. Another report involving animal studies described that the decreased levels of serum T4 were associated with prolonged DEHP exposure [21]. Similar results were found in epidemiological studies [18, 19]. Moreover, other endocrine disruptors, such as polychlorinated biphenyls, have been shown to decrease of THs expression [32]. The negative feedback of low-levels of circulating THs increased secretion of serum TSH and TRH, and also promoted TSH secretion. However, the difference of TSH in various dose groups was not statistically significant. We put forward a hypothesis that, in addition to decreasing THs, DEHP produced toxic effects on pituitary and interfered with the normal secretion of TSH. This mechanism of disturbance is similar to estrogen-like effects of DEHP.

TRHR and TSHR are the key elements in HPTA. The regulatory mechanism, in mammals, is that DEHP induced hypothyroidism stimulates hypothalamic TRH secretion, which works on the pituitary with binding of TRH to TRHR on the surface of pituitary gland cells and increasing synthesis and the release of TSH [32, 33]. The TSH acts on the thyroid by interacting with TSHR to promote the secretion of THs [34, 35]. The results of this study show that DEHP exposure could raise the levels of both TRH in the hypothalamus and TRHR in the pituitary. Contrasted with untreated control group, mRNA expression levels of TRHR were significantly higher in 50 and 500 mg/kg/d groups, and similar tendency were observed with TRHR protein expression. Interestingly, the levels of TSH were slightly altered, but the TSHR protein expression in the 500 mg/kg/d group was significantly lower than lower-dose groups. Therefore, it is highly likely that the administration of DEHP to adolescent rats affected the hypothalamus little and changes of TRH and TRHR should be a reflex of negative feedback regulation of THs decline. The thyroid toxicity of DEHP could lead to reducing levels of THs and TSHR, and besides, the stimulatory effect of TSH could be inhibited by the decreasing of TSHR and continue to reduce THs.

In conclusion, DEHP could interfere with the balance of HPTA of adolescent rats and disturb the homeostasis of thyroid related hormones and the expression levels of receptors.

Abbreviations

DEHP, Di-(2-ethylhexyl) phthalate; EEDs, environmental endocrine disruptors; HPTA, hypothalamic-pituitary-thyroid axis; MEHP, mono-(2-ethylhexyl)phthalate; PAEs, Phthalic acid esters; PVC, polyvinyl chloride; QPCR, quantitative real-time PCR; THs, thyroid hormones; TRH, thyrotropin-releasing hormone; TRHR, thyrotropin-releasing hormone receptor; TSH, thyroid-stimulating hormone; TSHR, thyroid-stimulating hormone receptor

Acknowledgements

This study was supported by the National Natural Science Foundation of China (Grant No. 81573184).

Disclosure

None of the authors have any potential conflicts of interest associated with this research.

References

• 1   Testai  E,  Ms Scientific Committee  SCENIHR,  Hartemann  P,  Rastogi  SC,  Bernauer  U, et al. (2016) The safety of medical devices containing DEHP plasticized PVC or other plasticizers on neonates and other groups possibly at risk (2015 update). Regul Toxicol Pharmacol 76: 209–210.
• 2   Al-Natsheh  M,  Alawi  M,  Fayyad  M,  Tarawneh  I (2015) Simultaneous GC-MS determination of eight phthalates in total and migrated portions of plasticized polymeric toys and childcare articles. J Chromatogr B Analyt Technol Biomed Life Sci 985: 103–109.
• 3   Al-Saleh  I,  Elkhatib  R (2016) Screening of phthalate esters in 47 branded perfumes. Environ Sci Pollut Res Int 23: 455–468.
• 4   Wang  J,  Chen  G,  Christie  P,  Zhang  M,  Luo  Y, et al. (2015) Occurrence and risk assessment of phthalate esters (PAEs) in vegetables and soils of suburban plastic film greenhouses. Sci Total Environ 523: 129–137.
• 5   Wang  X,  Song  M,  Guo  M,  Chi  C,  Mo  F, et al. (2015) Pollution levels and characteristics of phthalate esters in indoor air in hospitals. J Environ Sci (China) 37: 67–74.
• 6   Ortiz-Colon  AI,  Pinero-Santiago  LE,  Rivera  NM,  Sosa  MA (2016) Assessment of concentrations of heavy metals and phthalates in two urban rivers of the northeast of Puerto Rico. J Environ Anal Toxicol 6: pii: 1000353.
• 7   Wang  J,  Lv  S,  Zhang  M,  Chen  G,  Zhu  T, et al. (2016) Effects of plastic film residues on occurrence of phthalates and microbial activity in soils. Chemosphere 151: 171–177.
• 8   Zota  AR,  Phillips  CA,  Mitro  SD (2016) Recent fast food consumption and bisphenol A and phthalates exposures among the U.S. population in NHANES, 2003–2010. Environ Health Perspect 124: 1521–1528.
• 9   Eckert  E,  Muller  J,  Goen  T (2015) Simultaneous determination of polyvinylchloride plasticizers di(2-ethylhexyl) phthalate and tri(2-ethylhexyl) trimellitate and its degradation products in blood by liquid chromatography-tandem mass spectrometry. J Chromatogr A 1410: 173–180.
• 10   Lin  CY,  Hsieh  CJ,  Lo  SC,  Chen  PC,  Torng  PL, et al. (2016) Positive association between concentration of phthalate metabolites in urine and microparticles in adolescents and young adults. Environ Int 92–93: 157–164.
• 11   Liu  T,  Li  N,  Zhu  J,  Yu  G,  Guo  K, et al. (2014) Effects of di-(2-ethylhexyl) phthalate on the hypothalamus-pituitary-ovarian axis in adult female rats. Reprod Toxicol 46: 141–147.
• 12   Li  N,  Liu  T,  Zhou  L,  He  J,  Ye  L (2012) Di-(2-ethylhcxyl) phthalate reduces progesterone levels and induces apoptosis of ovarian granulosa cell in adult female ICR mice. Environ Toxicol Pharmacol 34: 869–875.
• 13   Li  N,  Liu  K,  Yuan  H,  Zhu  J,  Yu  G, et al. (2015) The effect of mono-(2-ethylhexyl) phthalate on apoptosis of rat ovarian granulosa cells in vitro. Environ Toxicol Pharmacol 39: 643–650.
• 14   D’Alecy  LG (1997) Thyroid hormone in neural rescue. Thyroid 7: 115–124.
• 15   Wyller  VB,  Vitelli  V,  Sulheim  D,  Fagermoen  E,  Winger  A, et al. (2016) Altered neuroendocrine control and association to clinical symptoms in adolescent chronic fatigue syndrome: a cross-sectional study. J Transl Med 14: 121.
• 16   Roman  C,  Fuior  EV,  Trusca  VG,  Kardassis  D,  Simionescu  M, et al. (2015) Thyroid hormones upregulate apolipoprotein E gene expression in astrocytes. Biochem Biophys Res Commun 468: 190–195.
• 17   Liu  Y,  Huang  H,  Zeng  J,  Sun  C (2013) Thyroid volume, goiter prevalence, and selenium levels in an iodine-sufficient area: a cross-sectional study. BMC Public Health 13: 1153.
• 18   Meeker  JD,  Calafat  AM,  Hauser  R (2007) Di(2-ethylhexyl) phthalate metabolites may alter thyroid hormone levels in men. Environ Health Perspect 115: 1029–1034.
• 19   Huang  PC,  Kuo  PL,  Guo  YL,  Liao  PC,  Lee  CC (2007) Associations between urinary phthalate monoesters and thyroid hormones in pregnant women. Hum Reprod 22: 2715–2722.
• 20   Liu  C,  Zhao  L,  Wei  L,  Li  L (2015) DEHP reduces thyroid hormones via interacting with hormone synthesis-related proteins, deiodinases, transthyretin, receptors, and hepatic enzymes in rats. Environ Sci Pollut Res Int 22: 12711–12719.
• 21   Zhai  W,  Huang  Z,  Chen  L,  Feng  C,  Li  B, et al. (2014) Thyroid endocrine disruption in zebrafish larvae after exposure to mono-(2-ethylhexyl) phthalate (MEHP). PLoS One 9: e92465.
• 22   Kavlock  R,  Boekelheide  K,  Chapin  R,  Cunningham  M,  Faustman  E, et al. (2002) Ntp center for the evaluation of risks to human reproduction: phthalates expert panel report on the reproductive and developmental toxicity of di-n-octyl phthalate. Reprod Toxicol 5: 721–734.
• 23   Ge  RS,  Chen  GR,  Tanrikut  C,  Hardy  MP (2007) Phthalate ester toxicity in Leydig cells: developmental timing and dosage considerations. Reprod Toxicol 23: 366–373.
• 24   Dong  X,  Dong  J,  Zhao  Y,  Guo  J,  Wang  Z, et al. (2017) Effects of long-term in vivo exposure to di-2-ethylhexylphthalate on thyroid hormones and the TSH/TSHR signaling pathways in wistar rats. Int J Environ Res Public Health 14: pii: E44.
• 25   Douglas  GR,  Hugenholtz  AP,  Blakey  DH (1986) Genetic toxicology of phthalate esters: mutagenic and other genotoxic effects. Environ Health Perspect 65: 255–262.
• 26   Huang  HB,  Pan  WH,  Chang  JW,  Chiang  HC,  Guo  YL, et al. (2017) Does exposure to phthalates influence thyroid function and growth hormone homeostasis? The Taiwan Environmental Survey for Toxicants (TEST) 2013. Environ Res 153: 63–72.
• 27   Smerieri  A,  Testa  C,  Lazzeroni  P,  Nuti  F,  Grossi  E, et al. (2015) Di-(2-ethylhexyl) phthalate metabolites in urine show age-related changes and associations with adiposity and parameters of insulin sensitivity in childhood. PLoS One 10: e0117831.
• 28   Hao  C,  Cheng  X,  Xia  H,  Ma  X (2012) The endocrine disruptor mono-(2-ethylhexyl) phthalate promotes adipocyte differentiation and induces obesity in mice. Biosci Rep 32: 619–629.
• 29   Somm  E,  Schwitzgebel  VM,  Toulotte  A,  Cederroth  CR,  Combescure  C, et al. (2009) Perinatal exposure to bisphenol a alters early adipogenesis in the rat. Environ Health Perspect 117: 1549–1555.
• 30   Segerson  TP,  Kauer  J,  Wolfe  HC,  Mobtaker  H,  Wu  P, et al. (1987) Thyroid hormone regulates TRH biosynthesis in the paraventricular nucleus of the rat hypothalamus. Science 238: 78–80.
• 31   Marsili  A,  Sanchez  E,  Singru  P,  Harney  JW,  Zavacki  AM, et al. (2011) Thyroxine-induced expression of pyroglutamyl peptidase II and inhibition of TSH release precedes suppression of TRH mRNA and requires type 2 deiodinase. J Endocrinol 211: 73–78.
• 32   Liu  C,  Ha  M,  Cui  Y,  Wang  C,  Yan  M, et al. (2012) JNK pathway decreases thyroid hormones via TRH receptor: a novel mechanism for disturbance of thyroid hormone homeostasis by PCB153. Toxicology 302: 68–76.
• 33   Kelly  JA,  Boyle  NT,  Cole  N,  Slator  GR,  Colivicchi  MA, et al. (2015) First-in-class thyrotropin-releasing hormone (TRH)-based compound binds to a pharmacologically distinct TRH receptor subtype in human brain and is effective in neurodegenerative models. Neuropharmacology 89: 193–203.
• 34   Neumann  S,  Nir  EA,  Eliseeva  E,  Huang  W,  Marugan  J, et al. (2014) A selective TSH receptor antagonist inhibits stimulation of thyroid function in female mice. Endocrinology 155: 310–314.
• 35   Al-Azzam  SI,  Alzoubi  KH,  Khabour  O,  Al-Azzeh  O (2014) The associations of polymorphisms of TSH receptor and thyroid hormone receptor genes with L-thyroxine treatment in hypothyroid patients. Hormones (Athens) 13: 389–397.