Abstract
We previously demonstrated hepatic, cardiac, and skin inflammation in a high-fat diet-induced steatotic liver disease (SLD) model. However, the molecular mechanism in the kidneys in this model remains unclear. It has been recently reported that SGLT2 inhibitors improve chronic kidney disease (CKD). Therefore, we used this model to evaluate the effects of tofogliflozin on renal lipid metabolism and inflammation. Male 8–10-week-old C57Bl/6 mice were fed a high-fat/high-cholesterol/high-sucrose/bile acid (HF/HC/HS/BA) diet with 0.015% tofogliflozin (Tofo group) or an HF/HC/HS/BA diet alone (SLD group). After eight weeks, serum lipid profiles, histology, lipid content, and mRNA/microRNA and protein expression levels in the kidney were examined. The Tofo group showed significant reductions in body (26.9 ± 0.9 vs. 24.5 ± 1.0 g; p < 0.001) and kidney weight compared to those of the SLD group. Renal cholesterol (9.1 ± 1.6 vs. 7.5 ± 0.7 mg/g; p < 0.05) and non-esterified fatty acid (NEFA) (12.0 ± 3.0 vs. 8.4 ± 1.5 μEq/g; p < 0.01) were significantly decreased in the Tofo group. Transmission electron microscopy revealed the presence of fewer lipid droplets. mRNA sequencing analysis revealed that fatty acid metabolism-related genes were upregulated and NFκB signaling pathway-related genes were downregulated in the Tofo group. MicroRNA sequencing analysis indicated that miR-21a was downregulated and miR-204 was upregulated in the Tofo group. Notably, the expression of PPARα, which has been known to be negatively regulated by miR-21, was significantly increased, leading to enhancing β-oxidation genes, Acox1 and Cpt1 in the Tofo group. Tofogliflozin decreased renal cholesterol and NEFA levels and improved inflammation through the regulation of PPARα and miR-21a.
Introduction
Chronic kidney disease (CKD) is a high-risk condition for cardiovascular disease mortality [1]. Previous clinical studies have reported that dysregulation of renal lipid metabolism is involved in the development and progression of CKD [2, 3]. Although angiotensin-converting enzyme inhibitors and angiotensin II receptor blockers have been used to treat CKD, it has recently been reported that sodium-glucose cotransporter 2 inhibitors (SGLT2i) have renoprotective effects in patients with CKD [4, 5].
Several studies have used rodent models to reveal underlying mechanisms. It has been reported that the mechanisms of renal function improvement by SGLT2i involve the renin-angiotensin-aldosterone system, tubuloglomerular feedback, improvement in hypoxia, and increase in ketones [6-8]. However, the renoprotective effects of SGLT2i through regulation of lipid metabolism and related inflammation remain unclear.
In our previous studies, we have used a high-fat diet [9] or a high-fat/high-cholesterol/high-sucrose/bile acid (HF/HC/HS/BA) diet to explore the underlying mechanism of steatotic liver disease (SLD) in mice [10, 11]. In the heart of a steatohepatitic model induced by a HF/HC/HS/BA diet, cholesterol deposition and inflammasome-related inflammation were observed, leading to cardiac dysfunction [10]. In an imiquimod-induced dermatitis in a steatohepatitis model, psoriasis-like skin lesions were exacerbated by enhanced inflammation [11]. In one clinical study, SLD was associated with renal dysfunction [12]. Therefore, in the current study, we aimed to investigate whether the kidney is affected by steatohepatitis and whether tofogliflozin could improve renal lipid metabolism and inflammation.
Materials and Methods
i. Animals and diets
C57Bl/6 male mice were obtained from Charles River Laboratories (Tokyo, Japan) and housed in a temperature- and humidity-controlled facility with a 12-h light/dark cycle. Two diets containing the HF/HC/HS/BA diet (20% casein, 50% sucrose, 15% cocoa butter, 1.25% cholesterol, 0.5% cholate) with 0.015% tofogliflozin (Tofo group) or without tofogliflozin (SLD group) were prepared by Oriental Yeast Co., Ltd. (Chiba, Japan) and administered to mice, aged 8–10 weeks, for eight weeks. We also conducted a 16-week study in which C57Bl/6 mice were fed the HF/HC/HS/BA diet (SLD group), HF/HC/HS/BA + tofogliflozin diet (Tofo group), or normal chow diet (Chow group) for 16 weeks. Tofogliflozin was provided by Kowa Company, Ltd. (Aichi, Japan). The experimental protocol was approved by the Ethics Review Committee for Animal Experimentation of the Osaka University School of Medicine (03-046-004). All the experiments were conducted in accordance with the Guide for the Care and Use of Laboratory Animals.
ii. Biochemical analyses
Serum total cholesterol (TC), high-density lipoprotein cholesterol (HDL-C), and triglyceride (TG) levels were measured using enzymatic methods (Fujifilm, Tokyo, Japan). Non-HDL-C levels were calculated as TC minus the HDL-C level. Plasma lipoprotein levels were measured after fasting the mice for 4 h. Renal TC, free cholesterol (FC), TG, and non-esterified fatty acids (NEFA) were also measured (Fujifilm) after lipid extraction from the kidney tissue using the Folch method. Urinary glucose excretion was assessed using a Uropiece (295-51127-4; Minaris Medical Co., Ltd., Tokyo, Japan). Serum and urinary creatinine levels were measured using L-Type Creatinine M (460-69701, Fujifilm). Urinary albumin levels were measured using an LBIS Mouse Urinary Albumin Assay Kit (634-04301, Fujifilm). Serum insulin levels were measured using an Ultra Sensitive Mouse Insulin ELISA Kit (M1104, Morinaga Institute of Biological Science, Kanagawa, Japan).
iii. Histologic and immunohistochemical analyses
Paraffin-embedded sections were stained with hematoxylin and eosin (Muto Pure Chemicals, Tokyo, Japan) and Periodic Acid-Schiff (Cat.No.15792, Muto Pure Chemicals). For lipid staining, frozen sections were stained with Oil Red O (M3G0644; Nacalai Tesque, Kyoto, Japan). Macrophages were detected using F4/80 (MCA497R, Bio–Rad, Tokyo, Japan) and Vectastain secondary antibodies (Vector Laboratories, Burlingame, CA, USA).
iv. Transmission electron microscopy
Kidneys were immediately fixed in half Karnovsky’s fixative. Transmission electron microscopy (TEM) was performed using HT7800 (Hitachi High-Tech, Tokyo, Japan), and assessed number of lipid droplets (LDs).
v. Quantitative polymerase chain reaction
Total RNA was isolated from the renal cortex tissues using the RNeasy Mini Kit (Cat.No.74106, QIAGEN, Hilden, Germany) or NucleoSpin miRNA (Cat.No.740971, Takara Bio, Shiga, Japan). RNA was reverse transcribed using the SuperScript VILO cDNA Synthesis Kit (Cat.No.11754, Termo Fisher Scientific, MA, USA) or the Mir-X miRNA First-Strand Synthesis Kit (Cat.No.638313, Takara Bio, Shiga, Japan). RT-qPCR was performed using SYBR Select Master Mix (Cat.No.4472908, Thermo Fisher Scientific), Mir-X miRNA qRT-PCR TB Green Kit (Cat.No.638314, Takara Bio), and 7900 Sequencing Detection System (Applied Biosystems, CA, USA). The specific primers used for qPCR are listed in Supplemental Table 1.
vi. RNA and miRNA sequencing analyses
RNA or microRNA (miRNA) sequencing was performed on the NovaSeq 6000 platform in the 101-base single-end mode. For RNA sequencing, Illumina RTA ver. 3.4.4 software (Illumina Inc., CA, USA) was used for the base calling. Raw reads were mapped to mouse reference genome sequences (mm10) using TopHat ver. 2.1.1 [13], in combination with Bowtie2 ver. 2.2.8 [14] and SAMtools ver. 0.1.18 (San Diego, CA, USA) [15]. The number of fragments per kilobase of exons per million mapped fragments was calculated using Cufflinks ver. 2.2.1 (Seattle, WA, USA) [16]. In miRNA sequencing, the 3′ adapter sequence (AGATCGGAAGAGCACACGTCT) was trimmed from reads using Cutadapt 1.14. before analysis of the small RNA-seq data. Trimmed reads were mapped to the mouse genome sequence (mm10) and quantified using the miRBase mouse miRNA dataset and the software StrandNGS ver.4.0 (Strand Life Sciences Pvt. Ltd., Bangalore, India). A heatmap was created using gplots in R software. Pathway analysis was performed using the STRING network tool. The raw data of this study are available under the Gene Expression Omnibus (GEO) accession number GSE251739.
vii. Western blotting
The antibodies for peroxisome proliferator activated receptor alpha (PPARα, sc-398394, Santa Cruz Biotechnology, TX, USA), carnitine palmitoyltransferase 1 (CPT1, sc-393070, Santa Cruz Biotechnology), and βactin (A3854, Sigma Aldrich, MO, USA) were purchased respectively. Membranes were imaged using an Image Quant LAS 4000 camera system (GE Healthcare, IL, USA). The band intensity was quantified using ImageJ software (National Institute of Mental Health, Bethesda, MD, USA).
viii. Statistical analyses
All results are presented as mean ± SEM. p values were calculated using Student’s t-test.
Results
Renal lipid deposition and macrophage infiltration were suppressed by tofogliflozin in diet-induced steatohepatitic mice
We focused on the kidneys of C57Bl/6 male mice fed the HF/HC/HS/BA diet for eight weeks with (Tofo group) or without (SLD group) tofogliflozin. First, we measured fasting blood glucose levels, fasting insulin levels, and urinary glucose excretion. In the Tofo group, fasting blood glucose was significantly reduced (173 ± 25 vs. 135 ± 25 mg/dL; p < 0.005) and urinary glucose excretion was recognized by urine test strips (Fig. 1A, B). Serum fasting insulin levels did not significantly change (Fig. 1A). Body and kidney weights were significantly reduced in the Tofo group (26.9 ± 0.9 vs. 24.5 ± 1.0 g; p < 0.05, and 0.14 ± 0.02 vs. 0.13 ± 0.02 g; p < 0.05, respectively) (Fig. 1C, D). Notably, serum TC and non-HDL-C levels were significantly decreased in the Tofo group (204 ± 37 vs. 153 ± 22 mg/dL; p < 0.001, and 145 ± 31 vs. 105 ± 14 mg/dL; p < 0.001, respectively), but serum TG and NEFA were not reduced (Fig. 1E). Next, we investigated the renal histology using hematoxylin and eosin (H.E.), Periodic Acid-Schiff (PAS), F4/80, and Oil Red O (O.R.O). There were some vacuoles in the renal tubular epithelial cells in the SLD group, but not in the Tofo group. Macrophage infiltration and lipid deposition were observed using F4/80 or O.R.O staining in the SLD group, and were suppressed in the Tofo group (Fig. 1F). However, the glomerular area, serum creatinine, and urinary albumin-to-creatinine ratio (UACR) did not differ between the two groups (Fig. 1G–J). Furthermore, we performed an extended study for 16 weeks in which C57Bl/6 mice were fed a normal chow diet (Chow group), HF/HC/HS/BA diet (SLD group), or HF/HC/HS/BA + tofogliflozin diet (Tofo group) (Supplemental Fig. 1A). In the liver, we confirmed that the O.R.O and F4/80 positive area increased in the SLD group compared with those in the Chow group, and then decreased in the Tofo group (Supplemental Fig. 1B, C). Consistent with these results, hepatic cholesterol and TG levels were higher in the SLD group than in the Chow group and were reduced in the Tofo group (Supplemental Fig. 1D). In the kidneys, we investigated the histology using PAS and Sirius Red staining, which showed that glomerular size did not differ among the three groups (Supplemental Fig. 1E, F). Sirius Red staining showed that the Sirius Red-positive area was increased in the SLD group compared with that in the Chow group, which was attenuated in the Tofo group (Supplemental Fig. 1E, G). Importantly, serum creatinine levels were higher in the SLD group than in the Chow group and lower in the Tofo group (Supplemental Fig. 1H). These results suggest that renal dysfunction was induced by this SLD model at 16 weeks, which mainly occurred in the tubular epithelial cells but not in the glomeruli.
To reveal the renal lipid deposition, we performed TEM. We observed lipid droplets on tubular epithelial cells in the SLD group (Fig. 2A), and the number of lipid droplets was reduced in the Tofo group (Fig. 2B). However, no obvious lesions were observed in the glomerular podocytes of the two groups (Fig. 2C), which was consistent with the unchanged glomerular area, serum Cre, and UACR (Fig. 1G–J). To confirm lipid deposition in the kidney, we extracted lipids and measured cholesterol, TG, and NEFA levels. Renal cholesterol and NEFA were significantly reduced in the Tofo group (9.1 ± 1.6 vs. 7.5 ± 0.7; p < 0.05 and 12.0 ± 3.0 vs. 8.4 ± 1.5; p < 0.01, respectively) (Fig. 2D). These results suggest that lipid droplets located in tubular epithelial cells accumulated in mice with HF/HC/HS/BA diet-induced steatohepatitic mice and were reduced using tofogliflozin.
Tofogliflozin altered fatty acid metabolism and inflammation-related gene expressions
To elucidate the underlying metabolic pathways, we investigated gene expression using RNA sequencing and qRT-PCR. RNA sequencing showed that genes related to fatty acid metabolism (Metabolic Pathways, Fatty acid elongation, and Fatty acid degradation) and Aldosterone-regulated sodium reabsorption pathways were upregulated, and genes related to the NFκB signaling pathway were downregulated in the Tofo group (Fig. 3A, B). The mRNA expression levels of Fasn, Acc, and Scd1 were significantly decreased in the Tofo group (Fig. 3C). No differences were observed in the expression levels of genes related to cholesterol metabolism (Fig. 3C). Importantly, the mRNA expression of Il1β was significantly reduced, and other inflammation-related genes (Tnfα, Nlrp3, Casp1, and F4/80) tended to be reduced in the Tofo group (Fig. 3C). The previous study has demonstrated that free fatty acid and free cholesterol induce NLRP3 inflammasome, which drives IL-1β secretion [17]. These results suggest that tofogliflozin reduces renal cholesterol levels, NEFA deposition, and the inflammatory response.
To explore the cause of the upregulation of β-oxidation-related gene expressions in the RNA sequencing analysis, we examined the nuclear transcription factor PPARα and its target genes. Pparα mRNA and its target genes, Acox1 and Pdk4 mRNA, were upregulated, whereas Cd36 mRNA was impaired in the Tofo group (Fig. 4A). Renal PPARα and CPT1 protein levels were also significantly increased in the Tofo group (Fig. 4B).
Tofogliflozin restored PPARα via a decrease in miR-21a-5p expression
To further elucidate the mechanism of the differential direction of the expression pattern of PPARα and its target gene, CD36, miRNA sequencing analysis was further performed. As a result of miRNA sequencing, 14 miRNAs were significantly upregulated and 19 miRNAs were downregulated (p < 0.05) compared to the SLD group (Fig. 5A, B). Among these 33 miRNAs, miR-21a and miR-204 were included in the analysis. We performed RT-qPCR to confirm our results (Fig. 5C). In previous studies, it has been reported that PPARα mRNA is a target of miR-21 [18]. In addition, miR-204-3p inhibited CD36 transcription [19]. Therefore, these results suggested that tofogliflozin enhanced PPARα and target genes by suppressing miR-21a-5p and CD36 was downregulated by enhanced miR-204-3p expression, leading to decreased excess fatty acid uptake.
Discussion
In the current study, we fed C57Bl/6 mice an HF/HC/HS/BA diet with or without 0.015% tofogliflozin for eight weeks and demonstrated that tofogliflozin attenuated lipid deposition and inflammation in the kidney. To the best of our knowledge, this is the first study to suggest that tofogliflozin upregulates PPARα mRNA and protein levels via miR-21a regulation. Furthermore, CD36, a target gene of PPARα, was not upregulated through miR-204 mechanism (Graphical Abstract). Recently, fatty acids have been identified as the main energy source for tubular epithelial cells, and impaired fatty acid oxidation in these cells has been reported to induce tubulointerstitial inflammation and fibrosis [3]. Therefore, we considered that tofogliflozin recovered fatty acid oxidation through PPARα upregulation.
Among the small non-coding RNA molecules, miR-21 is widely known as a tumor-associated miRNA [20], and its expression has been reported to be elevated in many pathological patients, such as those with cardiovascular disease [21]. In the kidney, Chau et al. have reported that the expression of PPARα and its target genes were upregulated in miR-21–/– mice compared with controls in unilateral ureteral obstruction and unilateral ischemia-reperfusion injury models [18]. PPARα was negatively regulated by miR-21, leading to renal fibrosis [18]. In cell culture experiments, Das et al. reported that miR-21 expression was increased in high glucose-treated HK-2 cells due to high glucose-induced oxidative stress, and that inhibition of glucose uptake by empagliflozin suppressed miR-21 expression [22]. Therefore, we considered that tofogliflozin enhanced PPARα signaling by suppressing miR-21a expression in HF/HC/HS/BA-fed steatotic liver mice.
Additionally, tofogliflozin upregulated the expression of miR-204, which is abundant in the kidneys. Deletion of miR-204 leads to the upregulation of protein tyrosine phosphatase (SHP2) and increased phosphorylation of signal transducer and activator of transcription 3 (STAT3), which accelerates renal inflammation [23]. Recently, Liu et al. have reported that miR-204-3p localizes to the nucleus and inhibits CD36 transcription in macrophages [19]. In this study, we have shown upregulation of PPARα and target genes, but not CD36, which may be explained by the enhancement of miR-204-3p by tofogliflozin. In terms of transcriptional regulators of CD36, peroxisome proliferator-activated receptors (PPARs) [24, 25], CCAAT/enhancer-binding protein alpha (C/EBPα), and FOXO1 have been reported [26, 27]. However, there were no differences in expression levels of C/EBPα and FOXO1 pathway in RNA sequencing in this study.
This study had several limitations. First, our model did not reach an advanced CKD stage because of its short feeding period. This is because we would like to compare the experimental results with previous data [10, 11]. Further experiments are required to explore the effect of tofogliflozin on glomerular area, serum creatinine, UACR, and renal fibrosis. Second, Wu et al. reported that the expression of miR-21a increases in the livers of HFD-treated mice [28]. It is possible that miR-21a, which is secreted by the liver, affects the kidneys. Further studies using liver-specific miR-21a knockout mice are required to explore this hypothesis. Third, there is the possibility that tofogliflozin may upregulate PPARα in other cells, such as glomerular and collecting ducts as well as in tubular epithelial cells. On the other hand, SGLT2 is located in proximal tubular cells, and tubular epithelial cells use fatty acids as their main energy source, whereas other cells use glucose [3]. Therefore, we considered that PPARα upregulation could occurr in the proximal tubular cells. Finally, the molecular mechanisms by which SGLT2-mediated glucose influx affects miR-204/21a expression remain unknown. RNA sequencing revealed that VMP1, the host gene of miR-21a, was unchanged, and TRPM3, the host gene of miR-204, was upregulated in the Tofo group. Therefore, we considered that tofogliflozin indirectly downregulated miR-21a through the regulation of the miR-21a original promoter and upregulated miR-204 through the regulation of the TRPM3 promoter. To confirm their exact mechanisms, in vitro experiments can be conducted in the future. As the expression of ACC, FASN, and SCD1 was downregulated by tofogliflozin, we considered that tofogliflozin might inhibit lipogenesis.
Acknowledgments
The authors thank Misako Kobayashi and Kumiko Furukawa for technical assistance. This study was supported by Tomoaki Mizuno and the Center for Medical Research and Education at the Graduate School of Medicine, Osaka University.
Disclosure
This work was supported by a research grant from the Kowa Company, Ltd. M.K. received a lecturer fee, and M.K. and Y.S. received scholarship grants from Kowa Company, Ltd. S.N., K.T., T.O (Omatsu)., A.S., H.S., H.I., T.O (Okada)., T.O (Ohama)., D.O., Y.K., M.O., M.N., and M.W. declare no competing interests.
Mikio Watanabe is a member of Endocrine Journal’s Editorial Board.
Funding
This research was supported by a research grant from Kowa Company, Ltd., a grant from the Japan Agency for Medical Research and Development (AMED) (grant number J230705536), and the Japan Society for the Promotion of Science (JSPS) KAKENHI (grant numbers 21K08323, 22H02967, 22K08670, and 23K07968).
Supplemental Table 1 SYBER primers used for real-time quantitative PCR
| Primer |
Sequence (5′-3′) |
3-Hydroxy-3-Methylglutaryl-CoA Reductase
(Hmgcr) |
F: GATTCTGGCAGTCAGTGGGAA
R: GTTGTAGCCGCCTATGCTCC |
3-Hydroxy-3-Methylglutaryl-CoA Synthase 1
(Hmgcs) |
F: GCCGTGAACTGGGTCGAA
R: GCATATATAGCAATGTCTCCTGCAA |
ATP Binding Cassette Subfamily A Member 1
(Abca1) |
F: ATTGCCAGACGGAGCCG
R: TGCCAAAGGGTGGCACA |
ATP Binding Cassette Subfamily G Member 1
(Abcg1) |
F: TTCCCCTGGAGATGAGTGTC
R: CAGTAGGCCACAGGGAACAT |
Fatty Acid Synthase
(Fasn) |
F: AGGCTGTGAAGCCATTCG
R: CGCACCTCCTTGGCAAAC |
Acetyl-CoA Carboxylase Alpha
(Acc) |
F: GAGGTACCGAAGTGGCATCC
R: GTGACCTGAGCGTGGGAGAA |
Stearoyl-CoA Desaturase
(Scd1) |
F: CCTTCCCCTTCGACTACTCTG
R: GCCATGCAGTCGATGAAGAA |
Tumor Necrosis Factor
(Tnfα) |
F: ACCCTCACACTCAGATCATCTTC
R: TGGTGGTTTGCTACGACGT |
Interleukin 1 Beta
(Il1β) |
F: GCAACTGTTCCTGAACTCAACT
R: ATCTTTTGGGGTCCGTCAACT |
NLR Family Pyrin Domain Containing 3
(Nlrp3) |
F: TGGATGGGTTTGCTGGGAT
R: CTGCGTGTAGCGACTGTTGAG |
Caspase 1
(Casp1) |
F: ACTGGGACCCTCAAGTTTTG
R: CATCTCCAGAGCTGTGAG |
Adhesion G Protein-Coupled Receptor E1
(F4/80) |
F: CTTTGGCTATGGGCTTCCAGTC
R: GCAAGGAGGACAGAGTTTATCGTG |
Peroxisome Proliferator Activated Receptor Alpha
(Pparα) |
F: CACCCTCTCTCCAGCTTCCA
R: GCCTTGTCCCCACATATTCG |
Carnitine Palmitoyltransferase 1A
(Cpt1a) |
F: TGAGTGGCGTCCTCTTTGG
R: CAGCGAGTAGCGCATAGTCATG |
Uncoupling Protein 2
(Ucp2) |
F: CAGATGTGGTAAAGGTCCGC
R: TTCCTCTCGTCAATGGTCT |
Acyl-CoA Oxidase 1
(Acox1) |
F: TGGAAGCCAGCGTTACGAG
R: ATCTCCGTCTGGGCGTAGG |
Pyruvate Dehydrogenase Kinase 4
(Pdk4) |
F: GACCGCTTAGTAACAC
R: GTAACGGGGTCCACTG |
CD36 Molecule
(Cd36) |
F: GATGTGGAACCCATAACTGGATTCAC
R: GGTCCCAGTCTCATTTAGCCACAGTA |
Glyceraldehyde-3-Phosphate Dehydrogenase
(Gapdh) |
F: CATGACAACTTTGGCATTGTG
R: CATACTTGGCAGGTTTCTCCA |
| mmu-miR-21a-5p |
F: TAGCTTATCAGACTGATGTTGA |
| mmu-miR-204-3p |
F: GCTGGGAAGGCAAAGGGACGT |
References
- 1 Go AS, Chertow GM, Fan D, McCulloch CE, Hsu CY (2004) Chronic kidney disease and the risks of death cardiovascular events and hospitalization. N Engl J Med 351: 1296–1305.
- 2 Herman-Edelstein M, Scherzer P, Tobar A, Levi M, Gafter U (2014) Altered renal lipid metabolism and renal lipid accumulation in human diabetic nephropathy. J Lipid Res 55: 561–572.
- 3 Kang HM, Ahn SH, Choi P, Ko YA, Han SH, et al. (2015) Defective fatty acid oxidation in renal tubular epithelial cells has a key role in kidney fibrosis development. Nat Med 21: 37–46.
- 4 Heerspink HJL, Stefansson BV, Correa-Rotter R, Chertow GM, Greene T, et al. (2020) Dapagliflozin in patients with chronic kidney disease. N Engl J Med 383: 1436–1446.
- 5 The EMPA-KIDNEY Collaborative Group; Herrington WG, Staplin N, Wanner C, Green JB, et al. (2023) Empagliflozin in patients with chronic kidney disease. N Engl J Med 388: 117–127.
- 6 Cherney DZ, Perkins BA, Soleymanlou N, Maione M, Lai V, et al. (2014) Renal hemodynamic effect of sodium-glucose cotransporter 2 inhibition in patients with type 1 diabetes mellitus. Circulation 129: 587–597.
- 7 O’Neill J, Fasching A, Pihl L, Patinha D, Franzen S, et al. (2015) Acute SGLT inhibition normalizes O2 tension in the renal cortex but causes hypoxia in the renal medulla in anaesthetized control and diabetic rats. Am J Physiol Renal Physiol 309: F227–F234.
- 8 Tomita I, Kume S, Sugahara S, Osawa N, Yamahara K, et al. (2020) SGLT2 inhibition mediates protection from diabetic kidney disease by promoting ketone body-induced mTORC1 inhibition. Cell Metab 32: 404–419.e6.
- 9 Chang J, Koseki M, Saga A, Kanno K, Higo T, et al. (2020) Dietary oxysterol, 7-ketocholesterol accelerates hepatic lipid accumulation and macrophage infiltration in obese mice. Front Endocrinol (Lausanne) 11: 614692.
- 10 Kanno K, Koseki M, Chang J, Saga A, Inui H, et al. (2022) Pemafibrate suppresses NLRP3 inflammasome activation in the liver and heart in a novel mouse model of steatohepatitis-related cardiomyopathy. Sci Rep 12: 2996.
- 11 Saga A, Koseki M, Kanno K, Chang J, Higo T, et al. (2022) A dietary oxysterol, 7-ketocholesterol, exacerbates imiquimod-induced psoriasis-like dermatitis in steatohepatitic mice. Int J Mol Sci 23: 15855.
- 12 Targher G, Bertolini L, Rodella S, Zoppini G, Lippi G, et al. (2008) Non-alcoholic fatty liver disease is independently associated with an increased prevalence of chronic kidney disease and proliferative/laser-treated retinopathy in type 2 diabetic patients. Diabetologia 51: 444–450.
- 13 Kim D, Pertea G, Trapnell C, Pimentel H, Kelley R, et al. (2013) TopHat2: accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions. Genome Biol 14: R36.
- 14 Langmead B, Salzberg SL (2012) Fast gapped-read alignment with Bowtie 2. Nat Methods 9: 357–359.
- 15 Bonfield JK, Marshall J, Danecek P, Li H, Ohan V, et al. (2021) HTSlib: C library for reading/writing high-throughput sequencing data. Gigascience 10: giab007.
- 16 Trapnell C, Williams BA, Pertea G, Mortazavi A, Kwan G, et al. (2010) Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat Biotechnol 28: 511–515.
- 17 Schroder K, Tschopp J (2010) The inflammasomes. Cell 140: 821–832.
- 18 Chau BN, Xin C, Hartner J, Ren S, Castano AP, et al. (2012) MicroRNA-21 promotes fibrosis of the kidney by silencing metabolic pathways. Sci Transl Med 4: 121ra118.
- 19 Liu X, Guo JW, Lin XC, Tuo YH, Peng WL, et al. (2021) Macrophage NFATc3 prevents foam cell formation and atherosclerosis: evidence and mechanisms. Eur Heart J 42: 4847–4861.
- 20 Chan JA, Krichevsky AM, Kosik KS (2005) MicroRNA-21 is an antiapoptotic factor in human glioblastoma cells. Cancer Res 65: 6029–6033.
- 21 Thum T, Gross C, Fiedler J, Fischer T, Kissler S, et al. (2008) MicroRNA-21 contributes to myocardial disease by stimulating MAP kinase signalling in fibroblasts. Nature 456: 980–984.
- 22 Das NA, Carpenter AJ, Belenchia A, Aroor AR, Noda M, et al. (2020) Empagliflozin reduces high glucose-induced oxidative stress and miR-21-dependent TRAF3IP2 induction and RECK suppression, and inhibits human renal proximal tubular epithelial cell migration and epithelial-to-mesenchymal transition. Cell Signal 68: 109506.
- 23 Cheng Y, Wang D, Wang F, Liu J, Huang B, et al. (2020) Endogenous miR-204 protects the kidney against chronic injury in hypertension and diabetes. J Am Soc Nephrol 31: 1539–1554.
- 24 Tontonoz P, Nagy L, Alvarez JG, Thomazy VA, Evans RM (1998) PPARgamma promotes monocyte/macrophage differentiation and uptake of oxidized LDL. Cell 93: 241–252.
- 25 van der Lee KA, Vork MM, De Vries JE, Willemsen PH, Glatz JF, et al. (2000) Long-chain fatty acid-induced changes in gene expression in neonatal cardiac myocytes. J Lipid Res 41: 41–47.
- 26 Qiao L, Zou C, Shao P, Schaack J, Johnson PF, et al. (2008) Transcriptional regulation of fatty acid translocase/CD36 expression by CCAAT/enhancer-binding protein alpha. J Biol Chem 283: 8788–8795.
- 27 Bastie CC, Nahle Z, McLoughlin T, Esser K, Zhang W, et al. (2005) FoxO1 stimulates fatty acid uptake and oxidation in muscle cells through CD36-dependent and -independent mechanisms. J Biol Chem 280: 14222–14229.
- 28 Wu H, Ng R, Chen X, Steer CJ, Song G (2016) MicroRNA-21 is a potential link between non-alcoholic fatty liver disease and hepatocellular carcinoma via modulation of the HBP1-p53-Srebp1c pathway. Gut 65: 1850–1860.
Abbreviations
H.E.hematoxylin and eosin
HF/HC/HS/BAhigh-fat/high-cholesterol/high-sucrose/bile acid
PASPeriodic Acid-Schiff
O.R.OOil red O
Crecreatinine
UACRurinary albumin to creatinine ratio
NEFAnon-esterified fatty acid
FDRfalse discovery rate
FCfree cholesterol
SLDsteatotic liver disease
TGtriglyceride
https://orcid.org/0000-0003-1852-9319
