2024 Volume 71 Issue 4 Pages 417-427
Lipopolysaccharide (LPS) and Receptor Activator of Nuclear Factor-κB Ligand (RANKL) are the two important factors causing bone loss, which is an important pathogenesis for osteoporosis. However, the relationship between LPS and RANKL is not yet clear. LPS can be involved in the weakened osteoblast formation as an autophagy regulator, and osteoblasts and their precursors are the source cells for RANKL production. Our study aimed to explore the relationship between autophagy changes and RANKL production during LPS-regulated osteoblasts. Our results showed that LPS inhibited autophagy (LC3 conversion and autophagosome formation) and enhanced the protein and mRNA expression of RANKL in MC3T3-E1 osteoblast precursor line. Autophagy upregulation with Rapamycin over BECN1 overexpression rescued LPS-inhibited osteoblast formation and -promoted RANKL protein production in MC3T3-E1 cells. In vivo experiments supported that damaged bone mass, bone microstructure, osteoblastic activity (ALP and P1NP production by ELISA assays) and enhanced RANKL production by LPS administration were partially rescued by Rapamycin application. In conclusion, LPS can inhibit autophagy in osteoblast precursors, thereby inhibiting osteoblast formation and RANKL autophagic degradation.
IN THE CHRONIC INFECTIONS mediated by gram-negative bacteria, including periodontal disease or osteomyelitis, the number and activity of osteoclasts increased, thereby destroying bone homeostasis and causing osteoporosis [1]. Lipopolysaccharide (LPS) is the main component located in the outer membrane of gram-negative bacteria, and can cause inflammation [2, 3]; this subsequently results in bone destruction. Receptor Activator of Nuclear Factor-κB Ligand (RANKL) is a core inducer of osteoclast formation, and its increase mediated by various pathological conditions can significantly increase the number and activity of osteoclasts; this is the main pathogenetic basis for osteoporosis [4, 5]. Therefore, both LPS and RANKL are important factors causing bone loss under pathological conditions. The ability of LPS to promote osteoclastogenesis is independent of RANKL [6, 7]. Furthermore, the intrinsic mechanism underlying LPS-promoted osteoclastogenesis was well clarified. LPS can promote osteoclast differentiation by enhancing TRAF6 gene expression [8, 9]. In the early stage of differentiation, LPS also promote osteoclast formation through upregulating the expression of NF-κB, p-P-38, p-JNK and p-ERK [10, 11]. The relevant mechanistic studies were also presented in the other reports. Importantly, previous literature showed that LPS can promote osteoclastic activity by enhancing RANKL expression [12]. However, the relationship between LPS and RANKL production that is associated with bone loss remains unclear.
LPS is also an important autophagy regulator. LPS can induce autophagy in human periodontal ligament stem cells [13]. But more studies have defined LPS as an autophagy inhibitor. In vivo study showed that LPS application causes autophagy impairment by dysregulating ATG genes in mice, which is involved in LPS-induced depressive-like behaviors [14]. Additionally, LPS significantly reduces the ratio of LC3II/LC3I, a marker of autophagy, in mouse brain tissue [15]. Furthermore, LPS suppressed autophagic responses in microglia [16]. The inhibitory effect of LPS on autophagy was also presented in the other studies [17, 18]. In addition to pro-osteoclastogenic factor, LPS also plays an important role in inhibiting osteoblast formation [19-21]. Notably, the inhibitory effect of LPS on autophagy dominates its function in inhibiting osteoblast formation [22]. Accordingly, LPS is considered an autophagy-inhibiting factor during osteoblast formation. Furthermore, osteoblasts and their precursors are important source cells for the production of RANKL. Notably, autophagy has the ability to degrade molecules; this can lead to decreased RANKL production [23, 24]. Based on this, we propose a hypothesis that LPS could weaken osteoblast autophagy, which may lead to the reduction in RANKL production and the subsequent osteoclastic bone loss. In this study, we first elucidated the potential mechanism of LPS-promoted RANKL production from the perspective of autophagic degradation through in vivo and in vitro assays.
Murine MC3T3-E1 osteoblast precursor cell line was purchased from American Type Culture Collection (ATCC). Cells were maintained in DMEM containing 10% fetal bovine serum (FBS) at 37°C in a humidified atmosphere of 5% CO2. In all experiments of this study, MC3T3-E1 cells received osteoblastic induction with corresponding induction medium, containing 60 μg/mL ascorbic acid, 2 mM β-glycerophosphate and 10 nM dexamethasone (Sigma-Aldrich, St. Louis, USA). Furthermore, the intervention concentrations of LPS were determined according to previous studies [22]. On the one hand, MC3T3-E1 cells were treated with different concentrations of LPS (0, 0.5, 1 and 2 μg/mL) for corresponding times determined according to specific experiments. Additionally, MC3T3-E1 cells were treated with 2 μg/mL of LPS along with or without 10 nM of Rapamycin to observe the significance of autophagy in LPS-treated osteoblasts.
Osteoblastic induction and Alkaline phosphatase (ALP) activity analysesOsteoblast precursors were seeded onto a 12-well plate at an initial number of 5 × 104 cells per well (in all assays). After 7 days of osteoblastic induction, ALP activity was measured using a commercial kit according to manufacturer’s protocols (Nanjing Jiancheng Bioengineering Institute, Jiangsu, China).
Analyses regarding Mineralization CapacityAfter 14 days of osteoblastic induction, cell mineralization capacity was measured using Alizarin red staining. The indicated cells were fixed with ice-cold 70% ethanol, and stained with Alizarin red S to detect calcification according to manufacturer’s protocols (Sigma-Aldrich). The quantitative parameters of the mineralized area were measured by detecting the percentages of positive areas using ImageJ 1.47 software.
Lentiviral transductionLentiviral vectors encoding BECN1-cDNA were purchased commercially (HANBIO, China). MC3T3-E1 cells under optimization condition were seeded into 6-well plates and incubated at 37°C in 5 % CO2 overnight. When reaching 40–50% confluence, cells began to receive lentiviral infection. Lentiviruses were added into fresh FBS-free medium at a multiplicity of infection (MOI) of 75 along with 5 μg/mL polybrene. After 24 hours, the original medium was replaced by the fresh medium. 3 days later, GFP expression was observed. Next, 4 μg/mL puromycin was added into medium to perform antibiotic selection during each replacement, lasting 7 days.
Quantitative real-time PCR (qRT-PCR) assaysTotal RNA from the indicated cells was extracted and purified by Trizol methods. cDNA synthesis and quantitative real-time PCR (qRT-PCR) assays were performed according to manufacturer’s protocols (Takara, Tokyo, Japan). The designed primer sequences are presented in Table 1. After the reaction, the amplification curve and melting curve regarding qRT-PCR were confirmed. The melting curves indicated that a single peak was formed at 80–90°C and the peak shape was narrow. No primer dimer curve peaks were found. Based on the above observations, the specificity of each primer was qualified. Next, the relative quantitative analyses of the C(t) values were applied, which used the housekeeping gene (Gapdh) as the internal parameter to calculate the C(t) values. Finally, the relative ratio of target gene content in the experimental sample and the control sample was calculated using the control sample as a reference.
Specific primer sequences for qRT-PCR
| Gene | Forward (5'-3') | Reverse (5'-3') |
|---|---|---|
| Bglap2 | AGCAGCTTGGCCCAGACCTA | TAGCGCCGGAGTCTGTTCACTAC |
| Osterix (Sp7) | ATGGCGTCCTCTCTGCTTG | TGAAAGGTCAGCGTATGGCTT |
| Col1a1 | AGAACAGCGTGGCCT | TCCGGTGTGACTCGT |
| Runt-related transcription factor 2 (Runx2) | CCCAGCCACCTTTACCTACA | TATGGAGTGCTGCTGGTCTG |
| Rankl | GGCAGTTCTCCAAGGGTCACATTAC | CATACAAGGTCACAGGCAGGTCAC |
| Gapdh | ACCACAGTCCATGCCATCAC | TCCACCACCCTGTTGCTGTA |
The whole proteins were extracted from indicated cells by using RIPA buffer (Beyotime), and quantified using BCA protein assay kit (Beyotime). The cell lysates were loaded and electrophoresed separately through a 15% SDS-PAGE gel. Next, the separated proteins were transferred to the polyvinylidene fluoride membranes (PVDF) and incubated with primary antibodies, including rabbit anti-LC3B (ab192890, 1:2000), RANKL (#ab62516, 1:2000) and GAPDH (Abcam, Boston, MA, USA) antibodies at 4°C overnight. After rinsing, the membranes were incubated with a secondary antibody for 60 min at room temperature. The immunoreactive signals were visualized by using an ECL kit (Millipore, MA, USA), and quantified by using a ChemiDoc image analyser (Bio-Rad, Hercules, CA, USA).
Transmission Electron Microscopy (TEM) analysesThe formation of autophagosomes depended on TEM observation to measure. The indicated cells were incubated on 6-cm dishes, and stimulated with indicated treatments. The preparation of cell sections, staining, and TEM analyses were performed according to the manufacturer’s protocols (Servicebio, Wuhan, Hubei, China). Ultimately, the stained sections were observed using Hitachi 7700 transmission electron microscopy (Tokyo, Japan).
Animal experimentsSixteen 6-week-old C57/BL6 male mice (20 ± 2 g) were purchased from the Animal center of GemPharmatech Co., Ltd (Nanjing, China). The mice were housed in a common environment in which the room temperature was 20–30°C and the humidity was 60–80%, received a general laboratory diet. All mice were randomly divided into control group (PBS-treated), LPS-treated group and LPS + Rapamycin-treated group (N = 8/group). On both day 1 and day 5, LPS (5 mg/kg weight, intraperitoneal injection (i.p.)) or LPS + Rapamycin (10 mg/kg, orally) interventions were performed. After 9 days, the mice were anesthetized with isoflurane (2%, Inhalation anaesthesia) and sacrificed via cervical dislocation, and their femurs were collected and fixed in 4% paraformaldehyde (PFA). Blood samples were centrifuged for serum isolation and stored in –80°C for ELISA analysis. All experimental protocols were approved by the Ethics Committee of The Affiliated Hospital of Putian University (approval number: 2022067-XZ01).
Micro-computed tomography (Micro-CT) analysesBruker Micro-CT Skyscan 1276 system (Kontich, Belgium) was used for three-dimensional (3D) analyses regarding the cancellous bones in distal femoral metaphysis. The scanning settings were as following: voxel size 6.533481 μm, medium resolution, 55 kV, 200 mA, 1 mm Al filter and integration time 384 ms. Bone mineral density measurements were calibrated according to manufacturer’s calcium hydroxyapatite (CaHA) model. 3D reconstruction was completed by NRecon (version 1.7.4.2). The parameters consisted of Bone Mineral Density (BMD), Bone Volume/Tissue Volume (BV/TV), Trabecular Number (Tb.N), Trabecular Thickness (Tb.Th), Bone Surface/Bone Volume (BS/BV), and Trabecular Separation (Tb.Sp) (N = 6, per group).
Immunofluorescence (IF) assays in bone tissuesThe femurs from mice were fixed in 4% PFA for 40 hours, decalcified with 10% EDTA (pH 7.3) at 4°C for 2 weeks, then dehydrated with graded ethanol and embedded in paraffin. RANKL fluorescence intensity in osteoblasts was identified by IF staining on corresponding sections (RANKL, 1:300; OCN, 1:200; Santa Cruz Biotechnology) (N = 6/group). For IF assays, all sections were incubated in citrate buffer overnight at 60°C to expose antigens. Subsequently, the sections were incubated overnight in the first antibody at 4°C, and the secondary antibody was incubated for 1 hour at room temperature. Ultimately, the nuclei were counterstained with DAPI.
ELISA assaysSerum concentrations of ALP, N-Propeptide of Type I Procollagen (P1NP), RANKL, C-terminal cross-linking telopeptide (CTX), tartrate-resistant acid phosphatase 5b (TRAP-5b), Tumor Necrosis Factor-α (TNF-α) and Interleukin-1β (IL-1β) were detected using ELISA kits (Cell Signaling Technology, MA, USA). The assays were performed according to manufacturer’s protocols.
Statistical analysisThese experiments were replicated for at least three times. The data are expressed as mean ± SEM from three independent experiments. Statistical analyses were performed using SPSS19.0. For comparisons, one-way ANOVA tests were carried out. Tukey test was used for Post-Hoc Multiple Comparisons of one-way ANOVA. Differences were considered significant at a threshold of p < 0.05.
First, we identified the effects of LPS on osteoblast formation and osteoblast autophagy. As shown in Fig. 1A–C, LPS decreased ALP-positive areas, ALP activity, alizarin-red nodule formation and alizarin-red-positive areas in a concentration-dependent manner. Similarly, LPS decreased the mRNA expression levels of various osteogenic genes (Bglap2, Sp7, Col1a1 and Runx2) in MC3T3-E1 cells in a concentration-dependent manner (Fig. 1D–G). In addition, LPS inhibited the LC3 conversion rate (defined as the ratio of LC3II to LC3I) in MC3T3-E1 cells and differentiated osteoblasts in a concentration-dependent manner (Fig. 1H, I and Supplementary Fig. 1A, B). Moreover, LPS reduced the number of autophagosomes in MC3T3-E1 cells (Fig. 1J, K). Importantly, LPS inhibited LC3 transformation in the presence or absence of lysosome protease inhibitors (E64d and Pepstatin A), and lysosome protease inhibitors increased LC3 transformation in the presence or absence of LPS (Fig. 1L, M), which indicates the stability of autophagic flux and confirms the reliability of our experimental system. These results suggest the inhibitory effect of LPS on osteoblast formation and osteoblast autophagy.
LPS inhibited osteoblast formation and osteoblast autophagy. (A) ALP activity in MC3T3-E1 cells treated with 0, 0.5, 1 or 2 μg/mL of LPS for 7 days under osteogenic induction. (B, C) Alizarin red staining in MC3T3-E1 cells treated with the indicated reagents for 14 days under osteogenic induction. The histogram in C showing the percentage of positive areas stained. (D–G) The mRNA levels of Bglap2, Sp7, Col1a1 and Runx2 in MC3T3-E1 cells treated with the indicated reagents for 7 days under osteogenic induction. (H, I) The protein levels of LC3 in MC3T3-E1 cells treated with the indicated reagents for 12 hours under osteogenic induction. LC3 conversion rate is presented as the ratio of LC3II to LC3I. (J, K) The formation of autophagosomes in MC3T3-E1 cells treated with 2 μg/mL of LPS for 24 hours under osteogenic induction was observed and counted under TEM (red arrows). Scale bar, 2 μm. The histogram in K represents the quantitative results of autophagosomes in J (45 cells from 3 independent experiments). (L, M) The protein levels of LC3 in MC3T3-E1 cells treated with 2 μg/mL of LPS in the presence and absence of E64d plus Pepstatin A for 12 hours under osteogenic induction. LC3 conversion rate is presented as the ratio of LC3II to LC3I. Data are presented as mean ± SEM from three independent experiments. The demotion in letters (such as a-b, b-c and c-d) indicates a significant decrease with p < 0.05 by one-way ANOVA and Tukey Post-Hoc Multiple Comparisons. Cont, control group; E, E64d; P, Pepstatin A.
Then, we used autophagy inducer Rapamycin to observe the significance of autophagy in LPS-regulated osteoblast formation. As shown in Fig. 2A, B and Supplementary Fig. 1C, D, LC3 transformation in MC3T3-E1 cells or differentiated osteoblasts inhibited by LPS was recovered with the addition of Rapamycin. In addition, the inhibition of LPS on ALP activity and mRNA expression levels of various osteogenic genes was rescued with the addition of Rapamycin (Fig. 2C–G). These results indicate that changes in autophagy are involved in LPS-regulated osteoblast formation.
Treatment of Rapamycin rescued LPS effects on osteoblast formation. (A, B) The protein levels of LC3 in MC3T3-E1 cells treated with 2 μg/mL of LPS in the presence and absence of 10 nM of Rapamycin for 12 hours under osteogenic induction. LC3 conversion rate is presented as the ratio of LC3II to LC3I. (C) ALP activity in MC3T3-E1 cells treated with the indicated reagents for 7 days under osteogenic induction. (D–G) The mRNA levels of Bglap2, Sp7, Col1a1 and Runx2 in MC3T3-E1 cells treated with the indicated reagents for 7 days under osteogenic induction. Data are presented as mean ± SEM from three independent experiments. The demotion in letters (such as a-b and b-c) indicates a significant decrease with p < 0.05 by one-way ANOVA and Tukey Post-Hoc Multiple Comparisons. Cont, control group; Rapa, Rapamycin.
We documented the role of LPS in osteoblast autophagy. The significance of autophagy for RANKL degradation in osteoblasts/osteoblast precursors is known [23, 24]. Therefore, we further explored the relationship between LPS and RANKL production in MC3T3-E1 cells. It was observed that LPS application increased RANKL protein and mRNA levels in MC3T3-E1 cells in a concentration-dependent manner (Fig. 3A–C). Based on this, it is believed that LPS affects the production of RANKL at the protein level in addition to mRNA level. Then, we observed the significance of autophagy in RANKL protein production affected by LPS with the help of Rapamycin. As shown in Fig. 3D, E, the expression of RANKL protein in MC3T3-E1 cells enhanced by LPS was blocked by Rapamycin application, which implies that changes in autophagy are involved in LPS-regulated RANKL production in osteoblast precursors.
Treatment of Rapamycin rescued LPS effects on RANKL production. (A, B) The protein levels of RANKL in MC3T3-E1 cells treated with 0, 0.5, 1 or 2 μg/mL of LPS for 12 hours under osteogenic induction. (C) The mRNA levels of Rankl in MC3T3-E1 cells treated with 0, 0.5, 1 or 2 μg/mL of LPS for 12 hours under osteogenic induction. (D, E) The protein levels of RANKL in MC3T3-E1 cells treated with 2 μg/mL of LPS in the presence and absence of 10 nM of Rapamycin for 12 hours under osteogenic induction. Data are presented as mean ± SEM from three independent experiments. The demotion in letters (such as a-b and b-c) indicates a significant decrease with p < 0.05 by one-way ANOVA and Tukey Post-Hoc Multiple Comparisons. Cont, control group; Rapa, Rapamycin.
BECN1 is a classic autophagic gene that can play an important role in promoting autophagy [25, 26]. Subsequently, we used lentiviral overexpression technique of BECN1 to confirm the significance of autophagy in LPS-regulated osteoblast formation and RANKL production. As shown in Fig. 4A–C, LC3 transformation in MC3T3-E1 cells inhibited by LPS was recovered by BECN1 overexpression. Additionally, RANKL production increased by LPS was rescued by BECN1 overexpression (Fig. 4A, D). Moreover, the inhibitory effect of LPS on ALP activity and mRNA expression levels of various osteogenic genes was reversed by BECN1 overexpression (Fig. 4E–I). These results suggest that BECN1-associated autophagy are involved in LPS-regulated osteoblast formation and RANKL production.
BECN1 overexpression rescued LPS effects on osteoblast formation and RANKL production. (A–D) The protein levels of BECN1, LC3 and RANKL in corresponding lentiviruses-transduced MC3T3-E1 cells treated with 2 μg/mL of LPS under osteogenic induction. LC3 conversion rate is presented as the ratio of LC3II to LC3I. (E) ALP activity in corresponding lentiviruses-transduced MC3T3-E1 cells treated with the indicated reagents for 7 days under osteogenic induction. (F–I) The mRNA levels of Bglap2, Sp7, Col1a1 and Runx2 in corresponding lentiviruses-transduced MC3T3-E1 cells treated with the indicated reagents for 7 days under osteogenic induction. Data are presented as mean ± SEM from three independent experiments. The demotion in letters (such as a-b and b-c) indicates a significant decrease with p < 0.05 by one-way ANOVA and Tukey Post-Hoc Multiple Comparisons. LV-cont, control lentiviral vector; LV-BECN1, lentiviral vector encoding BECN1-cDNA.
Finally, we investigated the significance of autophagy in LPS effects in vivo, relying on the joint intervention of LPS and Rapamycin in vivo. Inflammatory mice modeled by LPS administration were identified through detection of TNF-α and IL-1β; this showed that LPS-treated mice have higher serum levels of inflammatory cytokines (Supplementary Fig. 2A, B). Micro-CT assays showed that LPS administration reduced bone mass in mice and disrupted bone microstructure (Fig. 5A). The corresponding parameters showed that LPS-treated mice had decreased BMD, BV/TV, Tb.N and Tb.Th, and increased BS/BV and Tb.Sp, which was partially rescued with the addition of Rapamycin (Fig. 5C–H). However, the standalone application of Rapamycin was ineffective for bone mass and bone microstructure in untreated control mice (Supplementary Fig. 3A–C); this should be attributed to autophagy activation and mTOR inhibition-caused cell growth disorders. Moreover, ELISA assays showed that LPS-treated mice had decreased serum levels in ALP, P1NP and increased serum levels in RANKL, which was partially reversed with the addition of Rapamycin (Fig. 5I–K). Furthermore, increased serum levels of CTX and TRAP-5b in LPS-treated mice were also rescued with Rapamycin administration (Fig. 5L, M). Importantly, the immunofluorescence staining in bone tissues showed that LPS-treated mice had increased levels in the overlapped fluorescences between RANKL and osteoblastic marker OCN, which was partially blocked with the addition of Rapamycin (Fig. 5B, N). Furthermore, the reduced OCN fluorescence levels by LPS were also rescued by LPS administration (Fig. 5B, N). The in vivo results also suggest that changes in autophagy are involved in LPS-regulated osteogenesis and RANKL production.
Treatment of Rapamycin rescued LPS in vivo effects. Mice were treated with LPS or LPS plus Rapamycin to create models. (A) Representative 3D Micro-CT reconstructed images of the femurs from each group. Scale bar, 1 mm. (B) Representative IF-stained femoral sections in each group (Green, RANKL; Red, OCN; yellow, overlaps of RANKL and OCN). Scale bar, 2.5 μm. (C–H) Micro-CT analyses showing trabecular bone parameters, including BMD, BV/TV, Tb.N, Tb.Th, BS/BV and Tb.Sp (N = 6/group). (I–M) The serum levels of ALP, P1NP, RANKL, CTX and TRAP-5b were detected by using ELISA kits. (N) Quantitative results of IF staining from (B) showing the number of RANKL+OCN+ cells (N = 6). Data are presented as mean ± SEM. *p < 0.05, **p < 0.01, ***p < 0.001 by one-way ANOVA and Tukey Post-Hoc multiple comparisons. Cont, control group; Rapa, Rapamycin.
Both LPS and RANKL can induce osteoclast formation, which drives bone loss and causes osteoporosis [4-7]. However, LPS is also an important inhibitor for osteoblast formation [19-21]. Moreover, LPS is considered an autophagy-inhibiting factor during osteoblast formation; this is an important mechanism for its anti-osteoblastogenic effect [22]. Osteoblasts and their precursors can produce RANKL, but autophagy activation inhibits RANKL production in osteoblasts/osteoblast precursors through molecular degradation [23, 24], leaving an interesting scientific question: can LPS rescue RANKL degradation and promote RANKL production by inhibiting autophagy in osteoblasts/osteoblast precursors? This study is the first to elucidate the relationship between LPS and RANKL in bone loss from the perspective of autophagy.
First, LPS did indeed exert the inhibitory effects on osteoblast formation and osteoblast autophagy, which was consistent with previous research [22]. Autophagy, as a protective mechanism, plays a crucial role in osteoblast formation [27-30]. LPS plays a role in inhibiting autophagy during osteoblast formation; this is considered the key reason for LPS-inhibited osteoblast formation and -promoted bone loss [22]. Our data once again confirmed the above viewpoint. Through rescue analysis, our in vitro and in vivo assays demonstrated that autophagy activation with Rapamycin or BECN1 overexpression recovered the inhibition of LPS on osteoblast formation, which further clarified the contribution of LPS-inhibited autophagy to its anti-osteoblastogenic effects. Notably, LPS is an autophagy inducer of osteoclast precursors during osteoclast formation; this is a key factor for its pro-osteoclastogenic effects [31]. Therefore, LPS has the completely different effects on the protective autophagy for two types of functional bone cells; this leads to LPS-inhibited osteogenesis and -promoted osteoclastogenesis.
Previous literature showed that LPS can stimulate RANKL mRNA expression in osteoblasts [12]. Here, it was found that LPS administration synchronously promoted RANKL mRNA and protein expression in osteoblast precursors; however, autophagy activation with Rapamycin or BECN1 overexpression recovered the stimulation of LPS on RANKL protein expression; this was supported by in vitro and in vivo assays. Both LPS and RANKL are intense inducers for osteoclastic bone loss [4-7]. The relationship between LPS and RANKL mRNA expression has been elucidated [12]. We further clarified the positive effect of LPS on RANKL protein expression, which is associated with LPS-inhibited osteoblast autophagy. As a molecular degradation mechanism, autophagy can degrade RANKL protein in osteoblasts [23, 24]. Accordingly, due to its inhibitory effect on autophagy, LPS can protect RANKL from degradation in osteoblast precursors; this in detail bridges LPS and RANKL in elucidating the mechanism of bone loss. The recovery effects of Rapamycin on serum osteoclastic indicators (CTX and TRAP-5b) in LPS-treated mice also confirms the above inference. A decrease in RANKL degradation caused by LPS’s inhibitory effect on osteoblast autophagy and LPS-promoted osteoclast autophagy are the two determining factors for its pro-osteoclastogenic effects. The working model diagram related to this study is presented in Fig. 6. It should be noted that RANKL degradation and osteoblast differentiation are the two independent biological processes accompanied by changes in osteoblast autophagy. Osteoblast differentiation is not the determining factor for RANKL production, as osteoblast precursors can also produce RANKL [32, 33]. Therefore, we currently believe that there is no inherent correlation between LPS effects on RANKL degradation and osteoblast differentiation. Additionally, osteocytes are also RANKL-producing cells [34], and LPS also causes bone loss by affecting the state of osteocytes [35]. Therefore, the relationship between LPS and RANKL production mediated by osteocytes needs future investigation. Moreover, the limitation of this study is that it lacks the detailed signaling mechanism regarding LPS-inhibited osteoblast autophagy, which requires the in-depth exploration in future. Notably, the inhibition of autophagic degradation is only one mechanism by which LPS promotes RANKL production; it is also necessary to explore the other possible mechanisms.
The working model diagram regarding the relationship between LPS-inhibited osteoblast autophagy and osteoblast formation or RANKL production. Briefly, autophagy, as a protective mechanism, is beneficial for osteoblast formation, and RANKL is an inducer for the differentiation of osteoclast precursors into mature osteoclasts. LPS can inhibit autophagy in osteoblast precursors, which subsequently causes the reduction in osteoblast formation and prevents RANKL from autophagic degradation to promote osteoclast formation.
The current study elucidated a novel phenomenon and potential mechanism during infection-related bone loss by using the relationship between LPS and RANKL production as a breakthrough; this is based on changes in autophagy. Based on these findings, we believe that drugs with autophagy inducer properties and ability to target osteoblasts or their precursors can suppress LPS-caused osteogenic resistance and osteoclastic bone loss. Furthermore, the research and development of agents targeting osteoblasts is the correct way to address infection-related bone loss, which requires future efforts. In summary, our research provides more potential clues for the prevention and treatment of infection-related bone loss.
LPS, Lipopolysaccharide; RANKL, Receptor Activator of Nuclear Factor-κB Ligand; ATCC, American Type Culture Collection; FBS, fetal bovine serum; ALP, Alkaline phosphatase; qRT-PCR, Quantitative real-time PCR; PVDF, polyvinylidene fluoride membranes; MOI, multiplicity of infection; PVDF, polyvinylidene fluoride membranes; TEM, Transmission Electron Microscopy; Bglap2, Osteocalcin; Col1a1, Collagen type I; SP7, Osterix; Runx2, Runt-related Transcription Factor 2; PFA, paraformaldehyde; Micro-CT, Micro-computed tomography; BMD, bone mineral density; BV/TV, Bone Volume/Tissue Volume; Tb.N, Trabecular Number; Tb.Th, Trabecular Thickness; BS/BV, Bone Surface/Bone Volume; Tb.Sp, Trabecular Separation; IF, Immunofluorescence; P1NP, N-Propeptide of Type I Procollagen
This work was supported by Fujian Natural Science Foundation (2023J011718).
The authors have no relevant financial or non-financial interests to disclose. The authors have no conflicts of interest to declare that are relevant to the content of this article.
