The Journal of Poultry Science
Online ISSN : 1349-0486
Print ISSN : 1346-7395
ISSN-L : 1346-7395
Research Note
Expression of Prolactin Receptor mRNA in Lactotrophs and Somatotrophs of the Chicken Anterior Pituitary Gland
Hiromi KanedaNobuhiro Nakao Nobumichi TsushimaMinoru Tanaka
Author information
JOURNAL OPEN ACCESS FULL-TEXT HTML

2018 Volume 55 Issue 2 Pages 150-154

Details
Abstract

Prolactin (PRL) is a hormone mainly secreted by the anterior pituitary gland. In birds, PRL exerts a variety of physiological functions in target tissues expressing the PRL receptor (PRLR). In chicken, the PRLR mRNA is abundant in the anterior pituitary gland, but its regional and cellular localization are unknown. In the present study, we investigated the expression of the PRLR mRNA in cephalic and caudal lobes of the chicken anterior pituitary gland. Real-time polymerase chain reaction (PCR) revealed high levels of PRLR mRNA in both cephalic and caudal lobes. In situ hybridization revealed that the PRLR mRNA was distributed in a wide area of both lobes, and co-localized with the PRL and growth hormone (GH) mRNAs in the cephalic and caudal lobes, respectively. These results suggest that PRL exerts autocrine/paracrine effects through PRLR on PRL-producing lactotrophs and GH-producing somatotrophs in the chicken anterior pituitary gland.

Introduction

Prolactin (PRL) is a hormone secreted by the anterior pituitary gland that participates in a variety of physiological functions in vertebrates (Bole-Feysot et al., 1998). In birds, prolactin is involved in osmoregulation (Harvey et al., 1984; Murphy et al., 1986), crop milk production (Scanes et al., 1975), brood patch formation (Hutchinson et al., 1967), and incubation behavior (Saeki and Tanabe, 1955; March et al., 1994). These functions of PRL are mediated through the PRL receptor (PRLR) in target cells.

Studies showed that the PRLR mRNA is abundantly expressed in the anterior pituitary of laying White Leghorn and Bantam hens (Ohkubo et al., 1998a). The chicken anterior pituitary gland is composed of two lobes, namely, the cephalic and caudal lobes. Six types of endocrine cells are variably distributed in these two lobes, such as the PRL-producing lactotrophs, growth hormone (GH)-secreting somatotrophs, thyroid-stimulating hormone (TSH)-producing thyrotrophs, adrenocorticotropic hormone (ACTH)-producing corticotrophs, and follicle-stimulating hormone (FSH) or luteinizing hormone (LH)-secreting gonadotrophs (Kansaku et al., 1995; Proudman et al., 1999; Chowdhury et al., 2003). However, the regional and cellular localization of the PRLR mRNA in chicken anterior pituitary gland has not been reported. Therefore, the objective of this study is to determine the expression of the PRLR mRNA in lactotrophs and somatotrophs of chicken anterior pituitary gland.

Materials and Methods

Experimental Birds and Tissue Collection

Laying White Leghorn hens (10-months-old) were obtained from Santoku Farm Matsuo Corp. (Chiba, Japan). The hens were housed under 16.5 h light and 7.5 h dark conditions. Food and water were provided ad libitum. Tissues were isolated after decapitation. For RNA preparation, tissues were immediately frozen in liquid nitrogen. For in situ hybridization, the anterior pituitary glands were frozen in dry ice powders. The frozen tissues were stored at −80°C until further use. All procedures were conducted in accordance with the provision for animal welfare of the Nippon Veterinary and Life Science University (Approval number: 27K-44).

RNA Preparation and cDNA Synthesis

Total RNA was extracted from the tissue using the TRIzol reagent (Life Technologies, Tokyo, Japan) and was reverse-transcribed at 50°C for 60 min with Superscript III transcriptase (Life Technologies). The resulting cDNA was amplified by PCR using LA Taq polymerase with GC buffer (Takara, Tokyo, Japan). PCR was performed for 33 cycles of 94°C for 30 s, 60°C for 30 s, and 72°C for 2 min using forward and reverse primers specific for each cDNA. The sequences of the primers are shown in Table 1. The amplified cDNA fragments were ligated to pGEM-T Easy plasmid vector (Promega, Madison, WI, USA) and transformed into Escherichia coli. The plasmid DNAs were extracted from the bacteria and purified. Sequencing of the cDNA was performed using the BigDye Terminator v3.1 Cycle Sequencing kit (Life Technologies) with an ABI PRISM 310 genetic analyzer (Life Technologies).

Table 1. Primers used for PCR
cDNA Sequence (5′→3′) Size (bp) Accession No.
PRLR* Forward AGGAAACATTTACCTGTTGGT 371 NM_204854.1
Reverse AAGCCATCCAGATCTGACATC
PRLR Forward AGGAAACATTTACCTGTTGGT 628 NM_204854.1
Reverse CATATGAGAGATGATAAGACACCC
PRL Forward GATGAACGTTATGCTCAGGGTCGGGGTTT 477 NM_205466.2
Reverse CAATTGCTATCATGGATTAGGCGGCACTT
GH Forward ATGGCTCCAGGCTCGTGGTT 651 NM_204359.2
Reverse TCAGATGGTGCAGTTGCTCT
*  Applied for real-time PCR.

†  Applied for RNA probe synthesis

Real-Time PCR

The plasmid DNA containing PRLR cDNA was used as a standard DNA for real-time PCR with forward and reverse primers. The primer sequences are shown in Table 1. Real-time PCR was conducted in accordance with the manufacturer's instructions for the real-time PCR system 7500 (Life Technologies). The thermal parameters for the PCR were 95°C for 15 s and 60°C for 35 s in 25 µL of buffer containing 1 × Platinum SYBR Green qPCR SuperMix-UDG (Life Technologies) and 0.2 µM each of forward and reverse primers. Quantitative measurements were performed after establishing a linear amplification curve with the serial dilutions of the PRLR cDNA.

In Situ Hybridization (ISH)

RNA probes for ISH were synthesized using SP6 or T7 RNA polymerases (Takara, Tokyo, Japan) and plasmid cDNAs as the template. The RNA probe for PRLR mRNA was labeled with digoxigenin-11-uridine-5′-triphosphate and detected using an HNPP fluorescent detection set (Roche Diagnostics, Tokyo, Japan). The RNA probes for PRL and GH mRNAs were labeled with fluorescein-12-uridine-5′-triphosphate (Roche Diagnostics). The synthesis and labeling reactions were performed in accordance with the manufacturer's instructions. These labeled probes were hybridized with frozen sections (18 µm) of the anterior pituitary gland prepared using a Leica CM1850 cryostat (Leica Biosystems, Nussloch, Germany). The slide-mounted sections were fixed in 4% paraformaldehyde (PFA) for 10 min, rinsed thrice in phosphate-buffered saline (PBS), and treated with proteinase K (Wako Pure Chemical Osaka Japan) (1 µg/ml) in PBS at 25°C for 5 min and with 2 mg/mL glycine in PBS at 25°C for 10 min. After post-fixing in 4% PFA for 10 min and rinsing thrice in PBS, the sections were acetylated with acetic anhydride (0.125%) in 100 mM triethanolamine (pH 8.0) at 25°C for 20 min and prehybridized at 60°C for 60 min with 200 µg/mL yeast tRNA in hybridization buffer containing 50% formamide, 5 × standard saline citrate (SSC), and 0.5 µg/mL heparin in a humidity chamber. Both digoxigenin-labeled and fluorescein-labeled probes (300 ng/mL each) were added to the hybridization buffer and incubated at 60°C for 16 hr. After washing with 2 × SSC/formamide and 0.1 × SSC at 60°C, the sections were incubated in a blocking buffer containing casein (5 mg/mL) and sheep serum (5 µL/mL) at 25°C for 30 min. Subsequently, the sections were incubated with anti-digoxigenin antibody conjugated to alkaline phosphatase (Roche Diagnostics) diluted 1:2,000 in the blocking buffer at 4°C for 16 hr in the humidity chamber. After washing with buffer containing 100 mM Tris-HCl (pH7.5), 150 mM NaCl, and 0.05% Tween 20, and then with detection buffer containing 100 mM Tris-HCl (pH8.0), 100 mM NaCl, and 10 mM MgCl2 at 25°C, 300 µL of HNPP/Fast Red solution (Roche Diagnostics) was applied to the sections and incubated at 25°C for 30 min. After washing with the washing buffer at 25°C, the sections were mounted with ProLong Diamond antifade mountant with 4′, 6-diamidino-2-phenylindole (DAPI) (Life Technology) and air-dried. Red fluorescence of the digoxigenin-labeled probes and green fluorescence of fluorescein-labeled probes were detected using a fluorescence microscope (Axiovert 200 M; Carl Zeiss Microscopy, Tokyo, Japan).

Statistical Analysis

All data were analyzed using one-way analysis of variance, and differences in values were confirmed using the Tukey multiple comparison test. All analyses were performed using GraphPad Prism (GraphPad Software, San Diego, CA, USA).

Results

Comparison of the PRLR mRNA Levels in the Anterior Pituitary Gland and Other Tissues

The PRLR mRNA levels in the anterior pituitary gland, liver, kidney, duodenum, jejunum, ileum, ovary, and hypothalamus were determined using real-time PCR. Markedly high levels of PRLR mRNA were observed in both the cephalic and caudal lobes of the anterior pituitary gland than in other tissues. The levels in the cephalic and caudal lobes were almost equivalent and were more than threefold higher than those of other tissues (Fig. 1).

Fig. 1.

The PRLR mRNA levels in chicken tissues. The PRLR mRNA levels were measured using real-time PCR. AP, anterior pituitary gland; Ce, cephalic lobe; Ca, caudal lobe; Li, liver; Ki, kidney; Du, duodenum; Je, jejunum; Il, ileum; Ov, ovary; Hy, hypothalamus. Each bar represents the mean±SEM (n=4). Bars with different letters are significantly different (P<0.05).

Regional and Cellular Distribution of PRLR, PRL, and GH mRNAs in the Anterior Pituitary Gland

First, the distribution of PRLR, PRL, and GH mRNAs in the anterior pituitary gland was determined using ISH. As shown in Fig. 2A, fluorescence signals in the entire anterior pituitary gland sections were detected with antisense probes, and not with sense probes, for each mRNA, indicating that the fluorescence signals were derived from PRLR, PRL, and GH mRNAs. The fluorescent signal of the PRLR mRNA was distributed in both cephalic and caudal lobes, whereas signals of PRL and GH mRNAs were predominantly detected in the cephalic and caudal lobes, respectively. Figure 2B shows magnified (20-fold) fluorescent images with PRLR and PRL antisense probes in an arbitrary area in the cephalic lobe and with PRLR and GH antisense probes in an arbitrary area in the caudal lobe. The merged fluorescent images of PRLR and PRL or GH mRNAs indicated that the PRLR mRNA was expressed in some of the PRL mRNA-expressing cells in the cephalic lobe and in most GH mRNA-expressing cells in the caudal lobe.

Fig. 2.

The distribution of PRLR, PRL, and GH mRNAs in the chicken anterior pituitary gland. PRLR, PRL, and GH mRNAs were detected by ISH. Red fluorescence of digoxigenin-labeled antisense and sense probes for PRLR mRNA and green fluorescence of fluorescein-labeled antisense and sense probes for PRL or GH mRNAs were detected using a fluorescence microscope. A: The distribution of PRLR, PRL, and GH mRNAs in entire anterior pituitary gland. B: The co-expression of PRLR and PRL mRNAs in an area of the cephalic lobe and PRLR and GH mRNAs in an area of the caudal lobe. Scale bars represent 20 µm.

Discussion

Quantitative real-time PCR analyses revealed abundant expression of the PRLR mRNA in both cephalic and caudal lobes of the chicken anterior pituitary gland. In agreement with these results, ISH analyses revealed extensive expression of the PRLR mRNA in both cephalic and caudal lobes. ISH also showed that the PRL and GH mRNAs were predominantly expressed in the cephalic and caudal lobes, respectively. In the cephalic lobe, the PRLR mRNA was expressed in some of the PRL mRNA-expressing cells, highlighting expression of the PRLR mRNA in other endocrine cells producing TSH, ACTH, FSH, or LH. In support of this observation, PRLR has been detected in all endocrine cells of the rat anterior pituitary gland (Morel et al., 1994). In mammals, PRL is known to inhibit its own synthesis and secretion and stimulate internalization of its receptor in anterior pituitary gland cells (Herbert et al., 1979; Melded et al., 1980; Divots and Boutin, 1999). Co-expression of the PRLR mRNA with PRL mRNA in the chicken anterior pituitary gland cells suggests similar autocrine/paracrine functions of PRL.

Interestingly, the PRLR mRNA was found in GH mRNA-expressing cells of the caudal lobe as well as PRL mRNA-expressing cells of the cephalic lobe. Studies showed that the levels of PRL, GH, and PRLR mRNAs in the chicken anterior pituitary gland increase during late embryonic development and those of the PRL and PRLR mRNAs are higher in incubating hens than in laying hens (Ohkubo et al., 1998b; Kansaku et al., 1994; Leclerc et al., 2007). These findings suggest unknown autocrine/paracrine functions of PRL in lactotrophs and somatotrophs during embryonic development and reproductive stages.

Recently, PRL has been shown to act as an autocrine/paracrine antiproliferative and proapoptotic factor as it inhibits the expression of PRLR in rodent anterior pituitary gland, and this action is considered to be involved in cell turnover and homeostasis of the anterior pituitary gland (Ferraris et al., 2012; Ferraris et al., 2013; Ferraris et al., 2014). Cell proliferation and apoptosis has been observed in the cephalic and caudal lobes of the anterior pituitary gland of turkey hen following nest-deprivation, with decrease in plasma PRL concentration (Rajesh et al., 2001). Similarly, in both cephalic and caudal lobes of the chicken anterior pituitary gland, cell proliferation and apoptosis were observed during inhibition and resumption of laying, which may cause rejuvenation of the anterior pituitary gland (Chowdhury and Yoshimura, 2002). These findings suggest that PRL may be involved in cell turnover in the chicken anterior pituitary gland. Expression of the PRLR mRNA in endocrine cells other than lactotrophs and somatotrophs remains to be investigated.

Acknowledgments

We thank Yoshikazu Tanaka for technical support for fluorescence microscope.

References
 
© 2018 by Japan Poultry Science Association

This article is licensed under a Creative Commons [Attribution-NonCommercial-ShareAlike 4.0 International] license. In accordance with the license, anyone may download, reuse, copy, reprint, distribute, or modify articles published in the JPS for not-for-profit purposes, if they cite the original authors and source properly. If anyone remix, transform, or build upon the material, the user must distribute their contributions under the same license. For for-profit or commercial use, a written permission by the Editorial Board of JPS is mandatory.
https://creativecommons.org/licenses/by-nc-sa/4.0/
feedback
Top