2018 年 55 巻 3 号 p. 172-181
Calpain 3 (CAPN3), also known as p94, is associated with multiple production traits in domestic animals. However, the molecular characteristics of the CAPN3 gene and its expression profile in goose tissues have not been reported. In this study, CAPN3 cDNA of the Sichuan white goose was cloned, sequenced, and characterized. The CAPN3 full-length cDNA sequence consists of a 2,316-bp coding sequence (CDS) that encodes 771 amino acids with a molecular mass of 89,019 kDa. The protein was predicted to have no signal peptide, but several N-glycosylation, O-glycosylation, and phosphorylation sites. The secondary structure of CAPN3 was predicted to be 38.65% α-helical. Sequence alignment showed that CAPN3 of Sichuan white goose shared more than 90% amino acid sequence similarity with those of Japanese quail, turkey, helmeted guineafowl, duck, pigeon, and chicken. Phylogenetic tree analysis showed that goose CAPN3 has a close genetic relationship and small evolutionary distance with those of the birds. qRT-PCR analysis showed that in 15-day-old animals, the expression level of CAPN3 was significantly higher in breast muscle than in thigh tissues. These results serve as a foundation for further investigations of the function of the goose CAPN3 gene.
Goose meat is rich in protein and several trace elements, such as calcium, phosphorus, potassium, and sodium, but low in fat and cholesterol. Thus, goose meat is a nutritional and healthy food. However, the tenderness of goose meat restricts consumer acceptance; therefore, candidate genes that affect goose meat enderness have received great research interest.
Previous studies have shown that the calpain system is closely related to meat quality traits in pigs (Gandolfi et al., 2011), sheep (Grochowska et al., 2017), and chickens (Zhang et al., 2009). Calpains are Ca2+-dependent intracellular cysteine proteases that are involved in cell motility (Glading et al., 2002), and apoptosis regulation (Liu et al., 2004), muscle atrophy (Richard et al., 1995), myoblast fusion (Honda et al., 2008), and muscle growth and development Sultan et al., 2000; Zhang et al., 2009). To date, 15 isoforms have been identified in humans (Sorimachi and Ono, 2012), and in vertebrates, calpain 1 and calpain 2 have been widely studied among calpain isoforms (Macqueen et al., 2010; Zhang et al., 2017). Among the calpain family members, calpain 3 (CAPN3, previously named p94) is particularly interesting, because in humans, limb-girdle muscular dystrophy type 2A (LGMDA2) is mainly caused by loss-of-function mutations of CAPN3 (Richard et al., 1995). In mammals, CAPN3 is the most highly expressed in skeletal muscles, especially in the fast (type II) fibers (Jones et al., 1999), but CAPN3 mRNA has also been detected in the heart (Fougerousse et al., 2000). In chickens, Zhang et al. (2012) and Sorimachi et al. (1995) reported that CAPN3 is abundantly expressed in the skeletal muscle and is also expressed in the liver, heart, and brain. Subsequent studies by Ilian et al. (2001, 2004) and Felício et al. (2013) revealed significant correlations between meat quality and the expression or polymorphism of CAPN3. However, the gene and cDNA sequences of the goose CAPN3 gene have not been published in GenBank. The expression level and pattern of CAPN3 in goose are less clear, and its precise physiological functions are not well characterized in goose.
In this study, we first cloned the cDNA of the Sichuan White goose CAPN3 gene, predicted the corresponding protein sequence, and performed phylogenetic and structural analyses. Then, we detected its expression patterns in muscle tissues of different growth stages using quantitative reverse transcription PCR (qRT-PCR). By comparing the cDNA sequences and mRNA expression patterns in goose breast and thigh muscle tissues, we sought to unravel potential roles of CAPN3 in goose muscle tissues. The results of this analysis will aid in understanding the function of the goose CAPN3 gene.
All geese were fed according to Chinese local goose breeding standards. All experimental protocols were reviewed and approved of by the Sichuan Agricultural University Institutional Animal Care and Use Committee in College of Animal Science and Technology, Sichuan Agricultural University, Sichuan, China (DKY-B201000805). Sampling procedures used strictly complied with the guidelines on Ethical Treatment of Experimental Animals.
Animals and Sample CollectionIn this study, 30 Sichuan white geese were kept in the Experimental Farm for Waterfowl Breeding at Sichuan Agricultural University, with ad libitum access to water and a commercial corn-soybean-based diet. For CAPN3 cloning and mRNA expression analysis, 15 female geese at different ages (15 and 22 days) were randomly selected, of which 3 geese aged 22 days old were used for cloning, and the remaining 12 were used for mRNA expression testing. All of these geese were healthy and of moderate weight, and they were fed in their housing. In the feeding room, the temperature was 15–19°C, and the environment was exposed to natural light. All geese were terminally killed by bleeding within 10 min of capture, and breast muscle and thigh muscle tissues were removed (within 5–10 min after death), frozen immediately in liquid nitrogen, and stored separately at −80°C until total RNA extraction.
RNA Extraction and Reverse TranscriptionTotal RNA was isolated from the collected tissues using TRIzol reagent (Takara Bio, Dalian, China) according to the manufacturer's instructions and treated with 30 µl DNase/RNase-Free water (Takara Bio) to remove DNA contamination. Before reverse transcription, RNA integrity and quality were checked by electrophoresis (1% agarose gels stained with ethidium bromide) and with a Nanodrop spectrophotometer (Nanodrop 2000C; Thermo Scientific, MA, USA), respectively. Reverse transcription was carried out using the PrimeScriptRT Reagent Kit with gDNA Eraser (Takara Bio) according to the manufacturer's instructions. Briefly, each 10 µl reaction contained 2 µl of 5 × PrimeScript™ buffer, 0.5 µl of PrimeScript™ RT Enzyme Mix I, 0.5 µl of OligodT Primer, 0.5 µl of random hexamers, 5.5 µl of RNase-free water, and 1 µl of total RNA. The reaction was carried out at 37°C for 15 min, terminated by 5 s at 85°C, and the cDNA was stored at 4°.
First-strand cDNA of the breast muscle was used to clone the full-length cDNA of CAPN3. First-strand cDNA of other tissues was used for gene expression analysis.
Molecular Cloning of the Goose CAPN3 cDNAThe goose CAPN3 gene was amplified from cDNA using PCR. The specific PCR primers were designed by using Primer 5.0 and Oligo 6.0 software based on predicted Anser cygnoides CAPN3 sequence (GenBank ID: XM_013192108). Primers used for cloning are shown in Table 1. The 10 µl PCR reaction mixture contained 5 µl of 2 × MasterMix (Tiangen, Beijing, China), 0.8 µl of each primer (10 mM each), 1 µl of cDNA (50–500 ng), and 2.4 µl of ddH2O. Thermal cycles were as follows: initial denaturation at 94°C for 5 min, 34 cycles of 94°C for 45 s, 60°C for 30 s, and 72°C for 1 min, and final elongation at 72°C for 10 min. The PCR fragments were purified with the Gel Extraction Mini Kit (Qiagen, Hilden, Germany) and were cloned into the pMD-19T vector (Takara Bio). The plasmid DNA was isolated using a Plasmid Mini Kit(Qiagen) and was sequenced by BGI (Beijing, China).
| No | Gene | Type | Sequence (5′-3′) | Productsize (bp) | Tm (°C) |
|---|---|---|---|---|---|
| 1 | CAPN3 | Clone | F: CGCTTACAACTTTGACTAG | 390 | 56 |
| R: CTGGCTGTAGAAGAGGGA | |||||
| 2 | CAPN3 | Clone | F: ATCCTGATTTCCCACCTA | 229 | 55 |
| R: AACGTCCACCCAGTCTCC | |||||
| 3 | CAPN3 | Clone | F: GCTGGCATCTTTCACTTT | 619 | 56 |
| R: CGTTCCATTCCACCTGTC | |||||
| 4 | CAPN3 | Clone | F: AGGTCACGCCTACTCTGT | 869 | 56 |
| R: TGTCATCTCCTGCAATCT | |||||
| 5 | CAPN3 | Clone | F: AGTCTTTCAGAGGAGGTTG | 605 | 55 |
| R: TGGTGTTAGGCGTACATG | |||||
| 6 | CAPN3 | Expression | F: AAGCGACATTGGCGAACT | 152 | 60 |
| R: CCAGCCCACAAGACATCC | |||||
| 7 | β-actin | Expression | F: CAACGAGCGGTTCAGGTGT | 92 | 60 |
| R: TGGAGTTGAAGGTGGTCTCGT |
The obtained nucleotide sequence of the goose CAPN3 gene was analyzed at NCBI (http://blast.ncbi.nlm.nih.gov/) and was compared to the sequence database using the BLAST server (http://www.ncbi.nlm.nih.gov/blast). The open reading frame was predicted with the NCBI/ORF Finder program (http://www.ncbi.nlm.nih.gov/forf/gorf.html/). Protein domains were predicted using the Conserved Domain Architecture Retrieval Tool at NCBI (http://www.ncbi.nlm.nih.gov/BLAST) and the ClustalW software (http://align.genome.jp) was used for multiple alignment. The fundamental characteristics of the predicted protein including molecular weight(Mw) and isoelectric point(pI) were analyzed with ProtParam (http://www.expasy.org/tools/protparam.html). TMpred (http://www.ch.embnet.org/software/TMPRED_form.html) and TMHMM (http://www.cbs.dtu.dk/services/TMHMM-2.0) were used to predict transmembrane domains. Signal peptides were predicted by the SignalP4.0 server (http://www.cbs.dtu.dk/services/SignalP). NetOGlyc 3.1 (http://www.cbs.dtu.dk/services/NetOGlyc) and NetNGlyc 1.0 (http://www.cbs.dtu.dk/services/NetNGlyc) were used to predict potential O- and N-glycosylation sites, respectively. Disulfide bonds were predicted using the SCRATCH protein predictor (http://scratch.proteomics.ics.uci.edu). Phosphorylation sites were predicted using NetPhos 2.0 (http://www.cbs.dtu.dk/services/NetPhos). Secondary structures of deduced amino acid (aa) sequences were predicted by using the HNN method (http://npsa-pbil.ibcp.fr/). The protein 3D conformation was predicted using the SWISS-MODEL server (http://www.expasy.org/swissmod/SWISSMODEL.html). A phylogenetic tree was constructed using the MEGA 7.0 software. GenBank accession numbers of CAPN3 from different species for the phylogenetic analysis are listed in Table 2.
| Species | Accession no. (nucleic acid) | Accession no. (protein) |
|---|---|---|
| Ansercygnoides domesticus | XM_013192108 | XP_013047562 |
| Duck (Anas platyrhynchos) | XM_005021679 | XP_005021736 |
| Chicken (Gallus gallus) | NM_001004405 | NP_001004405 |
| Cattle (Bos taurus) | NM_174260 | NP_776685 |
| Medium ground-finch (Geospiza fortis) | XM_005419401 | XP_005419458 |
| House mouse (Mus musculus) | NM_007601 | NP_031627 |
| Human (Homo sapiens) | NM_000070 | NP_000061 |
| Japanese quail (Coturnix japonica) | XM_015864332 | XP_015719818 |
| Macaque (Macaca fascicularis) | NM_001287701 | NP_001274630 |
| Norway rat (Rattus norvegicus) | NM_017117 | NP_058813 |
| Helmeted guineafowl (Numida meleagris) | XM_021403511 | XP_021259186 |
| Pigeon (Columba livia) | XM_021287237 | XP_021142912 |
| Pig (Sus scrofa) | NM_214171 | NP_999336.2 |
| Sheep (Ovis aries) | NM_001009212 | NP_001009212 |
| Turkey (Meleagris gallopavo) | XM_019615582 | XP_019471127 |
qRT-PCR was used to evaluate changes in CAPN3 expression in muscle tissues of Sichuan white geese in different growth stages. The primers used for qRT-PCR are listed in Table 1. The housekeeping gene β-actin was selected as the endogenous control gene. qPCR was performed on a CFX-96 qPCR Real-Time PCR Detection System (Bio-Rad) and was carried out in a total volume of 25 µl, wit h 2.0 µl cDNA, 0.8 µl of each specific primer, 12.5 µl SYBR Premix EX Taq™ (Takara Bio), and 8.9 ≤l of ddH2O. The thermal protocol included one cycle of 95°C for 10 s, followed by 40 cycles of 95°C for 10 s and 60°C for 15 s. A 45-cycle-based melting curve was generated, starting at a temperature of 55°C and increasing by 0.5°C every 10 s, to determine primer specificity. Each sample was analyzed in triplicate. mRNA levels were normalized to β-actin mRNA and expressed as a fold change relative to the expression level in the control by using the 2−ΔΔCT method.
Statistical AnalysisMeans were compared by one-way ANOVA using the SAS 6.12 software, a multiple comparison test was performed using Duncan's method, and P<0.05 was considered statistically significant. Means±SEM were plotted using GraphPad Prism 5 software (GraphPad Software, La Jolla, CA, USA).
A 2,453-bp sequence of goose CAPN3 was obtained by cloning and splicing using cDNA generated from RNA isolated from breast muscle of Sichuan White goose as the template, which is in line with the predicted CAPN3 gene sequence of A. cygnoides (GenBank: XM_013192108). The cDNA contains a 2,316-bp ORF, encoding a 771 aa protein.
The deduced aa sequence of Sichuan White goose CAPN3 was compared to the CAPN3 sequences from 14 other animals using DNAMAN. The coding sequence of Sichuan White goose CAPN3 was 99.87% identical to A. cygnoides CAPN3, and 93.42%, 93.16%, 93.16%, 92.92%, 89.18%, 88.94%, 86.65%, 71.79%, 71.51%, 70.99%, 70.87%, 70.43 %, 70.17%, and 70.10% identical to that of helmeted guineafowl, Japanese quail, turkey, duck, chicken, pigeon, medium ground-finch, macaque, human, Norway rat, pig, house mouse, cattle, and sheep, respectively. The aa sequence was 100%, 97.23%, 96.85%, 96%, 93.41%, 92.57%, 92.21%, 89.11%, 74.11%, 74.05%, 73.93%, 73.93%, 73.73%, 73.02 %, and 72.66% identical to that of A. cygnoides, Japanese quail, turkey, helmeted guineafowl, duck, pigeon, chicken, medium ground-finch, macaque, Norway rat, human, house mouse, pig, cattle, and sheep, respectively (Table 2 and Fig. 1).

Multiple alignment of deduced aa sequences of CAPN3 from Sichuan White goose and the indicated species. Absolutely conserved aa are highlighted in dark; highly conserved sequences are highlighted in gray. Gen- Bank accession numbers of the CAPN3 sequences are listed in Table 2.
The physicochemical properties of the Sichuan White goose CAPN3 protein were predicted using ProtParam software (Table 3). The results showed that the CAPN3 protein molecular formula is C3971H6105N1075O1185S36, and the molecular weight is 89,019 kDa. The theoretical pI is 5.54, and the instability index is 36.75. The grand average of hydropathicity of the protein was −0.531. The Sichuan White goose CAPN3 protein was predicted to be nonsecretory, as it does not contain signal peptide sequences, and a transmembrane domain was not predicted. In addition, goose CAPN3 was predicted to have 13 O-glycosylation sites (Thr13, 21, 22, 24, 25, 26, 30, 34, 310 and Ser17, 20, 588, 591), four N-glycosylation sites (Asn78, Asn112, Asn218, and Asn409), 66 phosphorylation sites (Table 4), and no disulfide bonds. The hydrophobicity profile of the protein was calculated by ProtScale of ExPASy (Fig. 2). The ordinate represents the hydrophobic score—the higher the score, the more hydrophobic, the lower the score, the lower the hydrophobicity. The abscissa represents aa position. As shown in Fig. 2, the aa at position 474 is highly hydrophobic and that at position 484 is highly hydrophilic. Moreover, the protein has substantially more hydrophilic than hydrophobic amino acids.
| Physiochemical characteristics | CAPN3 |
|---|---|
| Amino acids | 771 |
| Number of atoms | 12,372 |
| Molecular weight(Da) | 89,019.81 |
| Isoelectric point | 5.54 |
| Asp + Glu | 116 |
| Arg + Lys | 97 |
| Extinction coefficients | 136,095 |
| Aliphatic index | 73.90 |
| Instability index | 36.75 |
| Grand average of hydropathicity | −0.531 |
| Putative phosphorylation sites | Quantity | Position |
|---|---|---|
| Serine | 33 | Ser3, Ser17, Ser20, Ser85, Ser189, Ser190, Ser210, Ser255, Ser259, Ser260, Ser268, Ser271, Ser275, Ser321, Ser331, Ser364, Ser367, Ser394, Ser426, Ser437, Ser524, Ser528, Ser538, Ser546, Ser553, Ser569, Ser573, Ser575, Ser588, Ser591, Ser659, Ser676, Ser694 |
| Threonine | 22 | Thr24, Thr25, Thr30, Thr34, Thr55, Thr134, Thr220, Thr231, Thr310, Thr333, Thr338, Thr403, Thr411, Thr422, Thr424, Thr450, Thr495, Thr530, Thr554, Thr639, Thr686, Thr717 |
| Tyrosine | 11 | Tyr56, Tyr70, Tyr211, Tyr234, Tyr244, Tyr316, Tyr531, Tyr548, Tyr684, Tyr695, Tyr713 |

Hydrophobicity profile of Sichuan White goose CAPN3 generated with the ProtScale program.
Secondary structural analysis indicated that the putative goose CAPN3 protein comprised 38.65% alpha helix, 18.55 % extended strand, and 42.80% random coil. The fully automatic procedure on the SWISS-MODEL server was used to construct a 3D structural model of a segment of the goose CAPN3 sequence (aa 47–770). The result showed that the segment was similar to that of the calpain-2 catalytic subunit 3bow.1.A, which is the template of this 3D model in the SWISS-MODEL library (Arnold et al., 2006; Benkert et al., 2011; Biasini et al., 2014) (Fig. 3). Meanwhile, in the predicted 3D structure, the QMEAN score was −2.23, and the GMQE score was 0.73.

3D structure of Sichuan White goose CAPN3 based on homology modeling using SWISS-MODEL.
A phylogenetic tree was constructed from the deduced Sichuan White goose CAPN3 and CAPN3 sequences from other animals by the Neighbor Joining (NJ) method in MEGA 7.0 (Fig. 4). As shown in Fig. 4, the Sichuan White goose CAPN3 protein evaluated in this study had a position close to A. cygnoides and Anas platyrhynchos CAPN3 proteins, while it was distant from Bos taurus and Ovis aries CAPN3 proteins.

Phylogenetic tree based on aa sequences of CAPN3 from goose and the indicated species. UPGMA analysis based on the Poisson correction model was performed using Mega 7.0 software. Numbers at each branch indicate the bootstrap percentage.
The mRNA levels of CAPN3 in the breast muscle and thigh muscle of Sichuan white geese at 15 and 22 days of age were determined by qRT-PCR. As shown in Table 5, CAPN3 mRNA expression in thigh tissue increased from the 15-day to the 22-day stage, but there was not significant difference (P>0.05). However, in the breast muscle, the expression of CAPN3 was significantly higher in 15-day-old than in 22-day-old geese (P<0.05). Meanwhile, at 15 days, the CANP3 mRNA level in thigh muscle was lower than that in breast muscle, although the difference was not significant (P>0.05). In contrast, at 22 days, the expression of CAPN3 mRNA in thigh muscle was significantly higher than that in breast muscle (P>0.05) (Table 5 and Fig. 5).
| Animal age | Number | Breast muscle | Thigh muscle |
|---|---|---|---|
| 15 days | 6 | 0.319±0.025a | 0.259±0.028 |
| 22 days | 6 | 0.113±0.025Bb | 0.506±0.031A |
The results are shown as the mean±SEM.

mRNA expression levels of CAPN3 in two different muscle tissues at the indicated growth stages. Error bars show the SEM of triplicate measurements. *P<0.05.
CAPN3 is involved in multiple important functions (Zhang et al., 2017) and has drawn greatresearch interest because of its three specific regions (N-terminal, IS1 and IS2) (Ono et al., 2016). For example, defects IS1/2 in CAPN3 lead to limb girdle muscular dystrophy type 2A (LGMD2A) symptoms and other disease (Beckmann and Spencer, 2008). Meanwhile, the rapidity of CAPN3 auto-degradation was also thought to through regulate its activity in N-terminal (Ono et al., 2014). Although it has also been demonstrated to be a candidate protein for meat tenderness in mammals, including cattle (Robinson et al., 2012; Nattrass et al., 2014) and pigs (De Smet et al., 2003), its roles, particularly its physiological activities, in geese have not been sufficiently examined. Therefore, this work will have the potential to increase our understanding of the functional roles of CAPN3 gene during improving goose meat quality provides a molecular basis. This study is the first to report the full-length cDNA of Sichuan White goose CAPN3. It contained a 2,316-bp coding sequence (CDS) that encodes 771 aa. Sequence alignment revealed thatt he aa sequence of the Sichuan white goose CAPN3 protein was highly similar to those of species including Japanese quail, turkey, helmeted guineafowl, duck, pigeon, and chicken (greater than 90% sequence identity for all analyzed bird species). This result is consistent with the zoological classification and suggests that CAPN3 protein is relatively evolutionarily conserved. Meanwhile, consistent with CAPN3 protein in other animals, such as cattle and chickens (Zhang et al., 2012; Pan et al., 2013; Wang et al., 2016), the Sichuan white goose CAPN3 protein has no signal peptide.
Previous research has shown that disulfide bonds play an important role in maintaining the stability of protein conformations (Hatahet and Ruddock, 2009), and the instability coefficient is used as an indicator of protein stability. Usually, when the instability coefficient is greater than 40, the protein structure is considered unstable (Emanuela and Marco, 2011). In this study, the Sichuan white goose CAPN3 was predicted to lack disulfide bonds, and its instability coefficient was less than 40, indicating that CAPN3 is relatively stable.
Hägglund et al. (2004) reported that N-glycosylation occurs in the rough endoplasmic reticulum and the Golgi apparatus, whereas O-glycosylation occurs only in the Golgi apparatus. Our results indicated that goose CAPN3 might be regulated by glycosylation. Because goose CAPN3 was not predicted to have signal peptides, it likely cannot enter the rough endoplasmic reticulum to be glycosylated. Currently, there are no reports on the glycosylation of CAPN3 protein; thus, we speculate that CAPN3 is translated and synthesized on the ribosomes of the rough endoplasmic reticulum and then enclosed in vesicles that merge with the Golgi apparatus, allowing glycosylation. This hypothesis regarding the process of CAPN3 glycosylation requires verification.
In addition to glycosylation, phosphorylation is considered an important modification. Huttlin et al. (2010) and Cohen-Kaplan et al. (2012) both considered that protein phosphorylation affects various biological processes, such as enzyme activity regulation, cell division, and signal transduction. In this study, the goose CAPN3 protein was predicted to contain several phosphorylation sites, and the number of serine phosphorylation sites was larger than that in other species, such as cattle (Wang et al., 2016). The different results might be due to the species being different.
To better understand the expression pattern of the goose CAPN3 gene, CAPN3 mRNA levels were analyzed in breast and thigh muscle tissues collected from Sichuan white geese. Our results showed that CAPN3 was expressed in both muscle tissues, which is consistent with a report that the level of CAPN3 gene expression in the breast muscle and leg muscle was significantly higher than that in other tissues in chickens (Zhang et al., 2012). Wu et al. (2015) reported high levels of CAPN3 expression in the muscle atrophic phase after denervation. The expression level of CAPN3 in skeletal muscle is reportedly associated with carbohydrate oxidation and insulin concentrations (Walder et al., 2002). In the current study, CAPN3 mRNA was abundantly expressed in goose muscle at the two developmental stages examined, and the mRNA levels tended to increase at the later growth stage (22 days) in thigh muscle and maintain a high level at the earlier growth stage (15 days) in breast muscle. This finding is in partial accordance with previous findings in duck, in which the CAPN3 mRNA level is low at the embryonic stage, but increases at neonatal stages (7 days) (Zhu et al., 2014). Presumably, the abundant expression of CAPN3 in developing goose muscle suggests that CAPN3 is involved in the development and functions of goose muscle, such as controlling skeletal satellite cell proliferation/differentiation. Interestingly, the CAPN3 expression level in thigh muscle was lower than that in breast muscle at 15 days, while at 22 days, the level in thigh muscle was higher than that in breast muscle. We speculated that through long-term breeding, the goose has lost its ability to fly, and therefore, the thigh muscle, primarily used for moving and swimming, has a higher level of activity, resulting in high CAPN3 expression. CAPN3 is not inhibited by calpastatin (Ono et al., 2004) and its expression pattern has been a matter of debate. In chickens, the CAPN3 mRNA level in breast muscle is higher than that in thigh muscle (Zhang et al., 2012). Yang et al. (2012) reported that the CAPN3 mRNA level in longissimus muscles of pigs was correlated with tenderness. Conversely, tenderization processes were not affected in CAPN3 knockout mice (Geesink et al., 2005). Additionally, Richard et al. (1995) found that inactivating mutations in human CAPN3 cause recessive limb girdle muscular dystrophy type 2. These results suggest that CAPN3 expression might have an effect on the tenderness of skeletal muscles, but unknown roles of CAPN3 in different muscle types should be investigated further.
In conclusion, a full-length cDNA of CAPN3 from the Sichuan white goose (2,316 bp long, encoding a 771 aa protein) was cloned and characterized. The protein was predicted to have 4 N-glycosylation, 13 O-glycosylation, and several phosphorylation sites. Homology analysis revealed that the aa sequence of goose CAPN3 protein was highly similar to those of other species. qRT-PCR analysis showed that CAPN3 expression was higher in breast muscle in 15-day-old than in 22-day-old animals. These results provide an important theoretical basis for further research into the functions and regulatory mechanism of CAPN3 in geese.
This work was supported by the Key Technology Support Program of Sichuan Province (2016NYZ0027, 2016NZ0055), a Project Supported by Scientific Research Fund of Sichuan Provincial Education Department (15ZA0025) and an interest training program for undergraduates of Sichuan Agricultural University (2017085).