Effects of Synthetic CpG Oligodeoxynucleotide K3 on Immune Response, Behavior, and Physiology in Male Layer Chicks (Gallus gallus)

ABSTRACT

Unmethylated cytosine-phosphate-guanine (CpG) motifs are often found in bacteria and viruses, but are rare in mammals. In mammals, CpG oligodeoxynucleotides (CpG ODN) stimulate the innate immune system via toll-like receptor 9 (TLR9). However, TLR9 is absent in birds; instead, TLR21 serves as the receptor for CpG ODN. While CpG ODN induce behavioral and physiological changes in mammals, there is limited research on their effects on behavioral and physiological parameters in birds. The aim of the present study was to determine whether intraperitoneal injection of K3, a synthetic class B CpG ODN, affected food intake, voluntary activity, cloacal temperature, blood constituents, and feed passage from the crop in chicks (Gallus gallus). Additionally, the effects of K3 (GC), which contains GpC motifs instead of CpG motifs, were investigated to determine the importance of these CpG motifs. Intraperitoneal injection of K3 significantly increased the mRNA expression of interleukin-1β, interleukin-6, interleukin-8, and interferon-γ in the spleen. These changes were not observed with K3 (GC) administration. Intraperitoneal injection of K3 significantly decreased food intake but did not affect voluntary activity. K3 also significantly increased cloacal temperature, tended to increase plasma glucose and corticosterone concentrations and significantly decreased feed passage from the crop. In contrast, K3 (GC) showed no effects on these parameters. These results demonstrate that class B CpG ODN is associated with anorexia, hyperthermia, and reduced feed passage through the digestive tract in chicks during bacterial and viral infections.

INTRODUCTION

Bacteria and viruses contain unmethylated cytosine-phosphate-guanine (CpG) motifs in their genomes[1]. Because unmethylated CpG motifs are rarely found in vertebrates, they are considered pathogen-associated molecular patterns (PAMPs). In mammals, unmethylated CpG motifs are recognized by toll-like receptor 9 (TLR9), which activates nuclear factor-kappa B (NFκB) signaling and stimulates the innate immune system[1]. To date, several synthetic unmethylated CpG oligodeoxynucleotides (CpG ODN) have been developed as TLR9 ligands. There are three major classes of CpG ODN (classes A-C). Class A CpG ODN (also known as D type) possess unmethylated CpG motifs within their internal palindrome, polyguanine at both the 5′ and 3′ ends, and a partially phosphorothioated backbone[1,2]. Class B CpG ODN (also known as K type) have at least one unmethylated CpG motif and a completely phosphorothioated backbone[1,2]. Class C CpG ODN have features from both classes A and B[3]. In mammals, class A CpG ODN trigger the production of interferon-α (IFN-α) in plasmacytoid dendritic cells[1,2,4]; whereas class B CpG ODN strongly stimulate dendritic cell maturation, B cell proliferation, and interleukin (IL)-6 production but weakly induce the production of IFN-α[1,2,4].

PAMPs are associated with infection-induced nonspecific symptoms, including anorexia, hypoactivity, hyperthermia, and altered digestive function. For example, lipopolysaccharide (LPS, recognized by TLR4), a component of the outer membrane of gram-negative bacteria, induces anorexia, hypoactivity, hypothermia or fever, and decreased gastric emptying in rodents[5,6,7]. Moreover, CpG ODN affect the behavior and physiology of rodents. Intravenous or intraperitoneal (IP) injection of class B CpG ODN decreases food intake and increases body temperature in mice and rats[8,9].

In chickens, TLR9 is predicted to be absent[10]; however, chicken TLR21 is a functional homolog of mammalian TLR9[11,12]. The mRNA of chicken TLR21 is expressed in several organs, including the bursa of Fabricius and the spleen[11]. In addition, class B and C CpG ODN stimulate NFκB signaling in cells that express TLR21[11,12]. Class B CpG ODN increases the mRNA expression of IL-1β and IL-6 but not IFN-β in chicken macrophages[12]. In vivo studies have reported that the peripheral injection of class B CpG ODN increases mRNA expression of IL-1β, IL-6, IL-8, and IFN-γ in the spleen and peripheral blood cells, along with IFN-α in the bursa of Fabricius of chickens[13,14,15]. However, the effects of CpG ODN administration on the behavioral and physiological parameters of chickens have not been investigated. Because several PAMPs, including LPS, induce anorexia, changes in body temperature, glucocorticoid release, and altered feed passage from the digestive tract in chickens[16,17,18,19,20,21,22], CpG ODN likely affect these parameters. Since PAMPs-induced changes in behavior and physiology can lead to a loss of productivity, information regarding the effects of CpG ODN will provide valuable insights for poultry production.

The purpose of this study was to examine whether the IP injection of K3, a synthetic class B CpG ODN, induced behavioral and physiological changes, including food intake, voluntary activity, cloacal temperature, plasma constituents, and the crop-emptying rate, in chicks (Gallus gallus). K3, developed by Verthelyi et al.[2], stimulates IL-6 production in peripheral blood mononuclear cells[2]. To investigate the importance of the CpG motif, we examined the effect of K3 (GC), which possesses a guanine-phosphate-cytosine (GpC) motif, on these parameters. Additionally, the effects of K3 and K3 (GC) on the mRNA expression of cytokines in the spleen were investigated.

MATERIALS AND METHODS

Animals

One-day-old male layer chicks (White Leghorn) were purchased from a local hatchery (Minami Iyo Yokei, Ehime, Japan) and raised in a room maintained at 30 °C with continuous lighting. The chicks were provided ad libitum access to a commercial diet containing 24% crude protein and 3050 kcal/kg metabolizable energy (Toyohashi Feed Mills Co. Ltd., Aichi, Japan) and water. For acclimation, the chicks were transferred to an experimental cage for at least two days before each experiment and were individually caged one day prior to the experiment. Before the experiment, body weights were measured, and the chicks were then divided into experimental groups to ensure uniform average body weight among the treatment groups. This study was approved by the Committee of Animal Care and Use of Ehime University, Japan (no. 08-o5-10).

Drugs and injections

All injections were performed between 05:00 and 12:00 h local time. K3 (oligonucleotides containing the unmethylated CpG motifs, atcgactctcgagcgttctc; Ajinomoto Bio-Pharma, Tokyo, Japan) was dissolved in a sterile saline solution. The vehicle only (saline) was used as a control. For IP injection, vehicle or K3 was injected into the abdominal cavity at a volume of 0.2 mL per chick. K3 (GC) (atgcactctgcaggcttctc; Ajinomoto Bio-Pharma), in which the CpG motif of K3 was replaced with GpC motifs, was also dissolved in sterile saline and used as described for K3.

Experiment 1: Effect of K3 and K3 (GC) on splenic mRNA expression of cytokines

A total of 16 ad libitum-fed seven-day-old chicks were IP injected with either 0 (control, vehicle only) or 50 μg of K3. The dose was determined based on a previous study[14]. At 3 h post-injection, the chicks were decapitated, and their spleens were collected and weighed. The spleens were snap-frozen in liquid nitrogen, and stored at −80 °C until analysis.

The spleens were used to measure the mRNA expression of IL-1β, IL-6, IL-8, IFN-γ, IFN-α, and tumor necrosis factor-like cytokine 1A (TL1A). TL1A is well known as tumor necrosis factor superfamily member 15 and causes similar effects as mammalian tumor necrosis factor-α (TNF-α)[23]. The spleens were homogenized (TissueLyser LT; Qiagen, Hilden, Germany) with Sepasol-RNA I Super G (Nacalai Tesque, Kyoto, Japan), and total RNA was isolated according to the manufacturer’s instructions.

First-strand cDNA was synthesized from the total RNA treated with DNase I using the reverse transcription kit ReverTra Ace^® qPCR RT Master Mix with gDNA Remover (Toyobo, Osaka, Japan) and random primers. Next, cDNA was amplified and quantified using real-time PCR with specific primers (Table 1). PCR was performed in duplicate (LightCycler^®Nano; Roche Applied Science, Germany) using SYBR Green Real-time PCR Master Mix (Toyobo) and β-actin as internal control (Table 1). PCR parameters for the assays included denaturation at 95 °C for 10 min followed by 45 cycles of 95 °C for 10 s, 60 °C for 10 s, and 72 °C for 15 s. The accuracy of the primers was verified by melting curve analysis and nucleotide sequencing of each PCR product. The PCR efficiencies of IL-1β, IL-6, IL-8, IFN-γ, IFN-α, TL1A, and β-actin were 92%, 105%, 100%, 99%, 101%, 105%, and 97%, respectively. The 2^−ΔΔCT value for the gene expression was calculated from the real-time quantitative PCR experiments[24], using the cycle threshold values obtained from the LightCycler^®Nano software (Roche Applied Science, Germany).

Table 1.  Nucleotide sequences of specific primers used for semi-quantitative PCR.

Target gene	GenBank accession	Primer sequences	PCR product (bp)
IL-1β	NM_204524.1	Forward: 5′-gcatcaagggctacaagctc-3′	131
		Reverse: 5′-caggcggtagaagatgaagc-3′
IL-6	NM_204628.1	Forward: 5′-aaatccctcctcgccaatct-3′	106
		Reverse: 5′-ccctcacggtcttctccataaa-3′
IL-8	NM205498	Forward: 5′-ggcttgctaggggaaatga-3′	199
		Reverse: 5′-agctgactctgactaggaaactgt-3′
IFN-γ	NM_205149.1	Forward: 5′-ctgacaagtcaaagccgcac-3′	230
		Reverse: 5′-gcatctcctctgagactggc-3′
IFN-α	AM049251.1	Forward: 5′-atgccaccttctctcacgac-3′	186
		Reverse: 5′-ggctgctgaggattttgaag-3′
TL1A	NM_001024578.1	Forward: 5′-cctgagttattccagcaacgca-3′	292
		Reverse: 5′-atccaccagcttgatgtcactaac-3′
β-actin	NM_205518	Forward: 5′-ccgcaaatgcttctaaaccg-3′	101
		Reverse: 5′-aaagccatgccaatctcgtc-3′

The K3 (GC) experiment was conducted with 15 seven-day-old chicks, following the same procedures used in the K3 experiment.

Experiment 2: Effect of K3 and K3 (GC) on food intake

In the K3 experiment, a total of 23 chicks, six days old and fed ad libitum, were IP injected with either 0 (control, vehicle only) or 50 μg of K3. The chicks were then provided with a pre-weighed feeders, and food intake was recorded at 0.5, 1, 2, 3, 4, 5, and 6 h post-injection using a digital balance with an accuracy of ±1 mg.

The K3 (GC) experiment was conducted with a total of 21 chicks (six days old) using the same procedures as those described for the K3 experiment.

Experiment 3: Effect of K3 and K3 (GC) on voluntary activity

Voluntary activity was measured for 6 h after IP injection of K3. A total of 15 seven-day-old chicks were IP injected with either 0 (control, vehicle only) or 50 μg of K3 and then returned to their home cages with ad libitum access to food and water. Voluntary activity was detected using a passive-type pyroelectric infrared detector (NS-AS02; Neuroscience Inc., Tokyo, Japan) placed on top of the individual cages. The NS-AS02 detected movement and counted movements lasting more than 0.5 s as one unit of voluntary activity. Data were analyzed using the digital data recording system software (DAS system 64; Neuroscience Inc.) every 30 min for 6 h. Food intake during the measurement of voluntary activity was measured as described for Experiment 2.

The K3 (GC) experiment was conducted with a total of 15 chicks (eight days old) following the same procedure as for the K3 experiment.

Experiment 4: Effect of K3 and K3 (GC) on cloacal temperature

Cloacal temperature was measured for 6 h after the IP injection of K3. The basal temperature was recorded in a total of 22 chicks (seven days old) by inserting a 19-mm stainless-steel sensor connected to an electronic thermometer (BAT7001H; Physitemp Instruments Inc., Clifton, NJ, USA) into the rectum. The chicks were then injected with either 0 (control, vehicle only) or 50 μg of K3 and returned to their home cages. Their cloacal temperatures were measured at 0.5, 1, 2, 3, 4, 5, and 6 h post-injection. During this period, the chicks had ad libitum access to food and water. Cloacal temperature data are expressed as a change from the basal temperature measured immediately before the injection (0 h).

The K3 (GC) experiment was conducted with a total of 24 chicks (seven days old), following the same procedure as for the K3 experiment.

Experiment 5: Effect of K3 and K3 (GC) on crop emptying

The crop-emptying rate was measured according to a previously reported method[25]. A total of 20 five-day-old chicks, fasted for 15 h to empty any residual ingesta from the crop, were IP injected with either 0 (control, vehicle only) or 50 μg of K3. Immediately after the injection, the chicks were gavaged with approximately 2 g of feed slurry into the crop. The feed slurry was prepared by mixing 40% powdered diet with 60% distilled water by weight. None of the chicks vomited after gavage. After gavage, the chicks were returned to their individual cages, and feed and water were withheld. Two hours after gavage (and injection of K3), the chicks were euthanized via carbon dioxide inhalation. Their crops were then exposed, the upper and lower esophagus clamped, and the crop excised. The timing for crop collection was based on previous studies using another TLR agonist[17,22]. The total content of the crops was recovered, dried at 55 °C for 48 h, and further air-dried for 24 h. The air-dried slurry was weighed using a digital balance with a precision of ±1 mg, and the wet slurry weight was calculated based on dry weight. The weight of the slurry emptied from the crop through the lower esophagus was calculated by subtracting the weight of the slurry remaining in the crop from that of the administered slurry. The crop-emptying rate was expressed as the percentage of slurry emptied from the crop relative to the amount gavaged.

As an additional experiment, 22 five-day-old chicks were fasted for 13 h and then IP injected with either 0 (control, vehicle only) or 50 of μg K3, followed by an additional 2-h fast. The chicks were then gavaged with approximately 2 g of feed slurry into the crop, as previously described. After gavage, the chicks were returned to their individual cages, and feed and water were withheld. All other procedures were identical to those described above.

The K3 (GC) experiment was performed with 20 (2-h trial) or 22 (4-h trial) six-day-old chicks, following the same procedure as for the K3 experiment.

Experiment 6: Effect of K3 and K3 (GC) on plasma constituents

A total of 16 seven-day-old chicks were IP injected with either 0 (control, vehicle only) or 50 μg of K3 and returned to their home cages. Six hours after the injection, blood was collected from their jugular veins using heparin as an anticoagulant. The blood was centrifuged at 9,000 × g for 5 min at 4 °C, and the plasma was collected and stored at −80 °C until analysis. Plasma concentrations of glucose and corticosterone were measured using commercial kits (Wako Pure Chemical Industries, Ltd., Osaka, Japan and AssayPro LLC, MO, USA, respectively) according to the manufacturer’s instructions.

The K3 (GC) experiment was performed using 15 seven-day-old chicks, following the same procedure as for the K3 experiment.

Statistical analysis

Data on gene expression, plasma constituents, and crop emptying were analyzed using a t-test, while the Mann–Whitney U-test was employed when normality and homoscedasticity were not observed. Voluntary activity and cloacal temperature data were analyzed using a two-way mixed model analysis of variance with respect to injection and time. The t-test or Mann–Whitney U-test were used as post-hoc test at each time point. Data are expressed as means ± SEM, and statistical significance was set at P < 0.05. The number of chicks is described in the figure legends.

RESULTS

Experiment 1: Effect of K3 and K3 (GC) on splenic mRNA expression of cytokines

Figure 1 shows the effect of the IP injection of K3 and K3 (GC) on cytokine mRNA expression in the spleen. At 3 h post-injection, K3 increased the expression of IL-1β, IL-6, IL-8, and IFN-γ to 526%, 469%, 916%, and 327%, that of the control group, respectively; however, it did not affect the expression of IFN-α and TL1A.

Fig. 1.

Effect of IP injection of K3 or K3 (GC) (both 50 µg) on mRNA expression of IL-1β, IL-6, IL-8, IFN-γ, IFN-α, and TL1A in the spleen of chicks. Injections were performed administered between 8:00 and 9:00. The spleen was collected 3 h post-injection. Data are expressed as means ± SEM. In the K3 experiment, 8 chicks were included in each group. In the K3 (GC) experiment, the number of chicks in the control and K3 (GC) groups was 7 and 8, respectively. Asterisks denote significant difference from the control group (P < 0.05).

In contrast, K3 (GC) did not affect cytokine mRNA expression in the spleen.

Experiment 2: Effects of K3 and K3 (GC) on food intake

The cumulative food intake following IP injection of K3 and K3 (GC) is shown in Fig. 2. K3 injection influenced food intake [F(1,21) = 4.18, P = 0.05], with significant interaction between injection and time [F(6,126) = 8.32, P < 0.05]. The post-hoc test revealed that K3 did not affect food intake until 2 h, but it caused a decrease at 3 h (P = 0.10). At 4 h post-injection, food intake was significantly reduced by K3, and this effect persisted throughout the experiment.

Fig. 2.

Effect of IP injection of K3 or K3 (GC) (both 50 µg) on food intake of ad libitum-fed chicks. Injections were performed between 8:00 and 9:00. In the K3 experiment, the control and K3 groups included 11 and 12 chicks, respectively. In the K3 (GC) experiment, the control and K3 (GC) groups included 11 and 10 chicks, respectively. Data are expressed as means ± SEM. Asterisks denote significant difference from the control group (P < 0.05).

In contrast, K3 (GC) did not have a significant effect on food intake [F(1,19) = 0.31, P = 0.58], and there was no significant interaction with time [F(6,114) = 1.29, P = 0.27]. Food intake of chicks injected with K3 (GC) was similar to that of controls at all time points.

Experiment 3: Effect of K3 and K3 (GC) on voluntary activity

The cumulative voluntary activity after IP injection of K3 and K3 (GC) is shown in Fig. 3. No significant effect of K3 on voluntary activity was observed [F(1,13) = 0.60, P = 0.45], nor was there any interaction with time [F(11,143) = 1.03, P = 0.42].

Fig. 3.

Effect of IP injection of K3 or K3 (GC) (both 50 µg) on voluntary activity in chicks. Injections were performed at either 5:00 or 12:00. In the K3 experiment, the control and K3 groups included 7 and 8 chicks, respectively. In K3 (GC) experiment, each group included 8 chicks. Data are expressed as means ± SEM.

Similarly, voluntary activity was not affected by K3 (GC) [F(1,14) = 0.07, P = 0.80] and showed no significant interaction with time [F(11,154) = 0.24, P = 0.99].

Experiment 4: Effect of K3 and K3 (GC) on cloacal temperature

Figure 4 illustrates the changes in cloacal temperature following the IP injection of K3 or K3 (GC). In the K3 experiment, cloacal temperatures immediately before injection were 39.6 ± 0.0 °C for the control and 39.7 ± 0.1 °C for the K3 groups. K3 had a significant effect on cloacal temperature [F(1,20) = 8.29, P < 0.05], along with significant interaction with time [F(7,140) = 7.35, P < 0.05]. Cloacal temperature was not affected by K3 for up to 3 h; however, K3 significantly increased the temperature from 4 h post-injection until the end of the experiment.

Fig. 4.

Effect of IP injection of K3 or K3 (GC) (both 50 µg) on cloacal temperature in chicks. Injections were performed between 8:00 and 9:00. Data are expressed as change from the temperature immediately before the IP injection (0 min). In the K3 experiment, the number of chicks was 11 in each group. In the K3 (GC) experiment, the control and K3 (GC) groups included 12 and 11 chicks, respectively. Data are expressed as means ± SEM. Asterisks denote significant difference from the control group at that time point (P < 0.05).

In the K3 (GC) experiment, the cloacal temperatures immediately before injection were 39.3 ± 0.1 °C for the control and 39.4 ± 0.1 °C for the K3 (GC) groups. In contrast to K3, no significant effect of K3 (GC) were detected [F(1,22) = 0.43, P = 0.52], nor were there any significant interactions with time [F(7,154) = 0.88, P = 0.53].

Experiment 5: Effect of K3 and K3 (GC) on crop emptying

Figure 5 shows the crop-emptying rate following the IP injection of K3 and K3 (GC). In the K3 experiments, chicks were gavaged with a similar amount of feed slurry across groups in each trial (control, 2.23 ± 0.01 g; K3, 2.22 ± 0.00 g for 2-h trial; control, 2.24 ± 0.00 g; K3, 2.24 ± 0.00 g for 4-h trial). K3 did not affect the crop-emptying rate in the 2-h trial, but significantly decreased it in the 4-h trial.

Fig. 5.

Effect of IP injection of K3 or K3 (GC) (both 50 µg) on crop-emptying rate in chicks. Injections were performed between 8:00 and 9:00. In the both experiments, the number of chicks in each group was 10 and 11 for 2-h and 4-h trials, respectively. Data are expressed as means ± SEM. The asterisk indicates significant difference from the control group (P < 0.05).

In the K3 (GC) experiment, the feed slurry was almost uniformly gavaged to chicks across groups in each trial (control, 2.23 ± 0.00 g; K3, 2.23 ± 0.01 g for 2-h trial; control, 2.25 ± 0.00 g; K3, 2.24 ± 0.01 g for 4-h trial). In contrast to K3, K3 (GC) did not affect the crop-emptying rate at any time post injection.

Experiment 6: Effect of K3 and K3 (GC) on plasma constituents

The effects of IP injection of K3 and K3 (GC) on the plasma concentrations of glucose and corticosterone are shown in Fig. 6. K3 injection increased plasma glucose and corticosterone levels, although this increase was not statistically significant. In contrast, no such trend was observed with K3 (GC).

Fig. 6.

Effect of IP injection of K3 or K3 (GC) (both 50 µg) on plasma glucose and corticosterone concentrations in chicks. Injections were performed between 8:00 and 9:00. In both K3 and K3 (GC) experiments, the number of chicks was 7 in each group. Data are expressed as means ± SEM.

DISCUSSION

Injecting K3 intraperitoneally increased the mRNA expression of IL-1β, IL-6, IL-8, and IFN-γ in the spleen, but did not affect IFN-α(Fig. 1). These results align with a previous study that investigated the effect of intramuscular injection of class B CpG ODN in chickens[14]. Since K3 (GC) had no effect, the unmethylated CpG motif of K3 likely stimulated cytokine mRNA expression in the present study. Other PAMPs, including LPS, polyriboinosinic-polyribocytidylic acid (poly I:C), resiquimod, zymosan, and flagellin, have been shown to increase the expression of TL1A in chicks[19,20,21,26], while K3 had no such effect. Although, several research groups have investigated the signaling pathways of TLR21 in chickens[11,27], they have not been fully elucidated. Understanding the signaling pathways for TLR21 would help clarify why class B CpG ODN had no effect on splenic TL1A expression in the present study.

In mammals, exogenous class B CpG ODN induce anorexia and hyperthermia[9]. A similar effect was observed in this study, where IP injection of K3 significantly decreased food intake and increased cloacal temperature (Figs. 2 and 4). However, K3-induced changes in food intake and cloacal temperature were not accompanied by a change in voluntary activity, as K3 did not affect this parameter (Fig. 3). These results are similar to those of previous studies using various PAMPs in chicks, where LPS, poly I:C, resiquimod, zymosan, and flagellin decreased food intake and affected cloacal temperature[16,18,19,20,21].

These PAMPs also delayed the passage of feed through the crop in chicks[17,18,19,21,22]. Similarly, K3 reduced the crop-emptying rate; however, this effect was not observed at 2 h but became significant at 4 h post-injection (Fig. 5). Notably, the K3-induced decreased food intake and increased cloacal temperature were also evident at 4 h post-injection (Figs. 2 and 4). The delayed effects of K3 indicate that it may induce the synthesis and release of other bioactive molecules, which then secondarily affect food intake and cloacal temperature. As K3 increased the splenic mRNA expression of IL-1β, IL-6, IL-8, and IFN-γ (Fig. 1), these cytokines are likely associated with the effects of K3. Among them, IL-1β is a strong candidate for mediating the anorexigenic effect of K3, as intracerebroventricular (ICV) injection of IL-1β decreased food intake in chicks, whereas IL-6, IL-8, and IFN-γ had no effect[26,28]. Furthermore, ICV injections of IL-1β and IL-6 increased body temperature in Pekin ducks[29]. Moreover, IL-1β and IL-6 have been associated with decreased gastric emptying in rats following IP injection[30,31]. Other potential candidates include nitric oxide and prostaglandins, as class B CpG ODN have been shown to boost their production in mouse macrophages[32,33]. Given that TLR21 mRNA is expressed in various organs, including the bursa of Fabricius, spleen, small intestine, lungs, skin, liver, kidney, and brain of chickens[11], these organs may play a role in the effects of K3. Further studies are required to clarify the precise mechanisms underlying the effects of K3.

Corticosterone is the major glucocorticoid in birds[34]; its release in chicks is stimulated by several PAMPs, including LPS, poly I:C, resiquimod, zymosan, and flagellin[16,18,19,20,21]. Although IP injection of K3 did not significantly elevate plasma corticosterone concentration at 6 h post-injection, there was a tendency for an increase (Fig. 6). The same was observed for plasma glucose (Fig. 6). Given that K3 reduced food intake (Fig. 2), plasma glucose levels followed suit. The increase in plasma glucose levels may be directly attributed to corticosterone which is known to elevate plasma glucose[35]. However, the effect of K3 on corticosterone release was weaker than that of other PAMPs. In our preliminary study, K3 did not affect plasma corticosterone levels at 3 h post-injection (data not shown). In rats, intravenous TNF-α injection, which has an effect similar to chicken TL1A[23], increased plasma corticosterone[36]. Since K3 did not increase splenic TL1A mRNA expression (Fig. 1), it is possible that K3 did not adequately simulate corticosterone release.

In this study, we demonstrated that IP injection of K3 influenced food intake, cloacal temperature, crop-emptying rate, and possibly corticosterone release. Conversely, K3 (GC) had no impact on these parameters. This suggests that the unmethylated CpG motif, a ligand for chicken TLR21, may be associated with anorexia, hyperthermia, and the inhibition of crop emptying during bacterial and viral infections in chicks.

ACKNOWLEDGEMENT

This work was supported by the Japan Society for the Promotion of Science (JSPS), KAKENHI, Grant Number 23/01407.

Author Contribution

Tetsuya Tachibana conceived the study and experimental design, conducted the experiments, analyzed the data, and wrote the manuscript; Rena Mimura conducted the experiments and analyzed the data; Sakirul Khan designed the experiment, discussed the results, and checked the manuscript; and Mark A. Cline discussed the results and checked the manuscript.

Conflicts of Interest

The authors declare no conflict of interest.

REFERENCES

• [1]  Kumagai Y, Takeuchi O andAkira S. TLR9 as a key receptor for the recognition of DNA. Adv Drug Deliv Rev, 60: 795–804. 2008. PMID:18262306, https://doi.org/10.1016/j.addr.2007.12.004
• [2]  Verthelyi D, Ishii KJ, Gursel M, Takeshita F andKlinman DM. Human peripheral blood cells differentially recognize and respond to two distinct CPG motifs. J Immunol, 166: 2372–2377. 2001. PMID:11160295, https://doi.org/10.4049/jimmunol.166.4.2372
• [3]  Vollmer J, Weeratna R, Payette P, Jurk M, Schetter C, Laucht M, Wader T, Tluk S, Liu M, Davis HL andKrieg AM. Characterization of three CpG oligodeoxynucleotide classes with distinct immunostimulatory activities. Eur J Immunol, 34: 251–262. 2004. PMID:14971051, https://doi.org/10.1002/eji.200324032
• [4]  Ishii KJ. Nucleic acid-based immuno-prophylaxis and -therapies against tropical ciseases. Yakugaku Zasshi, 142: 709–713. 2022. PMID:35781498, https://doi.org/10.1248/yakushi.21-00210-5
• [5]  van Miert AS andDe la Parra DA. Inhibition of gastric emptying by endotoxin (bacterial lipopolysaccharide) in conscious rats and modification of this response by drugs affecting the autonomic nervous system. Arch Int Pharmacodyn Ther, 184: 27–33. 1970. PMID:4393632
• [6]  Langhans W, Harlacher R, Balkowski G andScharrer E. Comparison of the effects of bacterial lipopolysaccharide and muramyl dipeptide on food intake. Physiol Behav, 47: 805–813. 1990. PMID:2388934, https://doi.org/10.1016/0031-9384(90)90001-K
• [7]  Kozak W, Conn CA andKluger MJ. Lipopolysaccharide induces fever and depresses locomotor activity in unrestrained mice. Am J Physiol Regul Integr Comp Physiol, 266: R125–R135. 1994. PMID:8304533, https://doi.org/10.1152/ajpregu.1994.266.1.R125
• [8]  Kozak W, Wrotek S andKozak A. Pyrogenicity of CpG-DNA in mice: role of interleukin-6, cyclooxygenases, and nuclear factor-κB. Am J Physiol Regul Integr Comp Physiol, 290: R871–R880. 2006. PMID:16293680, https://doi.org/10.1152/ajpregu.00408.2005
• [9]  Damm J, Wiegand F, Harden LM, Wenisch S, Gerstberger R, Rummel C andRoth J. Intraperitoneal and subcutaneous injections of the TLR9 agonist ODN 1668 in rats: brain inflammatory responses are related to peripheral IL-6 rather than interferons. J Neuroimmunol, 277: 105–117. 2014. PMID:25465287, https://doi.org/10.1016/j.jneuroim.2014.10.007
• [10]  Kannaki TR, Reddy MR, Shanmugam M, Verma PC andSharma RP. Chicken toll-like receptors and their role in immunity. Worlds Poult Sci J, 66: 727–738. 2010. https://doi.org/10.1017/S0043933910000693
• [11]  Brownlie R, Zhu J, Allan B, Mutwiri GK, Babiuk LA, Potter A andGriebel P. Chicken TLR21 acts as a functional homologue to mammalian TLR9 in the recognition of CpG oligodeoxynucleotides. Mol Immunol, 46: 3163–3170. 2009. PMID:19573927, https://doi.org/10.1016/j.molimm.2009.06.002
• [12]  Keestra AM, de Zoete MR, Bouwman LI andvan Putten JPM. Chicken TLR21 is an innate CpG DNA receptor distinct from mammalian TLR9. J Immunol, 185: 460–467. 2010. PMID:20498358, https://doi.org/10.4049/jimmunol.0901921
• [13]  Patel BA, Gomis S, Dar A, Willson PJ, Babiuk LA, Potter A, Mutwiri G andTikoo SK. Oligodeoxynucleotides containing CpG motifs (CpG-ODN) predominantly induce Th1-type immune response in neonatal chicks. Dev Comp Immunol, 32: 1041–1049. 2008. PMID:18395255, https://doi.org/10.1016/j.dci.2008.02.007
• [14]  St Paul M, Mallick AI, Haq K, Orouji S, Abdul-Careem MF andSharif S. In vivo administration of ligands for chicken toll-like receptors 4 and 21 induces the expression of immune system genes in the spleen. Vet Immunol Immunopathol, 144: 228–237. 2011. PMID:22019071, https://doi.org/10.1016/j.vetimm.2011.09.004
• [15]  Chrząstek K andWieliczko A. The effects of subcutaneous and intraocular administration of class B ODN CpG in chicken on the expression of TLR21, IFN-γ and IL-1β. Pol J Vet Sci, 17: 593–599. 2014. PMID:25638972, https://doi.org/10.2478/pjvs-2014-0089
• [16]  Johnson RW, Curtis SE, Dantzer R, Bahr JM andKelley KW. Sickness behavior in birds caused by peripheral or central injection of endotoxin. Physiol Behav, 53: 343–348. 1993. PMID:8446696, https://doi.org/10.1016/0031-9384(93)90215-2
• [17]  Tachibana T, Ogino M, Makino R, Khan MSI andCline MA. Lipopolysaccharide reduces food passage rate from the crop by a prostaglandin-independent mechanism in chickens. Br Poult Sci, 58: 100–106. 2017. PMID:27871194, https://doi.org/10.1080/00071668.2016.1237768
• [18]  Tachibana T, Ishimaru Y, Takeda K, Khan MSI, Makino R andCline MA. Physiological responses to central and peripheral injection of polyinosinic-polycytidylic acid in chicks. Br Poult Sci, 60: 64–70. 2019. PMID:30421962, https://doi.org/10.1080/00071668.2018.1547361
• [19]  Tachibana T, Takeda K, Khan MSI, Makino R andCline MA. Effects of toll-like receptor-7 agonists on feeding behaviour, voluntary activity, cloacal temperature and crop emptying in chicks. Br Poult Sci, 61: 303–310. 2020. PMID:31973574, https://doi.org/10.1080/00071668.2020.1720907
• [20]  Tachibana T, Nakatani A, Islam Khan MS, Makino R andCline MA. Behavioral and physiological responses to intraperitoneal injection of zymosan in chicks. Domest Anim Endocrinol, 72: 106471. 2020. PMID:32279040, https://doi.org/10.1016/j.domaniend.2020.106471
• [21]  Tachibana T, Khan MSI, Makino R andCline MA. Behavioral and physiological responses to peripheral injection of flagellin in chicks. Physiol Behav, 237: 113433. 2021. PMID:33905808, https://doi.org/10.1016/j.physbeh.2021.113433
• [22]  Tachibana T, Takahashi M, Takeda K, Ogino M, Khan MSI, Makino R andCline MA. Effect of zymosan on feed passage in the digestive tract in chicks. Br Poult Sci, 62: 414–423. 2021. PMID:33314959, https://doi.org/10.1080/00071668.2020.1863336
• [23]  Takimoto T, Takahashi K, Sato K andAkiba Y. Molecular cloning and functional characterizations of chicken TL1A. Dev Comp Immunol, 29: 895–905. 2005. PMID:15896842, https://doi.org/10.1016/j.dci.2005.03.002
• [24]  Livak KJ andSchmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT Method. Methods, 25: 402–408. 2001. PMID:11846609, https://doi.org/10.1006/meth.2001.1262
• [25]  Tachibana T, Matsuda K, Sawa H, Mikami A, Ueda H andCline MA. Differential thresholds of neuromedins B-, C-, and bombesin-induced anorexia and crop-emptying rate in chicks. Gen Comp Endocrinol, 169: 144–150. 2010. PMID:20727356, https://doi.org/10.1016/j.ygcen.2010.08.006
• [26]  Tachibana T, Ishimaru Y, Makino R, Khan SI andCline MA. Effect of central injection of tumor-necrosis factor-like cytokine 1A and interferons on food intake in chicks. Physiol Behav, 194: 199–204. 2018. PMID:29775631, https://doi.org/10.1016/j.physbeh.2018.05.015
• [27]  Guabiraba R, Rodrigues DR, Manna PT, Chollot M, Saint-Martin V, Trapp S, Oliveira M, Bryant CE andFerguson BJ. Mechanisms of type I interferon production by chicken TLR21. Dev Comp Immunol, 151: 105093. 2024. PMID:37951324, https://doi.org/10.1016/j.dci.2023.105093
• [28]  Tachibana T, Kodama T, Yamane S, Makino R, Khan SI andCline MA. Possible role of central interleukins on the anorexigenic effect of lipopolysaccharide in chicks. Br Poult Sci, 58: 305–311. 2017. PMID:28090781, https://doi.org/10.1080/00071668.2017.1280774
• [29]  Marais M, Maloney SK andGray DA. Brain IL-6- and PG-dependent actions of IL-1β and lipopolysaccharide in avian fever. Am J Physiol Regul Integr Comp Physiol, 301: R791–R800. 2011. PMID:21677266, https://doi.org/10.1152/ajpregu.00136.2011
• [30]  Robert A, Olafsson AS, Lancaster C andWei-rong Zhang Life Sci, 48: 123–134. 1991. PMID:1825231, https://doi.org/10.1016/0024-3205(91)90405-Z
• [31]  McCarthy DO. Tumor Necrosis Factor alpha and interleukin-6 have differential effects on food intake and gastric emptying in fasted rats. Res Nurs Health, 23: 222–228. 2000. PMID:10871537, https://doi.org/10.1002/1098-240X(200006)23:3<222::AID-NUR6>3.0.CO;2-3
• [32]  Chen Y, Zhang J, Moore SA, Ballas ZK, Portanova JP, Krieg AM andBerg DJ. CpG DNA induces cyclooxygenase-2 expression and prostaglandin production. Int Immunol, 13: 1013–1020. 2001. PMID:11470771, https://doi.org/10.1093/intimm/13.8.1013
• [33]  Utaisincharoen P, Anuntagool N, Chaisuriya P, Pichyangkul S andSirisinha S. CpG ODN activates NO and iNOS production in mouse macrophage cell line (RAW 264·7. Clin Exp Immunol, 128: 467–473. 2002. PMID:12067301, https://doi.org/10.1046/j.1365-2249.2002.01866.x
• [34]  Katsu Y andIguchi T. Corticosteroids. In: Handbook of Hormones 1st edition (Takei Y, Ando H, Tsutsui K eds.), Academic Press, London, pp 525–536, 2016.
• [35]  Tachibana T, Okuyama H, Takahashi M, Khan S, Makino R andCline MA. Possible role of corticosterone on behavioral, physiological, and immune responses in chicks. Physiol Behav, 272: 114357. 2023. PMID:37741605, https://doi.org/10.1016/j.physbeh.2023.114357
• [36]  Bernardini R, Kamilaris TC, Calogero A, Johnson EO, Gomez MT, Gold PW andChrousos GP. Interactions between tumor necrosis factor-α, hypothalamic corticotropin-releasing hormone, and adrenocorticotropin secretion in the rat. Endocrinology, 126: 2876–2881. 1990. PMID:2161738, https://doi.org/10.1210/endo-126-6-2876