Full Paper
Effects of Aging on the Microbiota and Inflammatory Status of the Intestinal and Oviductal Mucosa in Laying Hens
2025 Volume 62 Article ID: 2025018
Details
2025 Volume 62 Article ID: 2025018
Aging and inflammation of the intestinal and oviductal mucosa reduce egg production in laying hens. In mammals, microbiota changes in the intestine and reproductive mucosa are linked to aging and mucosal inflammation, but this relationship remains unclear in hens. The present study aimed to investigate the impact of aging on microbiota and inflammation in the intestinal and oviductal mucosa of hens. Sixteen White Leghorn hens aged ~280 days (young) and ~730 days (aged) were used. Bacterial DNA was extracted from feces and vaginal swabs for 16S rRNA amplicon sequencing. Intestinal (ileum and cecum) and oviductal (uterus and vagina) tissues were processed for histological analysis. Real-time PCR was performed to profile pro- and anti-inflammatory cytokines, tight junction-related molecules, and calbindin in the uterus. Whereas microbial diversity and composition in the vagina did not change with age; alpha-diversity of intestinal bacteria was lower in the aged group, as suggested by 46 genera showing a decrease and five an increase. The morphology of the ileum mucosa deteriorated, with transforming growth factor (TGF)β3 being upregulated and claudin (CLA)3 being downregulated in the intestine of the aged group. Finally, fibrosis progressed with age in the uterine mucosa, along with overexpression of IL-1β, TGFβ3, TGFβ4, and CLA1, but downregulation of calbindin in the oviductal mucosa. These results suggest that aging may impair intestinal and oviductal health through mucosal inflammation in both the intestine and oviduct of laying hens. This change may be related to alterations in the intestinal microbiota but appears less evident in the vagina.
Egg production and egg quality decrease with age in laying and broiler breeder hens. This decline can be attributed to reduced calcium absorption, decreased vitamin D metabolism, impaired synthesis of yolk precursors, irregular follicular development due to lesser antioxidant capacity in the liver, lower levels of serum 17β-estradiol, decreased oviductal weight, and cessation of egg laying[1,2,3,4,5]. Additional factors include inflammation of the intestine and oviduct. The former damages the villi, causing decreased nutrient absorption, as well as inflammation in nearby organs such as the liver, which affects the synthesis of yolk precursors[6,7]. Conversely, the latter has been shown to significantly reduce the expression of calbindin, which is involved in eggshell formation, along with high expression of the inflammatory cytokines interleukin (IL)-1β and IL-6, potentially leading to incomplete eggshell formation[8,9]. Therefore, inflammation in the intestine and egg tube mucosa can adversely affect egg-laying function.
In humans, aging is associated with decreased intestinal mucosal barrier function[10]. This may be attributed to a growing abundance of inflammation-inducing intestinal bacteria, leading to chronic inflammation, which is believed to suppress the expression of tight junction-related molecules[11]. Similarly, chronic inflammation occurs more often in the intestine of older mice (aged 17 months) compared to younger ones (aged 7–10 weeks)[12]. Chronological changes in the intestinal microbiota have been reported also in broilers and young laying hens, along with laying hens up to 60 weeks of age[13,14]. However, no studies have investigated the effect of aging beyond this period, nor have there been reports relating these changes to intestinal inflammation. A study profiled inflammatory cytokine expression in the duodenal, jejunal, and ileal mucosa of 65-week-old broiler breeders[15]. Another analyzed tumor necrosis factor alpha (TNF-α), IL-6, and IL-1β expression and their dietary modulation in 100-week-old Hy-Line Brown laying hens[16]. However, no comparison to findings in younger birds exists. Only one study compared oviductal microbiota and tissue morphology of 38-week-old and 77-week-old laying hens[17], although it did not involve the intestine. Therefore, it remains unclear how aging in laying hens affects the mucosal barrier function of the intestine and oviduct, and which of these is affected first. We hypothesized that age-related changes to the bacterial flora of the intestine and oviduct in chickens could compromise the mucosal barrier function and favor inflammation, thereby contributing to a decline in egg-laying function. To this effect, specific intestinal bacteria have been reported to be highly correlated with the expression of inflammatory cytokines in young laying hens[14].
Therefore, the present study explored whether aging affected the microbiota and inflammatory status of the intestinal and oviductal mucosa in chickens.
Sixteen White Leghorn hens (Julia Light; Tojo Poultry, Hiroshima, Japan) regularly laying seven or more eggs in a clutch (young group: approximately 280 days of age; aged group: approximately 750–1000 days of age, n = 8/group) were housed separately in individual wire cages (W300 mm × D400 mm × H600 mm) equipped with individual feed and water cups, and a 14/10-h light/dark cycle. All chickens were housed in the same room and were given the same adult chicken feed (High Egg 17S; Marubeni Nisshin Feed, Tokyo, Japan) and water ad libitum. Even though the eggshells of the aged group exhibited pimples and roughness on the surface, indicating lower quality, hens in the aged group continued to lay eggs.
Birds were euthanized under anesthesia with CO2 gas, and intestinal tissue (ileum and cecum) and oviductal tissue (uterus and vagina) were collected. Tissue samples were used for histological analysis, as well as for total RNA extraction on the same day. Normal feces still present in the cloaca were collected (n = 4/group) and vaginal mucus was swabbed using 4N6 FLOQSwabs (Copan Italia S.p.a., Brescia, Italy) from approximately 16 cm2 of mucosal surface. Feces and vaginal swabs were stored at –80 °C until use.
All experiments were approved by the Hiroshima University Animal Research Committee (approval no. C20-44-2). All animal handling regulations were adhered to.
Histological observationIntestinal and oviductal tissues were fixed with 10% (v/v) formalin in phosphate-buffered saline, processed into 4-μm-thick paraffin sections using a microtome (SM2000R; Leica Microsystems, Wetzlar, Germany), and attached to silane-coated slides. Sections were stained with Hansen’s hematoxylin and eosin, and examined under a light microscope connected to image analysis software (NIS-Elements; Nikon, Tokyo, Japan). The villus height/crypt depth ratio and the height of epithelial cells in the ileum and cecum were measured. Measurements were performed in triplicate on a section of each sample and the average was calculated. The inflammatory status of mucosal tissue was determined based on the infiltration of red blood cells and leukocytes into the lamina propria and the presence of infiltrating fluid beneath epithelial cells.
Microbiota analysisNormal feces and vaginal mucus microbiota DNA were extracted using an Innu PREP Stool DNA kit (Analytik Jena, Jena, Germany) according to the manufacturer’s instructions. Two-step tailed PCR was performed to amplify the V3 and V4 regions of 16S rRNA genes. The primer pairs used for the 1st PCR were 341F (5′-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-NNNNN- CCTACGGGNGGCWGCAG-3′) and 805R (5′-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-NNNNN-GACTACHVGGGTATCTAATCC-3′); whereas those used for the 2nd PCR were F (5′-AATGATACGGCGACCACCGAGATCTACAC-Index2-ACACTCTTTCCCTACACGACGC-3′) and R (5′-CAAGCAGAAGACGGCATACGAGAT-Index1-GTGACTGGAGTTCAGACGTGTG-3′). Two-step-tailed PCR and sequencing on a MiSeq system (300 × 2 bp; Illumina, San Diego, CA, USA) were performed by Bioengineering Lab Co., Ltd. (Kanagawa, Japan).
Sequencing fast-q data were analyzed using QIIME2 (ver. 2023.9) with the full-length sequence of Greengene2 2022.10 as reference. Row sequence data were trimmed using primer sequences and denoised in dada2 to achieve a quality score >20%. The relative abundance of taxa at the family level is presented as the mean % value. Alpha-diversity, a measure of species richness, was measured using the Observed (operational taxonomic units (OTUs) and Chao1, Shannon, and Simpson indices. Beta-diversity plots, which point to changes in species diversity among samples, were constructed to visualize the distance of each oviductal segment analyzed using weighted and unweighted UniFrac, while significance was measured by pairwise PERMANOVA. Statistical differences in bacterial abundance ratios between the young and aged groups were analyzed using linear discriminant analysis effect size (LEfSe).
Real-time PCR analysis for mucosal barrier function-related factorsTotal RNA was extracted from the ileum, cecum, uterus, and vaginal mucosa using Sepasol RNA I Super (Nacalai Tesque Inc., Kyoto, Japan), according to the manufacturer’s instructions. The RNA was dissolved in TE buffer (10 mM Tris-HCl, pH 8.0, with 1 mM EDTA) and stored at –80 °C until use. The concentration of total RNA in each sample was measured using NanoDrop Lite (Thermo Fisher Scientific, Waltham, MA, USA). RNA samples were reverse-transcribed using ReverTra Ace qPCR RT Master Mix with gDNA Remover (Toyobo Co., Ltd., Osaka, Japan) on a PTC-100 programmable thermal controller (MJ Research, Waltham, MA, USA), set according to the manufacturer’s instructions. Real-time PCR was performed using an AriaMX real-time PCR system (Agilent Technologies, Santa Clara, CA, USA) with Brilliant III Ultra-Fast SYBR Green QPCR Master Mix (Agilent Technologies). Table 1 lists the primers used for the PCR. The cycle parameters used for amplification were as follows: denaturation at 95 °C for 5 s and annealing at 58 °C (for transforming growth factor (TGF)β4), 60 °C (for IL-6, TGFβ3, claudin (CLA)1/3, calbindin, and RPS17), or 63 °C (for IL-1β) for 10 s. The denaturation and annealing steps were performed for 50 cycles. The cycle parameters for the melting step were: 95 °C for 30 s, 65 °C for 30 s, and 95 °C for 30 s. To calculate the relative levels of gene expression in each sample, real-time PCR data were analyzed using the 2-ΔΔCT method. The expression of target genes was normalized to that of the housekeeping gene RPS17[18].
| Target genes | Forward primer | Revers primer | Product size | Accession no. |
| IL-1β | GTGAGGCTCAACATTGCGCTGTA | TGTCCAGGCGGTAGAAGATGAAG | 214 | NM_204524.1 |
| IL-6 | AGAAATCCCTCCTCGCCAAT | AAATAGCGAACGGCCCTCA | 121 | NM_204628.1 |
| TGFβ3 | CAGATCCTGGCGCTCTACA | GAGGCCCTGGATCATGTCA | 141 | NM_205454.1 |
| TGFβ4 | ATGAGTATTGGGCCAAAG | ACGTTGAACACGAAGAAG | 109 | NM_001318456.1 |
| CLA1 | GACTCGCTGCTTAAGCTGGA | AAATCTGGTGTTAACGGGTG | 276 | NM_001013611.2 |
| CLA3 | GCCAAGATCACCATCGTCTC | CACCAGCGGGTTGTAGAAAT | 114 | NM_204202.2 |
| calbindin | ATGGATGGGAAGGAGCTACAA | TGGCACCTAAAGAACAACAGGAAAT | 194 | NM_205513.2 |
| RPS17 | AAGCTGCAGGAGGAGGAGAGG | GGTTGGACAGGCTGCCGAAGT | 136 | NM_204217.1 |
Significant differences in the observed OTUs and the Chao1, Simpson, and Shannon indices between the young and aged groups in both intestinal and oviductal microbiota using alpha-diversity were calculated with the Kruskal–Wallis test. Pairwise PERMANOVA analysis in QIIME2 was performed on the unweighted UniFrac distance matrix between the young and aged groups in both intestinal and oviductal mucosa to determine beta-diversity. Significance of the PERMANOVA was determined using the 999-permutation test. Differences were considered statistically significant at P < 0.05.
The ratio of villus height/crypt depth and gene expression data were analyzed statistically using JMP Pro16 software (SAS Institute Inc., Cary, NC, USA). Values are expressed as mean ± SEM. Significant differences between the young and aged groups were evaluated using Student’s t-test for homoscedastic samples and Welch’s t-test for heteroscedastic samples.
Alpha-diversity analysis revealed significantly higher observed OTUs, Chao-1 index, Shannon index, and Simpson index in the fecal microbiota of the young group compared to that of the aged group and the vaginal mucosa of both age groups (Fig. 1A). Beta-diversity assessment using principal coordinates analysis (PCoA) of unweighted UniFrac revealed distinct fecal microbiota clustering between the young and aged groups, but substantial overlap between vaginal mucus microbiota in the two age groups (Fig. 1B, C). Hence, a clear separation of the fecal microbiota structure between the young and aged groups contrasted with only minor age-related variations in the bacterial flora of the vaginal mucosa.
Alpha- and beta-diversity analysis of bacterial DNA in the feces and swab collected from the vaginal mucosa of young and aged laying hens (n = 4/group). (A) Alpha-diversity boxplot of observed OTUs, Chao1, Simpson, and Shannon indices. Boxplots show the quartiles, median, and extremities of the value; *P < 0.05. (B) PCoA plot based on an unweighted UniFrac distance matrix. Blue spheres represent feces in young hens (CY), red spheres represent feces in aged hens (CA), green spheres represent the vagina in young hens (VY), and orange spheres represent the vagina in aged hens (VA). (C) Unweighted UniFrac distance of each group against fecal samples from young hens. Boxplots show the quartiles, median, and extremities of the value; *P < 0.05.
A taxonomic bar plot encompassing genera with an abundance ratio >1% in normal feces (Fig. 2A) and vaginal mucosa (Fig. 2B) is reported. Specifically, g__Phocaeicola_A_858004 (11.99%), g__Lactobacillus (11.30%), g__Fusobacterium_A (8.74%), g__Romboutsia_B (6.42%), f__Bacteroidaceae (5.41%), g__Ligilactobacillus (4.57%), o__Bacteroidales (3.45%), g__Cryptobacteroides (2.80%), g__Helicobacter_G_479964 (2.56%), g__Limosilactobacillus (2.49%), f__Lachnospiraceae (2.41%), g__Phascolarctobacterium_A (1.93%), g__Fimicola (1.87%), g__Mediterraneibacter_A_155507 (1.83%), g__Desulfovibrio_R_446353 (1.67%), g__Prevotella (1.59%), g__Coprenecus (1.40%), g__Fournierella (1.38%), g__Paraprevotella (1.25%), g__Erysipelatoclostridium (1.12%), g__Akkermansia (1.02%), and others (22.81%) were the most abundant in the feces (Fig. 2A). Instead, g__Fusobacterium_A (9.05%), g__Lactobacillus (8.61%), g__Limosilactobacillus (6.49%), g__Phocaeicola_A_858004 (4.31%), f__Lachnospiraceae (3.92%), g__Alcaligenes (3.82%), g__Hydrotalea (3.79%), f__Bacteroidaceae (3.54%), g__Corynebacterium (3.45%), f__Moraxellaceae (3.32%), o__Bacteroidales (3.11%), f__Oscillospiraceae_88309 (3.04%), g__Prevotella (2.73%), g__Kocuria (2.67%), g__Staphylococcus (1.97%), g__Erysipelatoclostridium (1.67%), g__Bosea (1.28%), g__Lawsonibacter (1.27%), g__Ralstonia (1.26%), g__Coprenecus (1.24%), f__Peptostreptococcaceae_256921 (1.14%), g__Akkermansia (1.09%), g__Mediterraneibacter_A_155507 (1.08%), g__Enterococcus (1.03%), and others (25.12%) were the most abundant in the vagina (Fig. 2B).
Microbiota profiles in the feces and swab collected from vaginal mucosa of young and aged laying hens (n = 4/group). (A, B) Genus-level diversity bar plot showing the relative abundance of taxa identified in the feces (A) and vagina (B) in young and aged groups. Only taxa with abundance ratios >1% are included. (C) Bar graph showing statistical differences in bacterial abundance ratios between the young and aged group in fecal microbiota based on LEfSe analysis. Taxa more abundant in the young group are shown in blue; taxa more abundant in the aged group are shown in orange (P < 0.05).
When comparing changes in abundance between the young and aged groups using LEfSe analysis, 51 bacterial species were found to change in the fecal microbiota: 46 species were significantly more abundant in the young group; whereas five were significantly more abundant in the aged group. When focusing on bacteria with an abundance of ≥1% in the feces, g_Cryptobacteroides, g_Phascolarctobacterium_A, o_Bacteroidales, g_Coprenecus, and g_Akkermansia were found to be more abundant in the young group; whereas g_Limosilactobacillus, g_Ligilactobacillus, and g_Lactobacillus were more abundant in the aged group (Fig. 2C). No significant differences in bacterial abundance between the young and aged groups were observed within the vaginal mucosal microbiota.
Histological structure of the intestinal mucosa and gene expressionObservation of intestinal tissue sections revealed the presence of glands in the mucosal epithelium and lamina propria, as well as villi containing goblet cells, in both the ileum and cecum of either young or aged groups. No significant differences in tissue structure were observed between age groups and no clear signs of inflammation were observed in either group (Fig. 3A). Villus height and crypt depth were measured at five locations along the intestine, and the average of these measurements was used to calculate the villus/crypt ratio. A significant decrease in the villus/crypt ratio was observed in the ileum of the aged group compared to the young group (Fig. 3B).
Morphological structure of the ileal and cecal mucosa in young and aged laying hens. (A) Micrographs showing sections stained with hematoxylin and eosin. E, mucosal epithelium; L, lumen; LP, lamina propria. Scale bars = 100 μm. (B) Ratio of villus height/crypt depth in the ileum and cecum of young and aged hens. Values represent the mean ± SEM (n = 8); **P < 0.01.
Real-time PCR was conducted to assess the expression of genes related to mucosal barrier function in the intestine (ileum and cecum). No significant differences in the expression of IL-1β (Fig. 4A) and IL-6 (Fig. 4B) were detected between the two age groups. TGFβ3 was significantly upregulated in the ileum of the aged group (Fig. 4C); whereas no difference was detected for TGFβ4 (Fig. 4D). CLA3 was significantly downregulated in the cecum of the aged group, although no significant difference was observed between the two age groups in the ileum (Fig. 4E).
Expression of genes related to mucosal barrier function in the intestine (ileum and cecum): IL-1β (A), IL-6 (B), TGFβ3 (C), TGFβ4 (D), and CLA3 (E). Values are plotted as fold change compared to a standard sample from the young group of each segment, and represent the mean ± SEM (n = 8). The target gene was normalized to the housekeeping gene RPS17; *P < 0.05.
Mucosal folds were formed, the mucosal epithelium was lined with ciliated pseudostratified epithelium, and numerous well-developed tubular glands were distributed within the lamina propria of the uterine mucosa (Fig. 5). In the young group, the lamina propria of the uterine mucosa was filled with tubular glands; whereas in the aged group, connective tissue was spread between the tubular glands, and fibrosis was observed in the central part of the mucosa. In contrast, the mucosal epithelium was covered by ciliated pseudostratified epithelium, and the lamina propria was filled with connective tissue containing many lymphocytes (Fig. 5). Overall, no clear differences in vaginal mucosal tissue structure or lymphocyte distribution were observed between age groups.
Morphological structure of the uterine and vaginal mucosa in young and aged laying hens stained with hematoxylin and eosin. E, mucosal epithelium; L, lumen; LP, lamina propria. Scale bars = 100 μm.
Gene expression analysis of the vaginal mucosa revealed significant upregulation of IL-1β and TGFβ3 in the oviduct of the aged group (Fig. 6A, C). A similar effect was detected for expression of TGFβ4 in both the uterine and vaginal sections (Fig. 6D), as was also expression of CLA1 in the uterus (Fig. 6E). Instead, no significant age-related differences in expression were detected for IL-6 and CLA3 in either uterine or vaginal sections (Fig. 6B, F). Finally, calbindin was significantly downregulated in the aged group in uterine sections (Fig. 7).
Expression of genes related to mucosal barrier function in the oviduct (uterus and vagina): IL-1β (A), IL-6 (B), TGFβ3 (C), TGFβ4 (D), CLA1 (E), and CLA3 (F). Values are plotted as fold change compared to a standard sample from the young group of each segment, and represent the mean ± SEM (n = 8). The target gene was normalized to the housekeeping gene RPS17; *P < 0.05, **P < 0.01.
Expression of calbindin in the uterus, plotted as fold change compared to a standard sample from the young group. Values represent the mean ± SEM (n = 8). The target gene was normalized to the housekeeping gene RPS17; **P < 0.01.
This study aimed to investigate whether aging affected mucosal inflammation of the intestine and oviduct in hens. To this end, we assessed the impact of aging on tissue morphology and expression of cytokines, mucosal barrier-related factors such as tight junctions, and eggshell formation in the intestine (ileum and cecum) and oviduct (uterus and vagina). Results revealed the following: (1) the morphology of the ileal mucosa deteriorated with age, with upregulation of TGFβ3 and downregulation of CLA3. (2) Fibrosis progressed with age in the uterine mucosa, with an increase in IL-1β, TGFβ3, TGFβ4, and CLA1, but a decrease in calbindin in the oviductal mucosa.
Alpha-diversity analysis of the fecal microbiota in laying hens revealed an age-related decrease in the richness of bacterial species (OTUs), as suggested by observed OTUs and Chao1 index, and evenness of the microbiota, indicated by Shannon and Simpson indices. Instead, no significant difference in microbiota richness or evenness between the young and aged groups was detected in the vaginal mucosa. Additionally, beta-diversity analysis pointed to distinct clustering between the young and aged groups in the fecal microbiota, but not in vaginal microbiota (interspersed plots). Fecal microbiota covers the bacterial community of both the small intestine (84.11%–87.28%) and the cecum (99.39%)[19]. Therefore, the present results suggest that while the intestinal microbiota becomes less diverse with age, vaginal microbiota may be less affected by aging. In humans, the gut microbiota changes with age and its diversity decreases after 65 years of age due to a decline in physiological functions and changes in dietary habits[20]. Although some reports point to the complex development of gut microbiota during growth in chickens[13], there is no information regarding extreme age-induced changes. The results of this study suggest that aging leads to changes in the gut microbiota of chickens, similar to those observed in humans and other mammals. Bacterial composition of the vaginal mucosa has also been suggested to change with age in humans, with an increase in Enterococcus and Prevotella, which are associated with inflammation[21,22]. However, in this study, no statistically significant changes in bacterial composition of the vaginal microbiota were observed with age in laying hens. Nevertheless, a study on Hy-Line Brown hens reported that, while the bacterial flora in the oviductal vagina remained unchanged during aging, the microbiota in the uterine and magnum regions underwent alterations[17]. The absence of changes in the oviduct microbiota observed in this study may be specific to the vaginal segment, and further investigation is needed to examine changes in the upper regions of the oviduct, including the uterine segment. Any deterioration of the gut microbiota should manifest by 700–1000 days of age; although it is less likely to occur in individuals whose egg production is maintained within the economically-relevant lifespan.
Age-related changes in gut bacteria were evaluated by intergroup comparison via LEfSe analysis. Among genera that made up 1% or more of feces, g__Limosilactobacillus, g__Ligilactobacillus, and g__Lactobacillus increased with age; whereas g__Cryptobacteroides, g__Phascolarctobacterium_A, o__Bacteroidales, g__Coprenecus, and g__Akkermansia decreased. The genera g__Limosilactobacillus, g__Ligilactobacillus, and g__Lactobacillus were classified together in the Lactobacillus genus until 2020, and are known to produce lactic acid and help prevent pathogen overgrowth[23]. Therefore, an increased abundance of these bacteria should contribute to mucosal infection defenses. However, alpha-diversity of the fecal microbiota was significantly reduced in the aged group, suggesting a less stable gut environment. A similar increase in Lactobacillus with aging has been observed in humans[18].
Among the bacteria that decreased with age, members of o__Bacteroidales, such as g__Cryptobacteroides and g__Coprenecus, have been linked to microbiota diversity owing to their antimicrobial activity[24]. A reduction in Bacteroidales may therefore have contributed to decreased diversity and susceptibility to intestinal inflammation. Additionally, the decline in g__Akkermansia, known for its anti-inflammatory properties owing to mucin degradation[27,28], might also be associated with age-related intestinal inflammation. Overall, these findings suggest that aging in laying hens is accompanied by reduced microbial diversity and a decline in symbiotic bacteria involved in inflammatory regulation. A more detailed analysis linking microbiota to the hens’ physiological functions would require correlation analysis, for which more data and more samples are required.
Expression of IL-6, an inflammatory cytokine, is known to increase with age in the intestinal epithelium of young (7–12 years), middle (20–40 years), and elderly (67–77 years) individuals[10]. This gradual increase is explained by the progressive decline in intestinal CLA, which favors intestinal permeability and antigen stimulation of the mucosa, thereby increasing IL-6 expression. In the present study, no age-related changes in IL-6 were observed in the ileum, but the expression of the TGFβ3, which is known to have anti-inflammatory effects, increased with age, and the expression of the tight junction-related molecule CLA3 decreased with age in the cecum (Figs. 4). TGFβ3 is often increased during induction of inflammation[24]. In addition, the villus/crypt ratio decreased in the ileum, an effect associated with chronic inflammation[25]. These results suggest that aging may have weakened tight junctions in the intestine, owing to a decrease in CLA3, and induced slight inflammation of the mucosa.
In the uterus, the expression of TGFβ4 and CLA1 increased with age. In the vagina, IL-1β, TGFβ3, and TGFβ4 increased with age. IL-1β expression was found to augment in bovine oviductal epithelial cells in older cows (>150 months old) compared to younger cows (30–50 months old), resulting in an inflammatory state[26]. Higher IL-1β and TGFβ1 levels have been reported also during inflammatory reactions associated with chronic fibrogenesis in mice[27]. In laying hens, aging causes fibrosis in the mucosa of the oviductal uterus, a less uniform surface of epithelial microvilli, and weakening of the eggshell[28]. In this study, tissue fibrosis was detected in the uterine mucosa of the aged group, and IL-1β and TGFβ4 (equivalent to TGFβ1 in mammals) were upregulated in the oviductal mucosa, suggesting that aging may induce chronic inflammation of the oviductal mucosa in chickens. Previous studies revealed that, compared to 175-days-old hens, 620-days-old hens showed more macrophages and MHC class II-positive cells in the uterine and vaginal mucosa[29,30]. In the present study, immunohistochemical staining for these cells was not performed and, therefore, they could not be evaluated. Macrophages, which are among MHC class II-positive cells, are involved in the initiation and maintenance of inflammation. Based on the present gene expression results, these cells may contribute to the development and persistence of chronic inflammation in the oviduct mucosa during aging. CLA1 is involved in the formation of tight junctions, and in the present study, CLA1 was elevated in the uterine mucosa of the aged group. Our previous study showed that occludin, which is also involved in tight junctions, was upregulated in the uterine mucosa of older (130-week-old) laying hens, while CLA1 was upregulated in 35-week-old hens[31]. As tight junctions are destroyed by inflammation[32], CLA1 expression may increase in aged chickens to compensate for this loss.
In the present study, the expression of calbindin, a gene related to eggshell formation, was significantly lower in aged hens than in young ones (Fig. 7). This result indicates that aging in hens may affect calbindin expression. In line with this result, calbindin expression in the uterus was found to decline with age, pointing to a correlation between calbindin levels and eggshell weight and density[3]. Because calbindin is located in the tubular glands of the uterine mucosa[8], the age-related decrease in the number of these glands may compel the downregulation of calbindin. Specific bacterial taxa characteristic of the uterine mucosa of 77-week-old laying hens, but not 38-week-old hens, may inhibit apoptosis of epithelial and lamina propria cells[17]. Inflammation of the intestinal mucosa prevents apoptosis of immune cells, thereby promoting tissue injury and fibrosis[33]. Similarly, TGFβ1 has been reported to inhibit apoptosis of fibroblasts in the lungs and muscles, facilitating tissue fibrosis[34]. Therefore, inhibition of apoptosis due to an inflammatory response in the uterine mucosa with age may promote fibrosis in hens.
Based on the above, we conclude that aging impairs the mucosal barrier function in egg-laying hens by inducing inflammation, which is linked to alterations in the intestinal microbiota and compromised intestinal health. Fibrosis of the uterine mucosa and an inflammatory response were observed also in the oviduct, which could possibly explain the decline in egg-laying function with age. However, vaginal microbiota appears to be of lower significance in vaginal inflammation.
We would like to thank Editage (www.editage.com) for English language editing.
TN conceived, designed, and performed the experiments, and acquired research funds. TS performed and analyzed the experiments. NS, NI, and YY contributed to critical discussion and review of the manuscript.
The authors declare that this study was conducted in the absence of commercial or financial relationships that could be construed as potential conflicts of interest.
