Full Paper
Expression of Olfactory Sense-Related Genes in Chicken Olfactory Epithelium
2025 Volume 62 Article ID: 2025019
Details
2025 Volume 62 Article ID: 2025019
Olfaction plays a key role in the selection and acquisition of feed as well as its vision and gustation. Although olfactory behavior in chickens is speculated to depend on olfactory receptors, trace-amine-associated receptors (TAARs), and its signaling pathway, insufficient information is available regarding the expression of these molecules in chicken olfactory epithelium. Here, we investigated whether genes encoding representative olfactory receptors, TAARs, and olfactory signaling pathway molecules were expressed in this tissue. Based on real-time quantitative polymerase chain reaction and agarose gel electrophoresis, we confirmed the expression of 18 olfactory receptors, three TAARs, and six signaling pathway genes, suggesting that chickens possess molecular mechanisms for capturing odorants and transducing olfactory signals.
Chickens are among the most economically important animals and are frequently used in research as models for avian studies. In chickens and many other animals, olfaction plays a key role in the selection and acquisition of feed as well as its vision and gustation. A thorough understanding of the olfactory system in chickens is useful for the poultry industry and poultry science, as well as in the fields of avian physiology, evolutionary biology, and neuroscience. Till now, studies on chicken olfactory behaviors have yielded several important findings[1,2]. For example, chickens detect ammonia, eugenol, hexane, and vanilla extract; they fear blood and cat odors and avoid methyl anthranilate[1]. Furthermore, pre-hatching exposure to specific scents changes the behavior of chicks toward odors after hatching[3,4,5,6,7]. In chicks reared in a specific odorous environment, fear is reduced by the application of familiar odors[8,9,10]. Finally, the smell of the female uropygial gland enhances sexual behavior in chickens[11].
Olfaction is essential in mammals, where it plays a crucial role in avoiding predators and other dangers, searching for and ingesting food, interindividual communication, and reproductive behaviors. The olfactory system is receptive to volatile organic compounds and amines, which are detected by the nasal olfactory epithelium (OE). The OE contains numerous olfactory sensory neurons (OSNs) and diverse olfactory receptors (ORs), which detect volatile organic compounds[12]. In mice, each OSN expresses only one OR, and individual chemicals activate diverse patterns of ORs and are recognized by different combinations of ORs[13]. A small subpopulation of OSNs that lack ORs express trace-amine-associated receptors (TAARs), which detect amines[14]. The chicken genome contains many OR genes[15,16]. Chickens possess an estimated 300 functional OR genes[17] and three functional TAAR genes[18]. The mRNA expression of some OR genes in the OE of chick embryos was confirmed using in situ hybridization[19,20].
As reviewed by Boccaccio et al.[21] and Dewan[22], the mammalian olfactory signaling pathway starts with the binding of an odorant to an OR or TAAR, which activates a trimeric G-protein comprised of Gαolf, β, and γ subunits. Gαolf is encoded by G-protein subunit alpha L (GNAL). Activation of the G-protein activates adenylyl cyclase type III (ACIII; encoded by ADCY3), triggering the synthesis of cyclic adenosine monophosphate (cAMP). cAMP gates cyclic nucleotide-gated (CNG) channels, allowing the influx of Na+ and Ca2+. Olfactory CNG channels are tetramers composed of three different types of subunits (two encoded by CNGA2, one by CNGA4, and one by CNGB1b). This transient Ca2+ influx via CNG channels gates Ca2+-activated Cl− channel anoctamin-2 (ANO2), allowing the leakage of Cl− and depolarizing OSNs. Currently, it remains unknown whether these olfaction-related molecules are expressed in chicken OE.
Chicken olfactory behavior is thought to be induced by ORs, TAARs, and its signaling pathway. However, the expression of these molecules in chickens has not been characterized. We conducted this to determine whether the genes of representative ORs, TAARs, and olfactory signaling pathway molecules were expressed in chicken OE. To this end, we used real-time quantitative polymerase chain reaction (qPCR) and agarose gel electrophoresis.
Fertilized eggs of the Rhode Island Red strain were obtained from the Okazaki Station (Okazaki, Japan) at the National Livestock Breeding Center. Eight two-week-old chicks (no sex identification) were used. The chicks were maintained in a brooder equipped with a heating and humidifying system (Belbird, Saitama, Japan) at about 25–30°C under 24-h lighting. They were provided ad libitum access to commercial feed (Power Chick ZK Zenki, JA Zen-Noh Kitanihon Kumiai Feed Co., Sendai, Japan) and water.
The use of animals in the study was approved by the Animal Research Committee of Hirosaki University (Approval No. AE01-2023-008-1), following the Rules for Animal Experimentation of Hirosaki University, Law Concerning the Human Care and Control of Animals (Law No. 105; October 1, 1973), the Japanese Government Notification on the Feeding and Safekeeping of Animals (Notification No. 6; March 27, 1980), and Guidelines for Animal Experiments and Guide for the Care and Use of Agricultural Animals in Research and Teaching (4th edition, 2020).
Real-time qPCR and agarose gel electrophoresisSodium pentobarbital (100–200 mg/kg body weight) was administered intraperitoneally to euthanize the chicks. The upper beaks were transected along the coronal plane, slightly anterior to the eye. To expose the nasal cavity, the nasal septa and lateral walls of the external nares were horizontally incised. The middle turbinates were removed, and the OE located dorsal to these positions, including the cribriform plates, was collected. The collected OE was rinsed with saline, and excess moisture was removed using paper. The tissue was immediately frozen in liquid nitrogen and stored at −80°C.
Total RNA was isolated from the nasal tissue of eight randomly selected chicks using a FastGene RNA Premium Kit (Nippon Genetics Co., Tokyo, Japan) according to the manufacturer’s instructions. The first-strand cDNA was synthesized using reverse transcription with 100 ng of total RNA, with or without reverse transcriptase (RNase-free water was used in this case), and a PrimeScript RT reagent kit with gDNA Eraser (Perfect Real Time) (TaKaRa Bio, Otsu, Japan) following the manufacturer’s protocol.
Primers were designed using the nucleotide database of the US National Center for Biotechnology Information and are listed in Tables 1 and 2. The PCR mixture had a total volume of 10 μL and consisted of RNase-free water, PowerUp SYBR Green Master Mix (Thermo Fisher Scientific, Waltham, MA, USA), forward primer (0.3 μM), reverse primer (0.3 μM), and cDNA template (10 ng). The PCR reactions were conducted under the following conditions: 50°C for 2 min, 95°C for 2 min, 45 cycles of 95°C for 15 s, 58.3–59°C for 15 s, and 72°C for 1 min, and a melting curve analysis at 95°C for 15 s, 60°C for 1 min, and 95°C for 15 s using the StepOnePlus Real-Time PCR System (Thermo Fisher Scientific). The qPCR was conducted using triplicate samples, triplicate controls without reverse transcriptase, and duplicate non-template controls (the cDNA template was replaced by RNase-free water) for each chick and each primer pair. Expression of target genes was normalized to that of glyceraldehyde-3-phosphate dehydrogenase (GAPDH).
| Target gene | Abbreviation | Accession no. | Primer forward | Primer reverese | Product size (bp) | OR gene group | |
| Glyceraldehyde-3-phosphate dehydrogenase | GAPDH | NM_204305.2 | CCCATGTTTGTGATGGGTGTC | ATGGCATGGACAGTGGTCATA | 158 | - | |
| Olfactory receptor 3 | COR1 | NM_001031545.2 | CTCACCTGATGGCTGTCTCC | GGACAGCCTTAGAGTCAATGAA | 225 | γ | |
| Olfactory receptor family 5 subfamily J member 2 (COR8) | COR8 | NM_001396932.1 | ATGTCAAGGACACGCTCAGG | CTGAGTCAACGGCTTGTTGC | 332 | γ | |
| Olfactory receptor family 8 subfamily U member 1 | OR8U1 | NM_001031176.2 | GAGGATCCGCTCCAAGGATG | TAACTCTGCGTAGAGCGTCC | 236 | γ | |
| Olfactory receptor family 51 subfamily M member 1 | OR51M1 | NM_001008754.4 | ACTCCTCCATCCTCACTGGT | GGTGATGCCTAGCACAGTCC | 290 | α | |
| Olfactory receptor family 52 subfamily R member 1 | OR52R1 | NM_001009878.2 | CTGGATACCAGTGGAGAGGC | ATCAGACCATGGATAACGGTGC | 302 | α | |
| Olfactory receptor family 5 subfamily J member 2 (OLFR3A) | COR3 | NM_001396933.2 | AGTCATCTACACCACCACCTTG | TAGCAGCAAGCACTCTGAGG | 250 | γ | |
| Olfactory receptor family 5 subfamily J member 2 (OLFR4) | COR4 | NM_001031543.2 | GACCGGTACGTTGCCATCTG | GGTGCTGAGTTCAATGATGCC | 270 | γ | |
| Olfactory receptor family 1 subfamily F member 2 | OR1F2P | XM_040685819.1 | CACCATCACTGTGCCGAAGA | TCTCTGTGCCAACAACGTCA | 113 | γ | |
| XM_025146504.2 | |||||||
| Olfactory receptor family 4 subfamily S member 2 | OR4S2 | XM_040685446.1 | GATGTCCACCCCCTGTTACG | ATGGCCCGAAGAACAGAACC | 223 | γ | |
| XM_003643764.5 | |||||||
| Olfactory receptor family 5 subfamily AP member 2 | OR5AP2 | XM_040685466.1 | TCATTTACACCGCCACCCTG | TCTTGGGAGCGATTGCAGAG | 144 | γ | |
| XM_428286.5 | |||||||
| Olfactory receptor family 9 subfamily Q member 1 | OR9Q1 | XM_040660893.1 | GACGGCCAACCTCAACTACA | GTAGATGAGGGGGTTCAGCG | 112 | γ | |
| XM_004937383.4 | |||||||
| Olfactory receptor family 10 subfamily A member 4 | OR10A4 | XM_040680486.1 | TGGTGGTGACGCTGTTCTAC | TAAGTGAAACCCTCTGGGCA | 227 | γ | |
| XM_001231930.6 | |||||||
| Olfactory receptor family 14 subfamily J member 1-like 112 | OR14J1L112 | XM_040654712.1 | CACGGGGCTTCTCTATTCCC | ACAGAACAGACACCACCAGG | 383 | γ-c | |
| Olfactory receptor family 52 subfamily L member 1 | OR52L1 | XM_040661969.1 | CGCCTTTTCTCCTGATGGGA | GCCCAGCCAGAATACACTCA | 236 | α | |
| XM_040660299.1 | |||||||
| Olfactory receptor family 6 subfamily B member 1 | OR6B1 | NM_001030392.2 | TGTTCATCCTGCTCGTTCCC | ACATGGGTGTGACAATAGCA | 243 | γ | |
| XM_040706280.2 | |||||||
| XM_046924729.1 | |||||||
| XM_040706279.2 | |||||||
| XM_040706277.2 | |||||||
| XM_046924728.1 | |||||||
| XM_040706276.2 | |||||||
| Olfactory receptor family 8 subfamily D member 4 | OR8D4 | XM_046919070.1 | CATACCTTGTCGGGGTTGTGA | TGGAACCAGCAGAGGCATAGA | 330 | γ | |
| Olfactory receptor family 5 subfamily AS member 1 | OR5AS1 | XM_040672629.1 | AGCTGCTGGTGAATCTCGTG | CTGAGATAAGCCCCGGCTAC | 214 | γ | |
| Olfactory receptor family 5 subfamily I member 1 | OR5I1 | XM_040672626.1 | GGCCATTTGTAACCCACTGC | TGCAAGAGTGGTTGCCTCAA | 265 | γ | |
| XM_426384.6 | |||||||
Those with more than one accession No. are due to the presence of more than one chicken BioProject or more than one splice variant.
| Target gene | Abbreviation | Accession no. | Primer forward | Primer reverese | Product size (bp) |
| Trace amine associated receptor 1 | TAAR1 | XM_040667842.2 | AGCCAAAAGGCAGGCAAGA | AAGAAGAATGGGCTCCAGCA | 153 |
| Trace amine associated receptor 2 | TAAR2 | XM_040667703.1 | TAGGTCACCCGGAGTACGAG | CTCCACAGACCTCACCATGC | 208 |
| Trace amine associated receptor 5 | TAAR5 | XM_040668165.1 | TGACCCTTTGCTCTACCCCA | GCCACCCCCAGAGCTTATTG | 197 |
| Adenylate cyclase 3 | ADCY3 | XM_040668402.2 | CTTCTCTCGCCACGAGCTGTA | ACTGGGGTTCATCCAGGAGT | 179 |
| XM_040698094.2 | |||||
| XM_040698095.2 | |||||
| XM_040668401.2 | |||||
| Anoctamin 2 | ANO2 | XM_046909374.1 | AGTCTGAACAGGCAGAAGGC | AAGTGCATGCCACTCATGGA | 224 |
| XM_046909597.1 | |||||
| Cyclic nucleotide gated channel subunit alpha 2 | CNGA2 | XM_040669765.2 | GACCCTGCAAGGGATTGGTAT | GGTGAAGATGAGGGCTAGAGG | 134 |
| XM_040669764.2 | |||||
| XM_025149974.3 | |||||
| XM_025149973.3 | |||||
| Cyclic nucleotide gated channel subunit alpha 4 | CNGA4 | XM_040657765.2 | AGTCCAGTGCCCTCAAACTG | CTGCGCCTTAGTGGGATCTT | 179 |
| XM_015280937.4 | |||||
| Cyclic nucleotide gated channel subunit beta 1 | CNGB1 | XM_040680816.2 | ACATGGGTCTACGATGGGGA | GGTTCTGGACTGTTCTGGGG | 283 |
| XM_040645978.2 | |||||
| XM_015292311.4 | |||||
| XM_015292310.4 | |||||
| G protein subunit alpha L | GNAL | XM_046911740.1 | GAGGATCCTGCACGTCAATGG | CATGCTGACGCTGTCGATTC | 337 |
| XM_046911739.1 | |||||
| XM_046926427.1 | |||||
| NM_001396901.1 | |||||
| NM_001008746.2 |
Those with more than one accession No. are due to the presence of more than one chicken BioProject or more than one splice variant.
To check the amplification of unintended targets, we confirmed the correct bands (or no bands in negative controls) using electrophoresis and single peaks (or no peaks in negative controls) in the melting curve analysis for all samples and negative controls. For electrophoresis, 3 μL of PCR products and 100 bp of DNA Ladder (TaKaRa Bio) were mixed with a nucleic acid staining reagent (Midori Green Direct, Nippon Genetics) following the manufacturer’s protocol, and the mixture was run on a 1.5%-agarose gel with Tris-borate-ethylenediaminetetraacetic acid buffer.
Classifying ORs and determining their proteoformsOR genes analyzed in this study were assigned to the respective OR groups based on a literature search. Using the phylogenetic tree provided by Khan et al.[16], the OR genes in OR families 51 and 52 were classified in the α group, while other OR genes were classified in the γ group. Among γ-group ORs, gene family 14 is specifically expanded in avian species and is classified in the γ-c group[16]. The classification of each OR group is reported in Table 1. To determine whether OR and TAAR genes examined herein encoded for seven-transmembrane receptors, we applied the PROTTER open-source tool for proteoform visualization[23].
Statistical analysesMicrosoft Excel for Mac (2021; Redmond, WA, USA) was used to create graphs of the results. Gene relative expression levels obtained using qPCR (ΔΔCt method) are expressed as the mean ± standard deviation (SD).
Using qPCR and subsequent electrophoresis, we investigated whether ORs, TAARs, and olfactory signaling pathway genes were expressed in chicken OE. qPCR results confirmed the mRNA expression of COR1, COR8, OR8U1, OR51M1, OR52R1, COR3, and COR4 (Fig. 1A); OR1F2P, OR4S2, OR5AP2, OR9Q1, OR10A4, OR14J1L112, and OR52L1 (Fig. 1B); as well as OR6B1, OR8D4, OR5AS1, and OR5I1 (Fig. 1C) in chicken OE. Expression of TAAR genes TAAR1, TAAR2, and TAAR5 was also confirmed (Fig. 2A), along with that of the olfactory signaling pathway genes ADCY3, ANO2, CNGA2, CNGA4, CNGB1, and GNAL (Fig. 3A). Single peaks were confirmed using melt-curve analysis of the amplified products (data not shown).
Relative mRNA levels of olfactory receptor (OR) genes in chicken olfactory epithelium (OE).A, B, C: Mean relative mRNA levels (normalized to GAPDH) ± standard deviation (SD) (n = 6–8). D, E, F: Representative electrophoresis result of OR expression obtained after qPCR with reverse transcriptase (RT+), or in negative controls lacking RT (RT−) or template (Water).
Relative mRNA levels of trace-amine-associated receptor (TAAR) genes in chicken OE.A: Mean relative mRNA levels (normalized to GAPDH) ± SD (n = 7–8). B: Representative electrophoresis result for TAAR expression obtained after qPCR with RT (RT+), or in negative controls lacking RT (RT−) or template (Water).
Relative mRNA levels of olfactory signaling pathway genes in chicken OE.A: Mean relative mRNA levels (normalized to GAPDH) ± SD (n = 7–8). B: Representative electrophoresis result for these olfactory signaling pathway genes’ expression obtained after qPCR with RT (RT+), or in negative controls lacking RT (RT−) or template (Water).
Next, we investigated whether the amplified products had the correct target size expected for the chosen primer sets (Tables 1 and 2). Electrophoresis confirmed that every amplified product matched its expected target size. Representative data from a single chick are shown in Fig. 1D, E, F, Fig. 2B, and Fig. 3B. Control experiments without reverse transcriptase or cDNA template (water) failed to yield any bands (Fig. 1D, E, F, Fig. 2B, and Fig. 3B), indicating that genomic DNA and cDNAs were not contaminated.
Using PROTTER, we confirmed that all ORs and TAARs examined in this study, except for OR52L1 (data not shown), constitute seven-transmembrane receptors.
In this study, qPCR analysis and agarose gel electrophoresis confirmed the expression of 18 ORs (Fig. 1), three TAARs (Fig. 2), and six signaling pathway molecules (Fig. 3) in chicken OE, suggesting their role in olfaction-related processes.
Chickens have 300 functional OR genes[17,24], and the expression of some OR mRNAs, such as COR3, COR4, and COR8, in chicken OE has been confirmed using in situ hybridization[19,20]. The current analyses confirmed the expression of COR3, COR4, and COR8 in chicken OE. Moreover, we report the expression of a total of 15 OR genes in chicken OE, along with three previously predicted functional TAAR genes[18]. Other studies noted the expressions of olfactory signaling pathway molecules, such as Gαolf (GNAL), ACIII (ADCY3), CNG channel (CNGA2, CNGA4, and CNGB1), and ANO2 (ANO2), in chicken as well as mammalian OE[21,22]. We speculated that these ORs, TAARs, and olfactory signaling pathway molecules were expressed and involved in olfactory sensing in chickens.
Although our results confirm the expression of olfactory sense-related molecules in chicken OE, their functions remain to be elucidated. Our search of the relevant literature identified no evidence concerning the repertoire of odorants that could activate ORs and TAARs in chickens or whether olfactory signaling pathway proteins were involved in the depolarization of chicken OSNs. As some odorants change chicken behavior[1], the identification of functional receptors for these scents will reveal odorants that can control chicken behavior.
Model vertebrates, such as ray-finned fish, amphibians, mammals, lizards/snakes, and birds, have nine different monophyletic classes of ORs (α, β, γ, δ, ε, ξ, η, θ, and κ) divided into Type I and Type II[16,25,26]. Type I is the most diverse and includes Class I (α, β, δ, ε, ξ, θ, and κ groups) and Class II (γ and γ-c groups). The α and γ groups have undergone extremely large copy number expansions in tetrapods, possibly to enable detection of airborne odorants[25,27]. The remaining ORs of Type I (β, δ, ε, ξ, θ, and κ groups) and Type II (group η) are present mainly in fish and amphibian genomes and are thought to recognize water-soluble odorants[25,26]. The γ-c-group ORs are expanded only in birds[26], with 165 reported in chickens[28]. Our findings confirm the expression of three α-group ORs, 14 γ-group ORs, and one γ-c-group OR in chicken OE (Table 1). Although the number of γ-c-group OR genes in chickens is large, it was difficult to design primer pairs capable of discriminating between single γ-c-group OR genes owing to sequence similarity. Further studies on the function of avian-specific γ-c ORs will provide new insights into vertebrate olfaction mechanisms.
Among the genes examined in this study, 17 of the OR genes and the three TAAR genes belong to the family of seven-transmembrane receptors. According to PROTTER, OR52L1 is a pseudogene that cannot yield a seven-transmembrane receptor[23]. In contrast, human OR52L1 functions as a receptor for pentanoic acid, a carboxylic acid responsible for the unpleasant smell of human sweat[29]. We speculate that because the mRNA of OR52L1 is expressed in chicken OE, incomplete ORs may have functions other than odorant detection.
This study, which used two-week-old chicks, provides knowledge about the olfactory sensing mechanisms of growing chickens. The sex of the chicks used in this study was not identified. However, given that the smell of the female uropygial gland enhances sexual behavior in chickens[11], sex differences cannot be excluded. Such differences may explain the observed discrepancy in gene expression levels among individuals. Hence, future studies should assess the variation in olfactory sensing mechanisms according to age and sex in chickens.
The primers used in this study could detect mRNAs encoded by multiple accession numbers (Tables 1 and 2) owing to multiple BioProject data for chickens and splice variants. All targeted genes, except GAPDH, lacked introns. As some ORs harbor exons in their untranslated regions, alternative splicing produces various mRNA isoforms, but all result in a single OR protein[30]. As a result, even if variants were detected together, only one protein could be produced. Therefore, we believe that the objective of this study, i.e., to confirm the expression of each gene in chicken OE, has been fully achieved.
As qPCR was analyzed using the ΔΔCt method, quantification was done in the middle of the amplification process (mostly 20–35 cycles). In contrast, electrophoresis used samples amplified after 45 cycles. Thus, the differences in gene expression levels observed using qPCR were no longer detectable using electrophoresis, and the latter served only to verify the size of each gene.
The results of this study provide insights into the function and overall picture of the molecules responsible for chicken olfaction. Understanding olfaction and olfactory-related behaviors in chickens will help improve the poultry industry in terms of both animal welfare and efficiency. For example, the identification of odorants that can be safely used to regulate chicken food intake habits or inhibit combative behaviors would provide significant improvements.
In summary, our analyses revealed that genes encoding ORs, TAARs, and olfactory signaling pathway molecules were expressed in chicken OE. These results suggest that chickens possess mechanisms for capturing odorants and transducing olfactory signals. This information expands our understanding of chicken olfactory physiology, contributes to research on the regulation of chicken behavior by odorants, and provides an evolutionary perspective on avian olfaction systems.
We thank Mr. Tomohisa Yokoyama (WDB Holdings Co., Tokyo) for conducting qPCR and electrophoresis. This study was supported by a grant from the Senryaku 1 Program at Hirosaki University. We thank KN International Inc. (www.kninter.co.jp) for the English language revision.
K. Koyama and F. Kawabata conducted the experiments and analyzed the data. F. Kawabata designed the experiments. K. Koyama and F. Kawabata wrote and revised the manuscript.
The authors declare no conflicts of interest.
