Xylooligosaccharide Supplementation Mitigates Growth Performance Impairment and Intestinal Injuries in Enterohemorrhagic Escherichia coli-Challenged Broilers

Abstract

Xylooligosaccharide (XOS) is a typical prebiotic; however, whether it protects chickens from enterohemorrhagic Escherichia coli (EHEC) challenge remains unknown. This study investigated the protective effects of XOS on the growth and gut health of EHEC-challenged broilers. A total of 270 1-day-old broilers were divided into three groups (nine replicates per group): negative control (were not challenged), positive control (EHEC-challenged from days 8 to 11), and XOS (EHEC-challenged broilers supplemented with 1.6 g/kg XOS). Samples were collected from broilers at 14 days. XOS addition alleviated EHEC-induced decline in growth performance, liver index, and the villus height:crypt depth ratio in both the duodenum and ileum of broilers. XOS also attenuated the increase in the relative mRNA expression of the ileal proinflammatory cytokine interleukin 6 and the tight junction protein occludin in EHEC-challenged broilers. Microbiota analysis revealed that EHEC challenge reduced or tended to reduce the abundance of several beneficial bacteria (such as Firmicutes, Fournierella, and Lysinibacillus) and increased or tended to increase the abundance of multiple harmful bacteria (such as Proteobacteria, Aquabacterium, Methylotenera, and Arthrobacter) in the ileum. However, XOS addition mitigated these changes and downregulated or tended to downregulate certain disease-related pathways of the ileal microbiota. In conclusion, XOS supplementation mitigated poor growth performance and intestinal damage in EHEC-challenged broilers, and was probably involved in the attenuation of gut microbiota disturbances that might protect against EHEC infection. These findings provide a basis for the application of XOS to limit the risk of EHEC infection.

Introduction

Enterohemorrhagic Escherichia coli (EHEC) is a zoonotic pathogen responsible for multiple health disorders. Among the EHEC serotypes, EHEC O157:H7 is the most common and has drawn considerable attention worldwide[1]. EHEC O157:H7 infects multiple hosts, including animals and humans, causing a series of symptoms and serious threats to animal production and public health[1]. In chickens, EHEC O157:H7 challenge impairs growth performance and intestinal health[2,3]. Although antibiotics have been widely used to control bacterial infections in animals over the past few decades, their use in diets has now been prohibited in most countries and areas worldwide because of the occurrence of many side effects, such as antibiotic residues and bacterial resistance. These consequences are of great concern for both animal production and public health. Therefore, alternative approaches are imperative to limit the detrimental effects of EHEC infection on animal production.

There is increasing interest in characterizing functional oligosaccharides as potential antibiotic substitutes to restrain bacterial infections in poultry[4]. As a functional oligosaccharide, xylooligosaccharide (XOS) is usually produced by the enzymolysis of xylan, a natural constituent that spreads broadly in plant cell walls. XOS is an oligomer consisting of β-xylopyranosyl units that are unable to be degraded by intestinal digestive enzymes. Instead, XOS is degraded by certain beneficial bacteria possessing polysaccharide utilization loci within the intestine, thus exerting prebiotic actions and improving the intestinal microecology of the host[5,6]. These actions may allow for the beneficial effects of XOS on intestinal structure and function, along with the growth performance of animals. Indeed, supplemental XOS increases body weight gain and feed efficiency, and ameliorates intestinal morphological structure and immune reactions in broilers[7,8]. Nevertheless, it remains unclear whether XOS may protect chickens from EHEC challenge. Since gut microbiota dysbiosis caused by bacterial infection is implicated in the intestinal inflammatory microenvironment and intestinal disruption of hosts[9], and improving gut microbiota represents a promising approach to combat bacterial infection in broilers[10], we hypothesized that the potential improvements in gut microbiota following XOS addition may protect chickens against EHEC challenge. Consequently, this study explored the potential effects of XOS supplementation on the growth performance and gut health of EHEC-challenged broilers, thereby providing a novel strategy for restraining EHEC infection in chicken production.

Materials and Methods

Animals, diets, and experimental design

The animal experimental protocols used in the present study were approved by the Institutional Animal Care and Use Committee of South China Agricultural University (Guangzhou, China; Approval no. SCAU2024F011). A total of 270 1-day-old female 818 broiler chicks with similar initial body weight were stochastically grouped into three groups (note: 818 broilers are a small-sized commercial broiler generated by crossbreeding AA broilers (♂) with Hy-Line Brown laying hens (♀) and occupy a relatively large market share in China). Broilers in the negative control (NC) group were fed a basal diet, broilers in the positive control (PC) group were fed a basal diet and challenged with EHEC, while broilers in the XOS group were fed a basal diet containing 1.6 g/kg XOS and challenged with EHEC. Each group included nine replicates, with 10 broilers per replicate cage. XOS (Longlive Biotechnol., Dezhou, China) was prepared from corncobs with purity greater than 95%. The amount of XOS added to the diet was determined based on preliminary experiments. The nutritional composition of the basal diet is presented in Table 1. All broilers were reared in battery cages (10 broilers per cage, with dimensions of 70 cm × 55 cm × 45 cm) in an environmentally controlled house, where the temperature was kept at approximately 34 °C for the first three days and then lowered by 3 °C per week. Experimental diets and drinking water were supplied ad libitum to all broilers, who received incandescent light for 23 h per day throughout the experiment.

Table 1.  Composition of the basal diet (air-dry basis)

Ingredients	Content (%)
Corn	60.83
Soybean meal	20.45
Soybean oil	3.00
Corn gluten meal	11.21
Limestone	1.45
Dicalcium phosphate	1.45
Choline chloride (50%)	0.05
Sodium chloride	0.10
L-Lysine. hydrogen chloride (67%)	0.64
DL-Methionine (98%)	0.10
L-Tryptophan (99%)	0.09
L-Threonine (99%)	0.06
L-Cystine (99%)	0.07
Premix1	0.50
Total	100.00
Nutrient levels
Metabolizable energy (MJ/kg)	13.40
Crude protein	22.00
Calcium	1.05
Available phosphorus	0.48
Lysine	1.25
Methionine	0.52
Methionine + cysteine	0.93

¹Premix provided per kilogram of diet: Vitamin A 12000 IU, Vitamin D₃ 600 IU, Vitamin E 100 mg, Vitamin K₃ 15 mg, Vitamin B₁ 10 mg, Vitamin B₂ 30 mg, Vitamin B₆ 20 mg, calcium pantothenate 60 mg, nicotinamide 218 mg, choline chloride 450 mg, biotin 0.6 mg, folic acid 1.5 mg; Fe 80 mg, Cu 10 mg, Zn 80 mg, Mn 60 mg, I 1.4 mg, Se .6 mg.

Bacterial challenge and sampling

The EHEC O157:H7 EDL933 (the prototypic/reference strain of EHEC O157:H7) was cultured (37 °C, 180 r/min) in Luria broth (LB) medium overnight. It was then diluted and spread on MacConkey agar medium at 37 °C for 24 h. During four consecutive days (days 8–11), each broiler in the PC and XOS groups was orally administered 2 mL EHEC inoculum (5.0 × 10⁹ CFU/mL), while broilers in the NC group were orally administered the same amount of LB medium. On day 14, one broiler per replicate cage was randomly selected and weighed, and then sacrificed to isolate the spleen, liver, bursa of Fabricius, thymus, and intestinal tract. The midpoints of the proximal intestine (duodenum) and distal intestine (ileum) were collected and cut into two parts, soaked in 10% formalin, and quickly frozen in liquid nitrogen. Finally, the ileal content of each broiler chicken was determined.

Measurements of growth performance and organ indices

At 14 days of age, the live body weight and feed consumption of broilers in each replicate cage were documented. The average daily feed intake (ADFI), average daily gain (ADG), feed-to-gain ratio (F/G), and final body weight (FBW) from 1–14 days of age were determined. In addition, the spleen, liver, bursa of Fabricius, and thymus were weighed to determine organ indices, as calculated by the ratio of organ weight (g) to live body weight (kg).

Examination of intestinal morphology

Samples from the duodenum and ileum were soaked in 10% formalin, embedded in paraffin, and stained with hematoxylin and eosin. For each section, representative villi with a complete structure (seven villi per section/sample) were chosen to examine intestinal mucosal morphology using an optical microscope. The villus height (VH) and crypt depth (CD) of each villus were measured as described in a previous study[10], followed by calculation of the VH-to-CD ratio (VCR). The aforementioned parameters of seven villi per sample were examined to determine the average morphology of the sample.

Measurement of intestinal gene expression

Total RNA samples of the ileum were extracted using a commercial total RNA isolation kit (FastPure^®, Vazyme, Nanjing, China) using the corresponding instructions. After determining the concentration and verifying the purity and integrity, RNA samples were reverse-transcribed into cDNA using HiScript II qRT SuperMix for qPCR (Vazyme Biotech. Co., Ltd., Nanjing, China). The polymerase chain reaction (PCR) mixtures contained 4 μL reverse transcriptase, 2 μL RNA samples, and 14 μL double distilled water. The reaction protocols were 25 °C for 5 min, followed by 50 °C for 15 min and 85 °C for 2 min. The resulting cDNA samples were used for real-time (RT)-PCR, which was performed using 2× Taq Master Mix (Vazyme Biotech. Co. Ltd., Nanjing, China) on a CFX96 Touch RT-PCR instrument (Bio-Rad Laboratories, Hercules, CA, USA). The RT-PCR reaction mixture contained 10 μL 2× ChamQ Universal SYBR qPCR Master Mix, 0.6 μL of each forward and reverse primer, 6.8 μL double distilled water, and 2 μL cDNA template. The PCR conditions were 95 °C for 10 min, followed by forty cycles of 95 °C for 15 s, 60 °C for 15 s and 72 °C for 40 s. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the housekeeping gene. Primer information for the housekeeping gene and target genes, including proinflammatory cytokines (interleukin (IL)-1β, IL-6, IL-8 and tumor necrosis factor (TNF)-α) and tight junction (TJ) proteins (claudin-1, occludin, and zonula occludens (ZO)-1) are listed in Table 2. The 2^-ΔΔCt method was used to calculate the relative mRNA expression of target genes.

Table 2.  Primer sequences used for real-time polymerase chain reaction (PCR)

Genes1	Primer sequences (5′-3′)	Product size (bp)
GAPDH	F: GGGCACGCCATCACTATCTT	187
	R: TCACAAACATGGGGGCATCA
IL-1β	F: TGCCTGCAGAAGAAGCCTCG	204
	R: GACGGGCTCAAAAACCTCCT
IL-6	F: CTCGTCCGGAACAACCTCAA	96
	R: GGAGAGCTTCGTCAGGCATT
IL-8	F: TTGGAAGCCACTTCAGTCAGAC	120
	R: GGAGCAGGAGGAATTACCAGTT
TNF-α	F: GAGCAGGGCTGACACGGAT	152
	R: CAGGCACAAAAGAGCTGATGG
Claudin-1	F: CACTGCCACTCCCTGATGTT	270
	R: ACCGGTGACAGACTGGTTTC
Occludin	F: TTCGTCATGCTCATCGCCTC	158
	R: TCCACGGTGCAGTAGTGGTA
ZO-1	F: CTTCAGGTGTTTCTCTTCCTCCTC	131
	R: CTGTGGTTTCATGGCTGGATC

¹GAPDH, reduced glyceraldehyde-phosphate dehydrogenase; IL, interleukin; TNF, tumor necrosis factor; ZO, zonula occludens.

Analysis of ileal microbiota

As ileal microbiota may be more closely linked to the gut health and growth of poultry (versus cecal microbiota), bacterial DNA was isolated from ileal digested samples (five samples were randomly selected from each group that contained nine replicate samples) using the TIANamp Stool DNA Kit (Tiangen, Beijing, China) and the column centrifugation method. The Nanodrop 2000 (Thermo Fisher Scientific, Waltham, MA, USA) and gel electrophoresis were used to validate the concentration and quality, respectively, of the isolated DNA samples. Bacterial 16S rDNA sequences spanning the V3–V4 variable regions were amplified using the primers 341 F (5′-ACTCCTACGGGAGGCAGCA-3′) and 805 R (5′-GGACTACHVGGGTWTCTAAT-3′), according to the following PCR conditions: 95 °C for 30 s, followed by 25 cycles of 50 °C for 30 s, 72 °C for 40 s, and 72 °C for 7 min. The PCR products were purified, quantified, and homogenized, and then used to make a sequencing library. High-throughput sequencing (2× 250 bp) was performed on an Illumina Novaseq 6000 instrument (Illumina, San Diego, CA, USA). Raw sequencing data were deposited in the Genome Sequence Archive (GSA number: CRA025650) in the China National Center for Bioinformation (https://ngdc.cncb.ac.cn/gsa/browse/CRA025650). Raw reads were filtered using Trimmomatic v0.33, and the Cutadapt 1.9.1 software was then used to identify and remove primer sequences to obtain clean reads[11]. The Dada2 method[12] was used for denoising to obtain non-chimeric reads that were clustered into operational taxonomic units based on 97% sequence similarity. Subsequently, bacterial α-diversity analysis, partial least squares discriminant analysis (PLS-DA) (which evaluated bacterial β-diversity), linear discriminant analysis (LDA) combined with effect size measurements (LEfSe), as well as Kruskal–Wallis rank sum tests were performed. Finally, the Phylogenetic Investigation of Communities by Reconstruction of Unobserved State (PICRUSt) was employed for the functional prediction of gut microbiota.

Statistical analysis

All data are presented as the mean ± standard error and have been subjected to one-way analysis of variance (ANOVA) using SPSS 25.0. Differences among groups following ANOVA were identified using Tukey’s honest significant difference (HSD) multiple comparison test. Kruskal–Wallis rank sum tests were used to detect differences in the proportions of ileal bacteria among groups[10]. Values of P < 0.05 were considered significantly different, while 0.05 ≤ P < 0.10 was viewed as a trend towards significance.

Results

Growth performance and organ indices

As shown in Table 3, the FBW and ADG of broilers during days 1–14 declined (P < 0.05) in the PC group compared to that of the NC group, whereas XOS addition counteracted (P < 0.05) these changes in the PC group. The liver indices were lower (P < 0.05) in the PC group than those in the NC group (Table 4); however, they were higher (P < 0.05) in the XOS group than those in the PC group. The bursal indices remained unchanged (P > 0.05) between the PC and NC groups and between the XOS and PC groups.

Table 3.  Effect of xylooligosaccharides on the growth performance¹ of enterohemorrhagic Escherichia coli-challengedbroilers (days 1–14) (n = 9)

	NC2	PC	XOS	P-value
IBW (g)	35.93 ± 0.07	35.97 ± 0.06	36.06 ± 0.05	0.319
FBW (g)	127.89 ± 1.54a	122.25 ± 1.62b	130.65 ± 0.59a	0.001
ADG (g)	7.12 ± 0.15a	6.59 ± 0.11b	7.03 ± 0.08a	0.008
ADFI (g)	12.23 ± 0.21	12.09 ± 0.63	12.54 ± 0.22	0.346
F/G	1.76 ± 0.03	1.81 ± 0.02	1.75 ± 0.02	0.146

^a,bValues within a row with different superscript letters differ significantly (P < 0.05).

¹IBW, initial body weight; FBW, final body weight; ADG, average daily gain; ADFI, average daily feed intake; F/G, feed-to-gain ratio.

²NC, negative control (broilers were not challenged); PC, positive control (broilers were challenged with enterohemorrhagic Escherichia coli from 8–11 days of age); XOS, PC broilers supplemented with 1.6 g/kg xylooligosaccharide.

Table 4.  Effect of xylooligosaccharides on the organ indices of enterohemorrhagic Escherichia coli-challengedbroilers (day 14) (n = 9)

	NC1	PC	XOS	P-value
Spleen index (g/kg)	0.84 ± 0.06	0.80 ± 0.05	0.78 ± 0.07	0.747
Liver index (g/kg)	40.93 ± 0.65a	34.61 ± 0.82b	38.73 ± 1.38a	0.002
Thymus index (g/kg)	2.36 ± 0.08	2.39 ± 0.09	2.11 ± 0.16	0.182
Bursal index (g/kg)	1.68 ± 0.11a	1.47 ± 0.08ab	1.31 ± 0.09b	0.039

^a,bValues within a row with different superscript letters differ significantly (P < 0.05).

¹NC, negative control (broilers were not challenged); PC, positive control (broilers were challenged with enterohemorrhagic Escherichia coli from 8–11 days of age); XOS, PC broilers supplemented with 1.6 g/kg xylooligosaccharide.

Intestinal morphology

Broilers in the PC group exhibited reductions (P < 0.05) in duodenal and ileal VCR compared to those in the NC group (Table 5); however, these parameters were similar (P > 0.05) between the XOS and NC groups. In addition, duodenal VH was greater (P < 0.05) in the XOS group that that in the PC group.

Table 5.  Effect of xylooligosaccharide on intestinal morphology¹ in enterohemorrhagic Escherichia coli-challengedbroilers (day 14) (n = 9)

	NC2	PC	XOS	P-value
Duodenal VH (μm)	986.04 ± 39.86b	917.67 ± 52.47b	1103.30 ± 41.53a	0.030
Duodenal CD (μm)	148.17 ± 8.82	158.75 ± 18.67	150.35 ± 9.95	0.546
Duodenal VCR	7.06 ± 0.41a	4.74 ± 0.65b	7.10 ± 0.46a	0.013
Ileal VH (μm)	534.96 ± 20.94	491.59 ± 14.23	507.19 ± 34.71	0.407
Ileal CD (μm)	128.46 ± 8.17	148.28 ± 9.94	126.85 ± 7.78	0.181
Ileal VCR	4.33 ± 0.30a	3.33 ± 0.22b	4.06 ± 0.09ab	0.016

^a,bValues within a row with different superscript letters differ significantly (P < 0.05).

¹VH, villus height; CD, crypt depth; VCR, villus height-to-crypt depth ratio.

²NC, negative control (broilers were not challenged); PC, positive control (broilers were challenged with enterohemorrhagic Escherichia coli from 8–11 days of age); XOS, PC broilers supplemented with 1.6 g/kg xylooligosaccharide.

Intestinal inflammatory cytokine expression

Owing to the more active immune response in the distal small intestine, ileum samples were selected for further analysis. As presented in Fig. 1, the relative mRNA expression of ileal IL-6 and occludin is elevated (P < 0.05) in the PC group relative to that in the NC group, but shows no difference (P > 0.05) between the XOS and NC groups.

Fig. 1.

Effect of xylooligosaccharide (XOS) on the relative mRNA expression of intestinal inflammatory cytokines (A) and tight junction proteins (B) in enterohemorrhagic Escherichia coli-challenged broilers (day 14).^a,bDifferent superscript letters represent significant differences (P < 0.05). NC, negative control (broilers were not challenged); PC, positive control (broilers were challenged with enterohemorrhagic Escherichia coli from 8–11 days of age); XOS, PC broilers supplemented with 1.6 g/kg xylooligosaccharide.

Ileal microbiota

The α-diversity parameters, including the Simpson, Shannon, Abundance-based Coverage Estimator, and Chao1 indices of ileal microbiota of broilers did not differ (P > 0.05) among groups (Fig. S1). However, the β-diversity analysis using the PLS-DA method revealed a clear separation of ileal microbial communities across different groups (Fig. 2).

Fig. 2.

Beta-diversity analysis of the gut microbiota of broilers was based on partial least squares discriminant analysis (day 14). NC, negative control (broilers were not challenged); PC, positive control (broilers were challenged with enterohemorrhagic Escherichia coli from 8–11 days of age); XOS, PC broilers supplemented with 1.6 g/kg xylooligosaccharide.

The major phylum present in the ilea of broilers was Firmicutes, followed by Proteobacteria (Fig. 3A). The proportion of Firmicutes in the XOS group (95.05%) was greater than that in the PC group (78.92%) and was almost the same as that in the NC group (95.58%), whereas the proportion of Proteobacteria in the XOS group (0.81%) was lower than that in the PC group (6.00%) and similar to that in the NC group (1.55%). Within Firmicutes, the predominant classes were Bacilli and Clostridia (Fig. 3B). The proportion of Bacilli was the highest in the NC group (80.54%), followed by the XOS (68.97%) and PC groups (34.82%). A contrasting trend was observed for the proportion of Clostridia. At the order and family levels (Fig. 3C,D), the predominant members were Lactobacillales (Lactobacillaceae) and Clostridiales (Clostridiaceae), whose proportions were higher and lower in the XOS group than that of those in the PC group, respectively. At the genus level, the predominant members of the ileal microbiota were Lactobacillus and Candidatus Arthromitus (Fig. 3E), accounting for more than 60% of the total bacteria. The XOS group showed an increase in the proportion of Lactobacillus coupled with a distinct decrease in the proportion of Candidatus Arthromitus when compared to that of the PC group, but showed little difference from the NC group.

Fig. 3.

Gut microbial distribution at various taxonomic levels (day 14). A: phylum level; B: class level; C: order level; D: family level; and E: genus level. NC, negative control (broilers were not challenged); PC, positive control (broilers were challenged with enterohemorrhagic Escherichia coli from 8–11 days of age); XOS, PC broilers supplemented with 1.6 g/kg xylooligosaccharide.

Differential bacteria in the ileum among groups

As shown in Table 6, different bacterial members at diverse taxonomic levels have been detected to distinguish the ileal microbiota from different groups. Relative to the NC group, the PC group had higher (P < 0.05) proportions of the phyla Planctomycetota and Proteobacteria, coupled with a lower (P < 0.05) proportion of the phylum Firmicutes, whereas the proportions of these bacteria remained comparable (P > 0.05) between the XOS and NC groups. At the genus level, the PC group exhibited a lower proportion of Noviherbaspirillum (P < 0.05) and greater proportions of Aquabacterium and Methylotenera than those of the NC group (P < 0.05). Nevertheless, the proportions of these bacteria remained comparable (P > 0.05) between the XOS and NC groups. In addition, the XOS group showed increased (P < 0.05) amounts of Lysinibacillus compared to that in the NC group.

Table 6.  Differential bacteria at the phylum and genus levels identified in the gut microbiota of broilers amonggroups (day 14) (n = 5)

	NC1	PC	XOS	P-value
Phyla (%)
Planctomycetota	0.006 ± 0.006b	0.087 ± 0.031a	0.020 ± 0.011b	0.026
Acidobacteriota	0.289 ± 0.103	2.071 ± 0.949	0.239 ± 0.117	0.062
Gemmatimonadota	0.104 ± 0.038	0.538 ± 0.248	0.051 ± 0.023	0.068
Firmicutes	95.580 ± 1.160	78.915 ± 9.681	95.047 ± 1.448	0.099
Proteobacteria	1.551 ± 0.459	6.001 ± 2.880	0.807 ± 0.325	0.099
Genera (%)
Aquabacterium	HDb,2	0.016 ± 0.008a	HDb	0.027
Methylotenera	HDc	0.056 ± 0.026a	0.003 ± 0.003b	0.038
Lysinibacillus	0.006 ± 0.006b	HDc	0.037 ± 0.017a	0.046
Arthrobacter	0.002 ± 0.002	0.079 ± 0.040	0.005 ± 0.004	0.054
Achromobacter	0.008 ± 0.004	HD	0.001 ± 0.001	0.072
Fournierella	0.015 ± 0.008	0.006 ± 0.006	0.161 ± 0.085	0.074
Bacteroides	0.287 ± 0.180	0.515 ± 0.186	2.023 ± 0.906	0.080
Prevotellaceae UCG-001	0.001 ± 0.001	HD	0.007 ± 0.004	0.083
Butyricicoccus	0.014 ± 0.007	0.012 ± 0.007	0.324 ± 0.189	0.099

^a-c Values with different superscripts differ significantly (P < 0.05).

¹NC, negative control (broilers were not challenged); PC, positive control (broilers were challenged with enterohemorrhagic Escherichia coli from 8–11 days of age); XOS, PC broilers supplemented with 1.6 g/kg xylooligosaccharide.

²HD: hardly detectable (< 0.0001%).

LEfSe-based richness (P < 0.05, LDA > 3.0) analysis was used to identify core bacteria in the ileum as biomarkers to distinguish groups. As shown in Fig. 4, the NC group was not enriched with any bacteria, whereas some harmful bacteria (such as Frankiales, Sporichthyaceae, and Dechloromonas) were differentially enriched in the PC group. In comparison, the XOS group was enriched with Chloroflexia.

Fig. 4.

Linear discriminant analysis (LDA) combined with effect size measurements (LEfSe) analysis of bacterial richness (P < 0.05, LDA > 3.0) in the gut microbiota of broilers (day 14). NC, negative control (broilers were not challenged); PC, positive control (broilers were challenged with enterohemorrhagic Escherichia coli from 8–11 days of age); XOS, PC broilers supplemented with 1.6 g/kg xylooligosaccharide. Note: the NC group was not enriched with any bacteria.

Functional prediction of ileal microbiota

PICRUSt was used to predict the functional genes of ileal microbiota involved in Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways. As illustrated in Fig. 5, the enrichment patterns of several functional pathways of ileal microbiota differ (P < 0.05) among groups. The enrichment of endocrine and metabolic disease pathways in the XOS group decreased (P < 0.05) when compared to that in the PC group, but was close to (P > 0.05) that in the NC group. In addition, the enrichment of other disease-related pathways, including cardiovascular and infectious disease pathways, such as viral and substance dependence, of the XOS group tended to be lower than those of the PC group (P < 0.10), but comparable to those of the NC group (P > 0.05).

Fig. 5.

Functional prediction of the broiler gut microbiota based on Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways. *Indicates a difference (P < 0.05) between the PC and XOS groups (day 14). ^#Indicates a tendency towards difference (P < 0.10) between the PC and XOS groups. NC, negative control (broilers were not challenged); PC, positive control (broilers were challenged with enterohemorrhagic Escherichia coli from 8–11 days of age); XOS, PC broilers supplemented with 1.6 g/kg xylooligosaccharide.

Discussion

EHEC, such as strain O157, infects many hosts, including farm animals[1]. In line with previous studies[2,3], the present study showed that EHEC-challenged broilers have poor growth performance, as indicated by reductions in FBW and ADG. This could be associated with intestinal injuries induced by EHEC challenge. Previous studies have demonstrated the role of XOS in improving the growth performance of broilers[7,8], although conflicting results have been reported elsewhere[13]. This contradiction might be due to disparities in the added level of XOS and/or the health condition of the animals. To date, little information was available on whether XOS protects the growth performance of animals infected with EHEC. In this study, XOS addition counteracted EHEC-induced declines in the FBW and ADG of broilers. Thus, XOS addition protects broiler growth performance against EHEC challenge, which is probably linked to the role of XOS in moderating EHEC-induced intestinal disruptions[14].

Organ indices are typically used to reflect the infection status and immune function in chickens[10]. EHEC challenge disturbs liver functions and lowers the liver index of broilers[3]. Similarly, in the current study, EHEC challenge reduced the liver index of broilers. This may be because the disturbance of gut microbiota following EHEC challenge leads to increased production of harmful metabolites in the gut, which subsequently causes damage and apoptosis of hepatic cells via the gut-liver axis[15], finally resulting in liver atrophy (i.e., reduction of the liver index). However, XOS addition reversed the EHEC-induced reduction in the liver index of broilers, suggesting that XOS plays a role in combating liver atrophy in EHEC-challenged broilers. This may be because XOS addition alleviates EHEC-induced intestinal injuries, especially the disturbance of the ileal microbiota, which may improve intestinal metabolite profiles and relieve liver damage via the gut-liver axis, thus restoring the liver index of EHEC-challenged broilers[16].

The intestinal mucosa separates the gut lumen from the internal milieu and protects the host from bacterial invasion[17]. Amelioration of intestinal morphology, including augmentation of VH and VCR, favors digestion and absorption, as well as barrier functions of the intestine[17], thus benefiting broiler growth performance[10]. Similar to previous studies[18,19], this study confirmed that EHEC challenge disrupted intestinal morphology in broilers (as manifested by the reduced VCR of the duodenum and ileum). Several previous studies have revealed the beneficial effects of XOS supplementation on the intestinal morphology of broilers[10,15], despite some variations among these findings. Nevertheless, information on whether XOS protects the intestinal mucosa of broilers against EHEC infection is scarce. Here, XOS addition alleviated the EHEC-induced decrease in duodenal and ileal VCR in broilers. These findings demonstrated that XOS facilitated the elongation of intestinal villi and protected the intestinal mucosa from EHEC invasion, which might contribute to the observed improvement in the growth performance of broilers.

Intraepithelial TJ comprising certain functional proteins (such as occludin, claudins, and ZO families) maintain intestinal integrity and create a paracellular permeability barrier that prevents bacterial translocation from the gut lumen[17]. In this study, the increased expression of ileal occludin (a core TJ protein) in broilers following EHEC challenge is similar to the results of our previous study[20]. This may be because the intestine has a self-defense mechanism against bacterial invasion via upregulation of TJ protein expression to maintain intestinal integrity and resist intestinal dysfunction induced by bacterial challenge[20]. However, XOS supplementation moderated the EHEC-induced increase in ileal occludin expression in broilers. Thus, the improved gut microbiota of broilers fed XOS diminishes the invasion burden of EHEC on intestinal barriers, thereby leading to a feedback reduction in ileal occludin expression[20].

EHEC-induced intestinal mucosal damage is associated with intestinal inflammation mediated by multiple inflammatory cytokines[3,21]. In accordance with a previous study[3], the present study demonstrates that EHEC challenge causes ileal inflammation in broilers, as manifested by the increased expression of the proinflammatory cytokine IL-6. Increased levels of IL-6 may impair the intestinal villus-crypt architecture[22], leading to the observed destruction of intestinal mucosal morphology in EHEC-challenged broilers. XOS regulates proinflammatory cytokine expression in pig intestines[22]. Similarly, the current study revealed that XOS addition reversed the EHEC-induced increase in ileal IL-6 expression. These data suggest that XOS may attenuate intestinal inflammation in broilers challenged with EHEC, which may explain the beneficial effects of XOS on the intestinal mucosal morphology in EHEC-challenged broilers.

Gut microbiota are closely linked to intestinal homeostasis and growth performance in animals[9,14]. In addition, they mediate a bacterial infection-related inflammatory environment within the intestine, and thus modulate the pathological processes of the host[9,14]. A previous study has revealed a disturbance in the gut microbiota of mice following EHEC challenge[21]. Similarly the current study found that EHEC challenge distinctly shifted both the β-diversity (as visualized by PLS-DA plot) and the composition of the ileal microbiota of broilers. Strikingly, EHEC challenge perturbed the ileal microbial distribution from the phylum level to the genus level; however, these changes were alleviated by XOS supplementation. These results are similar to those of previous studies that report an amelioration of the gut microbiota of broilers receiving XOS[7,13]. LEfSe and Kruskal-Wallis analyses were then employed to reveal differential bacteria in the gut among the treatment groups. Among the bacteria shifted by XOS supplementation, the roles of the phylum Planctomycetota and the class Chloroflexia in the gut remain uncertain; however, the influence of other bacterial phyla on intestinal health has been established. For example, Acidobacteriota and Gemmatimonadota induce intestinal inflammation in broilers[23]. In addition, the expansion of Proteobacteria represents a typical indicator of gut microbiota dysbiosis that disrupts the intestinal epithelia, as Proteobacteria include multiple pathogens capable of secreting harmful metabolites, thus causing intestinal inflammatory diseases[24,25]. Conversely, Firmicutes comprises numerous beneficial bacteria (e.g., Lactobacillus spp.) that favor intestinal anti-inflammation and energy harvest in hosts[26]. The expansion of Proteobacteria, along with the loss of Firmicutes, triggers intestinal inflammatory damage and poor production performance in chickens[27,28]. Therefore, we hypothesized that the increase in Firmicutes coupled with the reduction in Acidobacteriota, Gemmatimonadota, and Proteobacteria in the ileum might partly explain the efficacy of XOS supplementation in alleviating intestinal injury and the poor growth performance of EHEC-challenged broilers.

In addition to the above bacterial phyla, XOS addition caused obvious alterations in the bacterial genera in the broiler gut. The roles of several beneficial members of the gut have been previously explored. For instance, Lysinibacillus exhibits probiotic potential because of its ability to antagonize harmful bacteria and enrich certain beneficial bacteria, such as Lachnospiraceae and Lactobacillus in the gut[29], thus favoring intestinal function and production performance in animals[30,31]. Fournierella is closely linked to immune system development in broilers[32]. Bacteroides alleviates inflammation and maintains intestinal homeostasis in hosts[33,34]. Butyricicoccus attenuates intestinal injuries and promotes growth in animals because it produces abundant butyric acid[35,36], which acts as a crucial nutrient for enterocytes with the ability to sustain the renewal and repair of intestinal epithelia[37]. Accordingly, enrichment of the aforementioned beneficial bacteria in the ileum contributed to the ability of XOS to mitigate EHEC-induced intestinal disruption and growth retardation in broilers.

In addition to increasing the aforementioned beneficial bacteria, XOS supplementation simultaneously reduced several harmful bacteria in the broiler gut. Aquabacterium, Methylotenera, and Arthrobacter are potentially pathogenic or harmful bacteria carrying antibiotic resistance genes[38,39,40]. In support of the results described above, supplemental XOS downregulated or tended to downregulate several predicted pathways associated with host diseases, such as endocrine and metabolic diseases, infectious diseases, and viral and substance dependence of the gut microbiota. Overall, we speculated that the reduction of several harmful bacteria together with the downregulated enrichment of certain disease-related pathways of the ileal microbiota might also contribute to the role of XOS in protecting broiler gut health against EHEC challenge. Nevertheless, future studies exploring metagenomic analysis would further validate the exact improvements in the ileal microbial pathways of broilers fed XOS.

In conclusion, supplementation with XOS alleviated poor growth performance and intestinal damage in EHEC-challenged broilers, which could be attributed to the capacity of XOS to attenuate the EHEC-induced disturbance of the ileal microbiota, as characterized by the enrichment of certain beneficial bacteria (especially Lactobacillus crispatus) and the loss of several harmful bacteria. The findings of this study underscore the potential role of ileal microbiota in mediating the protective effect of XOS on growth performance and gut health in EHEC-challenged broilers, thus providing a novel strategy to prevent the hazards of EHEC infection in chickens.

Acknowledgments

This work was financially supported by the Guangdong Basic and Applied Basic Research Foundations (Grant Nos. 2023A1515011112 and 2025A1515012884), the National Natural Science Foundation of China (Grant No. 32102584), the Key Research and Development Plan Project of Guangzhou City (Grant No. SL2023B03J01234), and the Rural Science and Technology Correspondent Project of Guangzhou City (Grant No. 2024E04J0277).

Author Contributions

Qingyun Cao wrote the original draft; Yaru Song conducted the experiments; Jiarong Fang assisted with sample analysis; Zemin Dong performed gut microbiota-related bioinformatics analysis; Changming Zhang guided sample analysis; Hui Ye reviewed the results; Jianjun Zuo conducted the experiments and supervised the research; and Weiwei Wang designed the experiments and acquired funding.

Conflict of Interest

The authors declare no conflicts of interest.

References

• [1]  Ferens WA andHovde CJ. Escherichia coli O157:H7: animal reservoir and sources of human infection. Foodborne Pathog Dis, 8: 465–487. 2011. PMID:21117940, https://doi.org/10.1089/fpd.2010.0673
• [2]  Xiang L, Ying Z, Xue M, Xiaoxian P, Xiaorong L, Chunyang L, Yu W, Mingcheng L andBinxian L. A novel Lactobacillus bulgaricus isolate can maintain the intestinal health, improve the growth performance and reduce the colonization of E. coli O157:H7 in broilers. Br Poult Sci, 63: 621–632. 2022. PMID:35383527, https://doi.org/10.1080/00071668.2022.2062220
• [3]  Guo YN, Mou RW, Lu MH, Liang SS, He YM andTang LP. Three different routes of EHEC O157:H7 infection were used to establish EHEC broiler model. Poult Sci, 103: 103561. 2024. PMID:38417337, https://doi.org/10.1016/j.psj.2024.103561
• [4]  Yaqoob MU, El-Hack MEA, Hassan F, El-Saadony MT, Khafaga AF, Batiha GE, Yehia N, Elnesr SS, Alagawany M, El-Tarabily KA andWang M. The potential mechanistic insights and future implications for the effect of prebiotics on poultry performance, gut microbiome, and intestinal morphology. Poult Sci, 100: 101143. 2021. PMID:34062442, https://doi.org/10.1016/j.psj.2021.101143
• [5]  Pourabedin M, Guan L andZhao X. Xylo-oligosaccharides and virginiamycin differentially modulate gut microbial composition in chickens. Microbiome, 3: 15. 2015. PMID:25874109, https://doi.org/10.1186/s40168-015-0079-4
• [6]  Yadav S, Singh AK, Selvaraj RK, Applegate TJ, Bhattacharya P, Shinall SB, Fenn LS, Shanmugasundaram R andKim WK. Research Note: effect of dietary xylo-oligosaccharide on growth performance, intestinal histomorphology, and specific cecal bacteria in broiler chickens. Poult Sci, 103: 103189. 2024. PMID:37939588, https://doi.org/10.1016/j.psj.2023.103189
• [7]  Wu Y, Lei Z, Wang Y, Yin D, Aggrey SE, Guo Y andYuan J. Metabolome and microbiota analysis reveals the conducive effect of Pediococcus acidilactici BCC-1 and xylan oligosaccharides on broiler chickens. Front Microbiol, 12: 683905. 2021. PMID:34122394, https://doi.org/10.3389/fmicb.2021.683905
• [8]  Rao Z, Li Y, Yang X, Guo Y, Zhang W andWang Z. Diet xylo-oligosaccharide supplementation improves growth performance, immune function, and intestinal health of broilers. Anim Nutr, 17: 165–176. 2024. PMID:38779325, https://doi.org/10.1016/j.aninu.2024.01.004
• [9]  Ferreira RBR, Gill N, Willing BP, Antunes LCM, Russell SL, Croxen MA andFinlay BB. The intestinal microbiota plays a role in Salmonella-induced colitis independent of pathogen colonization. PLoS One, 6: e20338. 2011. PMID:21633507, https://doi.org/10.1371/journal.pone.0020338
• [10]  Wang W, Ou J, Ye H, Cao Q, Zhang C, Dong Z, Feng D andZuo J. Supplemental N-acyl homoserine lactonase alleviates intestinal disruption and improves gut microbiota in broilers challenged by Salmonella Typhimurium. J Anim Sci Biotechnol, 14: 7. 2023. PMID:36617579, https://doi.org/10.1186/s40104-022-00801-4
• [11]  He B, Zhu R, Yang H, Lu Q, Wang W, Song L, Sun X, Zhang G, Li S, Yang J, Tian G, Bing P andLang J. Assessing the impact of data preprocessing on analyzing next generation sequencing data. Front Bioeng Biotechnol, 8: 817. 2020. PMID:32850708, https://doi.org/10.3389/fbioe.2020.00817
• [12]  Callahan BJ, McMurdie PJ, Rosen MJ, Han AW, Johnson AJA andHolmes SP. DADA2: high-resolution sample inference from Illumina amplicon data. Nat Methods, 13: 581–583. 2016. PMID:27214047, https://doi.org/10.1038/nmeth.3869
• [13]  Deng F, Tang S, Zhao H, Zhong R, Liu L, Meng Q, Zhang H andChen L. Combined effects of sodium butyrate and xylo-oligosaccharide on growth performance, anti-inflammatory and antioxidant capacity, intestinal morphology and microbiota of broilers at early stage. Poult Sci, 102: 102585. 2023. PMID:36913758, https://doi.org/10.1016/j.psj.2023.102585
• [14]  Diaz Carrasco JM, Casanova NA andFernández Miyakawa ME. Microbiota, gut health and chicken productivity: what is the connection? Microorganisms, 7: 374. 2019. PMID:31547108, https://doi.org/10.3390/microorganisms7100374
• [15]  Wu Q, Zhu F, Yao Y, Chen L, Ding Y, Su Y andGe C. Sini san regulates intestinal flora and short-chain fatty acids to ameliorate hepatocyte apoptosis and relieve CCl4-induced liver fibrosis in mice. Front Pharmacol, 15: 1408459. 2024. PMID:39281277, https://doi.org/10.3389/fphar.2024.1408459
• [16]  Lensu S, Pariyani R, Mäkinen E, Yang B, Saleem W, Munukka E, Lehti M, Driuchina A, Lindén J, Tiirola M, Lahti L andPekkala S. Prebiotic xylo-oligosaccharides ameliorate high-fat-diet-induced hepatic steatosis in rats. Nutrients, 12: 3225. 2020. PMID:33105554, https://doi.org/10.3390/nu12113225
• [17]  Tang X, Xiong K, Fang R andLi M. Weaning stress and intestinal health of piglets: A review. Front Immunol, 13: 1042778. 2022. PMID:36505434, https://doi.org/10.3389/fimmu.2022.1042778
• [18]  Small JT andWeiss AA. Intestinal enteroid monolayers model the human intestinal environment for Escherichia coli infection. J Bacteriol, 204: e00620-21. 2022. PMID:35389257, https://doi.org/10.1128/jb.00620-21
• [19]  Li H, Xie X, Li Y, Chen M, Xue L, Wang J, Zhang J, Wu S, Ye Q, Zhang S, Yang R, Zhao H, Wu L, Liang T, Ding Y andWu Q. Pediococcus pentosaceus IM96 exerts protective effects against enterohemorrhagic Escherichia coli O157:H7 infection in vivo. Foods, 10: 2945. 2021. PMID:34945495, https://doi.org/10.3390/foods10122945
• [20]Wang WW, Chen YL, Ye H, Dong ZM, Zhang CM, Feng DY, Cao QY, Liang SJ andZuo JJ. N-acyl homoserine lactonase attenuates the virulence of Salmonella typhimurium and its induction of intestinal damages in broilers. Anim Nutr, 14: 334–342. 2023. https://doi.org/10.1016/j.aninu.2023.04.010
• [21]  Fang X, Nong K, Wang Z, Jin Y, Gao F, Zeng Q, Wang X andZhang H. Human cathelicidin LL-37 exerts amelioration effects against EHEC O157:H7 infection regarding inflammation, enteric dysbacteriosis, and impairment of gut barrier function. Peptides, 159: 170903. 2023. PMID:36370932, https://doi.org/10.1016/j.peptides.2022.170903
• [22]  Wang X, Xiao K, Yu C, Wang L, Liang T, Zhu H, Xu X andLiu Y. Xylooligosaccharide attenuates lipopolysaccharide-induced intestinal injury in piglets via suppressing inflammation and modulating cecal microbial communities. Anim Nutr, 7: 609–620. 2021. PMID:34377847, https://doi.org/10.1016/j.aninu.2020.11.008
• [23]  Paneru D, Tellez-Isaias G, Bottje WG, Asiamah E, Abdel-Wareth AAA, Salahuddin M andLohakare J. Modulation of immune response and cecal microbiota by dietary fenugreek seeds in broilers. Vet Sci, 11: 57. 2024. PMID:38393075, https://doi.org/10.3390/vetsci11020057
• [24]  Guo X, Huang C, Xu J, Xu H, Liu L, Zhao H, Wang J, Huang W, Peng W, Chen Y, Nie Y, Zhou Y andZhou Y. Gut microbiota is a potential biomarker in inflammatory bowel disease. Front Nutr, 8: 818902. 2022. PMID:35127797, https://doi.org/10.3389/fnut.2021.818902
• [25]  Litvak Y, Byndloss MX, Tsolis RM andBäumler AJ. Dysbiotic Proteobacteria expansion: a microbial signature of epithelial dysfunction. Curr Opin Microbiol, 39: 1–6. 2017. PMID:28783509, https://doi.org/10.1016/j.mib.2017.07.003
• [26]  Jumpertz R, Le DS, Turnbaugh PJ, Trinidad C, Bogardus C, Gordon JI andKrakoff J. Energy-balance studies reveal associations between gut microbes, caloric load, and nutrient absorption in humans. Am J Clin Nutr, 94: 58–65. 2011. PMID:21543530, https://doi.org/10.3945/ajcn.110.010132
• [27]  Torok VA, Hughes RJ, Mikkelsen LL, Perez-Maldonado R, Balding K, MacAlpine R, Percy NJ andOphel-Keller K. Identification and characterization of potential performance-related gut microbiotas in broiler chickens across various feeding trials. Appl Environ Microbiol, 77: 5868–5878. 2011. PMID:21742925, https://doi.org/10.1128/AEM.00165-11
• [28]  Zhou J, Zhang H, Wu S, Qiu K, Fu Y, Qi G andWang J. Supplemental xylooligosaccharide modulates intestinal mucosal barrier and cecal microbiota in laying hens fed oxidized fish oil. Front Microbiol, 12: 635333. 2021. PMID:33692770, https://doi.org/10.3389/fmicb.2021.635333
• [29]  Zeng Z, Yue W, Kined C, Raciheon B, Liu J andChen X. Effect of Lysinibacillus isolated from environment on probiotic properties and gut microbiota in mice. Ecotoxicol Environ Saf, 258: 114952. 2023. PMID:37141683, https://doi.org/10.1016/j.ecoenv.2023.114952
• [30]  Mani SR, Vijayan K, Jacob JP, Vijayakumar S andKandhasamy S. Evaluation of probiotic properties of Lysinibacillus macroides under in vitro conditions and culture of Cyprinus carpio on growth parameters. Arch Microbiol, 203: 4705–4714. 2021. PMID:34185117, https://doi.org/10.1007/s00203-021-02452-x
• [31]  Devi WM, Irungbam S, Kumar M, Choudhury TG andKamilya D. Probiotic potential of Bacillus pumilus COFAHE_Pro08 and Lysinibacillus macroides COFAHE_Pro06 isolated from the intestine of labeo catla. Turk J Fish Aquat Sci, 24: TRJFAS24144. 2023. https://doi.org/10.4194/TRJFAS24144
• [32]  Liu Y, Feng Y, Yang X, Lv Z, Li P, Zhang M, Wei F, Jin X, Hu Y, Guo Y andLiu D. Mining chicken ileal microbiota for immunomodulatory microorganisms. ISME J, 17: 758–774. 2023. PMID:36849630, https://doi.org/10.1038/s41396-023-01387-z
• [33]  Brown EM, Ke X, Hitchcock D, Jeanfavre S, Avila-Pacheco J, Nakata T, Arthur TD, Fornelos N, Heim C, Franzosa EA, Watson N, Huttenhower C, Haiser HJ, Dillow G, Graham DB, Finlay BB, Kostic AD, Porter JA, Vlamakis H, Clish CB andXavier RJ. Bacteroides-derived sphingolipids are critical for maintaining intestinal homeostasis and symbiosis. Cell Host Microbe, 25: 668–680.e7. 2019. PMID:31071294, https://doi.org/10.1016/j.chom.2019.04.002
• [34]  Tan H, Zhao J, Zhang H, Zhai Q andChen W. Novel strains of Bacteroides fragilis and Bacteroides ovatus alleviate the LPS-induced inflammation in mice. Appl Microbiol Biotechnol, 103: 2353–2365. 2019. PMID:30666361, https://doi.org/10.1007/s00253-019-09617-1
• [35]  Eeckhaut V, Wang J, Van Parys A, Haesebrouck F, Joossens M, Falony G, Raes J, Ducatelle R andVan Immerseel F. The probiotic Butyricicoccus pullicaecorum reduces feed conversion and protects from potentially harmful intestinal microorganisms and necrotic enteritis in broilers. Front Microbiol, 7: 1416. 2016. PMID:27708624, https://doi.org/10.3389/fmicb.2016.01416
• [36]  Trachsel J, Humphrey S andAllen HK. Butyricicoccus porcorum sp. nov., a butyrate-producing bacterium from swine intestinal tract. Int J Syst Evol Microbiol, 68: 1737–1742. 2018. PMID:29620502, https://doi.org/10.1099/ijsem.0.002738
• [37]  Bedford A andGong J. Implications of butyrate and its derivatives for gut health and animal production. Anim Nutr, 4: 151–159. 2018. PMID:30140754, https://doi.org/10.1016/j.aninu.2017.08.010
• [38]  Pathak A, Jaswal R andChauhan A. Genomic characterization of a mercury resistant Arthrobacter sp. H-02-3 reveals the presence heavy metal and antibiotic resistance determinants. Front Microbiol, 10: 3039. 2020. PMID:32010097, https://doi.org/10.3389/fmicb.2019.03039
• [39]  Weng Y, Qiao Y, Xiao C andFeng L. Seasonal variation of microbial community, potential opportunistic pathogens and antibiotic resistance genes in a novel underground reservoir of an island. Int J Environ Res, 16: 59. 2022. https://doi.org/10.1007/s41742-022-00435-4
• [40]  Zhao Y, Gao J, Wang Z, Dai H andWang Y. Responses of bacterial communities and resistance genes on microplastics to antibiotics and heavy metals in sewage environment. J Hazard Mater, 402: 123550. 2021. PMID:33254740, https://doi.org/10.1016/j.jhazmat.2020.123550