Effects of Quercetagetin on Gut-Liver Axis Function and Cecal Microbial Diversity in Broilers via PINK1/Parkin-Mediated Mitophagy

Abstract

Oxidative stress is a major constraint on broiler health and productivity. Mitochondrial dysfunction and gut–liver axis disruption play pivotal roles in this process. The present study investigated whether dietary quercetagetin (QG) alleviated diquat (DQ)-induced oxidative stress in broiler chickens through modulation of PINK1/Parkin-mediated mitophagy and gut–liver axis homeostasis. A total of 144 1-day-old WOD168 broilers were randomly assigned to four treatments with six replicate cages of six birds per cage: control group (non-challenged, basal diet), DQ group (DQ-challenged, basal diet), D_QG group (DQ-challenged, basal diet with 20 mg/kg QG), and QG group (non-challenged, basal diet with 20 mg/kg QG). On day 35, the DQ and D_QG groups were intraperitoneally administered DQ (20 mg/kg body weight). Dietary QG significantly increased body weight and attenuated the loss in average daily gain induced by DQ, while reducing serum aspartate aminotransferase levels. DQ challenge impaired gut barrier function, as indicated by decreased villus height, villus height/crypt depth ratio, and mRNA expression of Claudin-1 and ZO-1 (P < 0.05), exacerbated hepatic lesions, and significantly altered cecal microbial diversity. QG supplementation significantly attenuated the drop in glutathione peroxidase activity and downregulated PINK1 and LC3-II in hepatic mitochondria. It also significantly increased complex I activity, mitochondrial DNA copy number, and adenosine triphosphate content, while decreasing DQ-induced reactive oxygen species. Collectively, these results indicate that dietary QG alleviates DQ-induced oxidative stress by preserving mitochondrial function, potentially modulating PINK1/Parkin-related mitophagy, enhancing intestinal barrier integrity, and modulating cecal microbial composition.

Introduction

Modern broiler production emphasizes intensive management, including dense housing and accelerated growth, inevitably exposing birds to multiple environmental stressors that increase the oxidative burden. Accumulating evidence indicates that oxidative stress is a major driver of metabolic imbalance and performance decline in broilers [1]. Mitochondria are the primary sites of cellular energy conversion and redox regulation, and are indispensable for maintaining normal liver metabolism and intestinal physiological function. When oxidative challenges persist, mitochondrial functionality may deteriorate, resulting in impaired ATP synthesis and accumulation of reactive oxygen species (ROS). These type of mitochondrial disturbances negatively affect hepatic metabolic capacity, while simultaneously compromising intestinal barrier integrity. The gut and liver are linked through a coordinated regulatory network known as the gut–liver axis, which is shaped by intestinal permeability, microbially derived metabolites, and portal blood flow [2]. Disruption of this axis favors hepatic exposure to gut-derived endotoxins and inflammatory signals, intensifying liver inflammation and oxidative injury. In turn, hepatic metabolic dysfunction can disturb bile acid homeostasis and intestinal immune regulation, reinforcing the self-perpetuating cycle of gut–liver axis impairment [3, 4].

As a source of ROS, mitochondria are particularly vulnerable to oxidative insults. Structurally or functionally impaired mitochondria trigger uncontrolled ROS accumulation and release damage-associated molecular patterns, which are potent activators of inflammatory signaling that disrupt the metabolic and immune equilibrium of the gut–liver axis [5]. To preserve mitochondrial integrity, bioenergetic efficiency, and cellular homeostasis, eukaryotic cells rely on mitophagy, a quality-control process that enables the targeted clearance of damaged mitochondria. The PINK1/Parkin-dependent mitophagic pathway plays a central role in the identification and elimination of dysfunctional mitochondria [6]. Notably, enhancing PINK1/Parkin-mediated mitophagy has been shown to attenuate oxidative stress-induced liver injury, strengthen intestinal barrier integrity, and reduce inflammation and apoptosis [7]. Together, these findings suggest that mitophagy is a key regulatory node within the gut–liver axis and that nutritional strategies targeting it may help restore homeostasis in broilers.

Quercetagetin (QG), a naturally occurring flavonol isolated from the marigold Tagetes erecta L., an herbaceous flowering plant in the asteraceae family, has attracted increasing attention because of its potent antioxidant, anti-inflammatory, and immunoregulatory properties [8]. Specifically, dietary QG supplementation promotes broiler performance by enhancing antioxidant defenses, modulating immune function, and reshaping intestinal microbial communities [9]. Despite these reported benefits, whether QG exerts protective effects by regulating mitochondrial quality control, particularly PINK1/Parkin-mediated mitophagy, remains largely unexplored. Furthermore, the potential involvement of this pathway in maintaining mitochondrial function, preserving gut–liver axis homeostasis, and influencing gut microbial diversity under oxidative stress has not been elucidated. Stemming from our previous findings, the present study evaluated the effects of QG on hepatic mitochondrial function, intestinal integrity, and cecal microbiota composition in broilers challenged with diquat (DQ)-induced oxidative stress, with a special emphasis on the role of PINK1/Parkin-dependent mitophagy. The findings provide mechanistic insights and the basis for applying QG as a nutritional supplement in broiler production.

Materials and Methods

Experimental materials

QG was supplied by Chenguang Biotech Group Co., Ltd. (Handan, China). DQ (diquat dibromide monohydrate, lot no. b2327176) was purchased from Shanghai Aladdin Biochemical Technology Co., Ltd. (Shanghai, China).

Animals, experimental design, and management

A total of 144 one-day-old male WOD168 broilers were obtained from Hebei Yuko Poultry Industry Co., Ltd. (Handan, China). Birds had an initial body weight of 40.00 ± 0.32 g and were allocated to a single-factor completely randomized design. Broilers were randomly assigned to four treatment groups, each comprising six replicates, with six birds per replicate. The experimental treatments were as follows: (1) control group (CON), fed a basal diet without DQ challenge; (2) DQ-challenged group (DQ), fed a basal diet and subjected to oxidative stress; (3) DQ+QG group (D_QG), challenged with DQ and fed a basal diet supplemented with 20 mg/kg QG; and (4) QG group, fed a basal diet supplemented with 20 mg/kg QG without DQ challenge. On day 35, broilers in the DQ and D_QG groups received an intraperitoneal injection of DQ at 20 mg/kg body weight (BW), whereas birds in the CON and QG groups were injected with an equivalent volume of sterile saline (0.9% NaCl). QG supplementation level and DQ challenge protocol were selected based on a previous study [10].

All birds were fed a corn–soybean meal-based basal diet formulated to meet or exceed the nutrient requirements recommended by the NRC (1994) and the Chinese Feeding Standard for Chicken (NY/T 33-2004). The composition and calculated nutrient levels of the basal diet are listed in Table 1. Broilers were housed in a three-tier cage system (60 cm × 60 cm × 40 cm per cage) in an environmentally controlled poultry facility thoroughly disinfected before the start of the experiment. The ambient temperature was maintained at 33–35 °C during the first three days and subsequently reduced by 2–3 °C per week until it reached 22 ± 1 °C, which was maintained thereafter. Relative humidity was maintained at 55–65% throughout the trial. Food and water were provided ad libitum. The experimental period was 42 days.

Table 1.  Composition and nutrient levels of the basal diet (as-fed basis), %

Items	1 to 21 days of age	22 to 42 days of age
Ingredients
Corn	52.50	58.80
Soybean meal	40.00	33.80
Soybean oil	3.00	3.00
Dicalcium phosphate	1.90	1.80
Limestone	1.08	1.22
Salt	0.37	0.37
Lysine	0.05	0.03
Methionine	0.19	0.07
Premixa	0.80	0.80
Choline chloride	0.11	0.11
Total	100.00	100.00
Nutrient levelsb
Metabolic energy (MJ/kg)	12.42	12.62
Crude protein	21.77	19.65
Calcium	1.00	1.02
Available phosphorus	0.44	0.42
Lysine	1.34	1.15
Methionine	0.55	0.40
Cystine	0.40	0.36

^a) The premix provided the following per kilogram of diet: vitamin A 9000 IU, vitamin D3 3000 IU, vitamin E 26 mg, vitamin K3 1.20 mg, vitamin B1 3.00 mg, vitamin B2 8.00 mg, vitamin B6 4.40 mg, vitamin B12 0.012 mg, nicotinic acid 45 mg, folic acid 0.75 mg, biotin 0.20 mg, calcium pantothenate 15 mg, Fe 100 mg, Cu 10 mg, Zn 108 mg, Mn 120 mg, I 1.5 mg, Se 0.35 mg.

^b) Crude protein was measured, while the other parameters were calculated.

Sample collection

On days 35 and 42, one broiler was randomly selected from each replicate (six birds per treatment). Blood samples were collected from the anterior vena cava into sterile tubes. Serum was separated by centrifugation at 3,000 × g for 15 min and stored at −20 °C until subsequent analysis. At the end of the trial (day 42), the birds were euthanized and tissue samples were collected. Liver samples and approximately 2-cm segments of the mid-ileum were excised, gently rinsed with sterile 0.9% saline, and immediately fixed in 4% paraformaldehyde for histological examination. In parallel, approximately 0.5 g of fresh liver tissue was collected and processed for mitochondrial isolation and antioxidant-related measurements. Cecal digesta (approximately 2 mL) were transferred into sterile cryovials, snap-frozen in liquid nitrogen, and stored at −80 °C for subsequent analysis of microbial diversity.

Growth performance

Body weight and feed intake were recorded weekly throughout the experimental period. They were used to calculate the average daily gain (ADG), average daily feed intake (ADFI), and feed-to-gain ratio (F/G). All growth performance indices were adjusted to account for mortality during the study period.

Serum biochemical and antioxidant measurements

Serum samples preserved at −20 °C were equilibrated to room temperature prior to biochemical analysis. Alanine aminotransferase (ALT) and aspartate aminotransferase (AST) activity was quantified using commercially available ELISA kits (Wuhan Cloud-Clone Corp., Wuhan, China). Antioxidant enzyme activities of superoxide dismutase (SOD), catalase (CAT), and glutathione peroxidase (GPx) were measured in both serum and liver samples using assay kits obtained from Nanjing Jiancheng Bioengineering Institute (Nanjing, China), following the manufacturer’s protocols.

Histomorphological analysis of liver and intestinal tissues

Liver and intestinal specimens were fixed in 4% paraformaldehyde for 24 h, sequentially dehydrated in graded ethanol solutions, clarified in xylene, and embedded in paraffin. Paraffin-embedded tissues were sectioned using a rotary microtome and stained with hematoxylin and eosin (H&E). The sections were sealed with neutral resin and examined under a light microscope. For intestinal morphology, the villus height (VH) and crypt depth (CD) were quantified, and the villus height/crypt depth ratio (V/C) was calculated to evaluate structural alterations in the intestinal mucosa.

Determination of hepatic mitochondrial ATP content, membrane potential, ROS levels, and respiratory chain activity

Hepatic mitochondria were isolated using a commercially available kit (Beyotime Biotechnology, Nanjing, China). The mitochondrial ATP content was determined using an ATP detection kit (Solarbio, Beijing, China). Mitochondrial membrane potential (MMP) was evaluated using the JC-1 fluorescent probe, following the manufacturer’s guidelines (Beyotime Biotechnology). Mitochondrial ROS production was assessed using a ROS detection kit (Beyotime Biotechnology). The activities of mitochondrial respiratory chain complexes I, II, III, IV, and V were quantified using commercial assay kits (Nanjing Jiancheng Bioengineering Institute). All measurements were conducted in strict accordance with the manufacturer’s instructions.

Isolation of hepatic mitochondria

Hepatic mitochondria were isolated as described previously [11], with minor modifications. Briefly, liver tissues were processed using a commercial mitochondrial isolation kit (Solarbio) to obtain purified mitochondrial fractions. All procedures were carried out on ice to preserve mitochondrial structure and enzymatic activity.

Extraction and quantification of hepatic mitochondrial DNA

Total DNA was extracted from the liver tissue using a DNA isolation kit (Beyotime Biotechnology). DNA concentration and purity were assessed spectrophotometrically, and all samples were normalized to 200 ng/μL prior to analysis. Mitochondrial DNA (mtDNA) was quantified using primers specific to the D-loop region. Primers were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China) and are listed in Table 2.

Table 2.   Primer sequences and parameters

Genes	Gene Bank No.	Primer sequences, 5′-3′	Length (bp)
β-Actin	NM_205518	F: GCCAACAGAGAGAAGATGACAC	118
		R: GTAACACCATCACCAGAGTCCA
mtD-loop	XM_015291451.1	F: AGGACTACGGCTTGAAAAGC	198
		R: CATCTTGGCATCTTCAGTGCC
P62	NC_006100.4	F: CCGCTGCTGAATCCGTTTGAGT	239
		R: GGAACACCGTGCCGCATCTT
LC3-I	XM_417327.5	F: TTACACCCATATCAGATTCTTG	143
		R: ATTCCAACCTGTCCCTCA
LC3-II	NM_001031461	F: AGTGAAGTGTAGCAGGATGA	193
		R: AAGCCTTGTGAACGAGAT
Parkin	XM_419615	F: ATCTTGGCTACTCCCTCCCGTG	111
		R: ACGCACTCCTCCGCACCATA
PINK1	XM_423139	F: GATAGCCGCCTCTCCACCATGA	387
		R: GCAGCCAGCAGAATCGAACTCA
SOD	NM_205064.1	F: CCGGCTTGTCTGATGGAGAT	124
		R: TGCATCTTTTGGTCCACCGT
CAT	NM_001031215.2	F: AGAAGCCAGATGCCTTGACC	299
		R: CCCAGATTCTCCAGCAACAGT
GPx	NM_001277853.1	F: GACCAACCCGCAGTACATCA	205
		R: GAGGTGCGGGCTTTCCTTTA
Claudin-1	NM_001013611.2	F: GGGGACAACATCGTGACCG	100
		R: AGGAGTCGAAGACTTTGCACT
Occludin	XM_046904540.1	F: CCTCATCGTCATCCTGCTCT	95
		R: GGTCCCAGTAGATGTTGGCT
ZO-1	XM_413773.4	F: CTTCAGGTGTTTCTCTTCCTCCTC	131
		R: CTGTGGTTTCATGGCTGGATC

F, forward primer; R, reverse primer; β-Actin, beta-actin; LC3-I, Microtubule-associated protein 1 light chain 3-I; LC3-II, Microtubule-associated protein 1 light chain 3-II; Parkin, Parkin Protein; PINK1, PTEN-induced putative kinase 1; SOD, Superoxide dismutase; CAT, Catalase; GPx, Glutathione peroxidase; ZO-1, Zonula occludens-1.

Hepatic antioxidant and mitophagy real-time PCR analysis

Total RNA was isolated from liver tissues using TRIzol reagent (Tiangen Biotech Co., Ltd., Beijing, China). RNA concentration and purity were assessed spectrophotometrically before reverse transcription. Complementary DNA (cDNA) was synthesized using a HiScript III RT SuperMix for qPCR (+gDNA wiper) kit (Vazyme Biotech Co., Ltd., Nanjing, China) according to the manufacturer’s instructions. Quantitative real-time PCR was conducted in a total reaction volume of 20 μL, consisting of 10 μL 2× RealStar Fast SYBR qPCR Mix, 0.5 μL of each primer, 1 μL cDNA template, and nuclease-free water. Amplification was as follows: initial denaturation at 95 °C for 30 s, followed by 45 cycles of denaturation at 95 °C for 5 s, annealing at 60 °C for 30 s, and extension at 72 °C for 20 s. β-Actin was used as the internal reference, and relative gene expression levels were calculated using the 2^{^−ΔΔCt} method. The analyzed targets included antioxidant-related genes (SOD, CAT, and GPx), as well as genes involved in mitophagy regulation, including PINK1, Parkin, microtubule-associated protein 1 light chain 3 (LC3-I/LC3-II), and sequestosome-1 (p62). Primer sequences are listed in Table 2.

Cecal microbial diversity analysis

Total genomic DNA extracted from the cecal digesta was used as template for the amplification of the V3–V4 hypervariable region of the bacterial 16S rRNA gene using the universal primer pair 338F and 806R. Amplicons were verified by electrophoresis on a 2% agarose gel and were subsequently purified, quantified, and normalized prior to library construction. Qualified libraries were sequenced on an Illumina NEXTFLEX Rapid DNA-Seq platform using paired-end reads (PE300). Raw sequencing data were merged and subjected to quality control to remove low-quality reads. Operational taxonomic units (OTUs) were clustered at a 97% sequence similarity threshold, followed by taxonomic assignment and analysis of relative abundance to characterize the structure and diversity of the cecal microbial community.

Statistical analysis

Data were analyzed by two-way ANOVA in a 2 × 2 factorial arrangement, with DQ challenge and QG supplementation as the main factors along with their interactions, using SPSS software (version 20.0; SPSS Inc., Chicago, IL, USA). For growth performance parameters, the replicate cage was considered the experimental unit (n = 6 replicates per treatment). For serum biochemical parameters, antioxidant indices, mitochondrial function measurements, gene expression analyses, histological observations, and cecal microbiota analyses, one bird was randomly selected from each replicate cage and served as the experimental unit (n = 6 per treatment). When a significant interaction was detected (P < 0.05), the treatment means were compared using Tukey’s multiple comparison test. Differences were considered statistically significant at P < 0.05.

Results

Effect of QG on growth performance in DQ-challenged broilers

The effect of QG supplementation on the growth performance of broilers exposed to DQ is summarized in Table 3. On day 35, dietary QG increased the final BW by 7.69% and ADG by 4.01% compared to the CON group (P < 0.05). DQ challenge significantly reduced BW, ADG, and ADFI on day 42, whereas dietary QG supplementation significantly increased these parameters. Significant DQ×QG interactions were also observed for growth performance indices.

Table 3.  Effect of QG on growth performance of broilers challenged with DQ (DQ (+)) or saline (DQ (-)). Broilers were given either a basal diet (QG (-)) or basal diet supplemented with QG (QG (+)).

Items		DQ (-)		DQ (+)		SEM	P-value
		QG (-)	QG (+)	QG (-)	QG (+)		DQ	QG	Interaction
35 d	BW (kg)	1.11b	1.20a	1.10b	1.18a	0.06	-	-	-
	ADG (g/d)	42.04a	43.02a	40.20b	41.65a	8.65	-	-	-
	ADFI (g/d)	77.74	78.29	78.96	80.16	8.68	-	-	-
	F/G	1.89	1.85	1.95	1.88	0.09	-	-	-
42 d	BW (kg)	1.53bc	1.67a	1.49c	1.56b	0.05	<0.01	<0.01	0.04
	ADG (g/d)	57.19b	59.19a	48.86d	53.88c	1.73	<0.01	<0.01	0.02
	ADFI (g/d)	91.89b	98.25a	77.92d	89.22c	1.13	<0.01	<0.01	<0.01
	F/G	1.61	1.64	1.60	1.66	0.13	1.05	0.07	0.13

BW, body weight; ADG, Average daily gain; ADFI, Average daily feed intake; SEM, Standard error of the mean (n = 6 replicate cages per treatment).

^a,b Different superscripts within the same row indicate significant differences (P < 0.05).

Effect of QG on serum biochemical parameters in DQ-challenged broilers

The serum biochemical indices are shown in Fig. 1. Prior to DQ administration (day 35), ALT and AST levels did not differ among treatments (P > 0.05). On day 42, DQ challenge significantly increased serum ALT and AST in broilers, whereas dietary QG supplementation significantly decreased these parameters. Significant DQ×QG interactions were also observed between ALT and AST levels.

Fig. 1.

Effect of QG on serum biochemical parameters in broilers challenged with DQ.

CON, control; DQ, diquat; D_QG, diquat+quercetagetin; QG, quercetagetin; ALT, alanine transaminase; AST, aspartate aminotransferase.

^a-c Different letters indicate significant differences between the mean values for a given behavior (P < 0.05).

Effect of QG on hepatic histopathology in DQ-challenged broilers

Representative H&E-stained liver sections are shown in Fig. 2. The CON group displayed a healthy hepatic architecture with intact hepatocyte morphology and no inflammatory infiltration. In contrast, DQ treatment disrupted the hepatic cord structure, induced notable hepatocellular vacuolation, and induced the accumulation of inflammatory cells. Broilers in the D_QG group exhibited partial restoration of hepatic organization and alleviated inflammatory infiltration compared with those in the DQ group; whereas vacuolation was not significantly reduced.

Fig. 2.

H&E staining of broiler livers (200×).

CON, control; DQ, diquat; D_QG, diquat+quercetagetin; QG, quercetagetin;

Black arrows indicate the central vein (CV), blue arrows indicate vacuolation, red arrows indicate the hepatic cord, and black circles indicate cell infiltration.

Effect of QG on ileal histology and intestinal barrier function in DQ-challenged broilers

Ileal histomorphology is shown in Fig. 3. On day 42, broilers in the CON group exhibited intact epithelial structure and normal crypt morphology. DQ challenge resulted in shortening of the villi and mucosal disruption. Supplementation with QG improved villus morphology relative to that of the DQ group (Fig. 3A).

Fig. 3.

Effect of QG on ileal histomorphology and intestinal barrier function in broilers challenged with DQ. (A) H&E staining. (B) Ileal tissue morphology. (C) Expression levels of ileum-related genes.

CON, control; DQ, diquat; D_QG, diquat+quercetagetin; QG, quercetagetin; VH, villus height; CD, crypt depth;

^a-c Different letters indicate significant differences between the mean values for a given behavior (P < 0.05).

As shown in Fig. 3B, DQ challenge significantly decreased the ileal VH and V/C in broilers; however, the latter was restored to CON levels upon QG supplementation. Significant DQ×QG interactions were also observed between the VH and V/C groups. As shown in Fig. 3C, DQ challenge significantly decreased the mRNA expression of Claudin-1 and ZO-1 in the ileum (main effect of DQ); whereas dietary QG supplementation significantly increased their expression (main effect of QG). In addition, a significant DQ×QG interaction was detected for ZO-1 expression.

Effect of QG on the hepatic mitochondrial respiratory chain

The activities of mitochondrial respiratory chain complexes are presented in Table 4. On day 42, DQ challenge significantly decreased the activity of hepatic mitochondrial respiratory chain complexes I, IV, and V in broilers; whereas dietary QG supplementation significantly increased the activity of complex I. Significant DQ×QG interactions were also observed for the activities of complexes I, IV, and V.

Table 4.  Effect of QG on hepatic mitochondrial respiratory chain activity in broilers challenged with (DQ (+)) or saline (DQ (-)). Broilers were given either a basal diet (QG (-)) or basal diet supplemented with QG (QG (+)).

Items	DQ (-)		DQ (+)		SEM	P-value
	QG (-)	QG (+)	QG (-)	QG (+)		DQ	QG	Interaction
Complex I (μmol NADH/min/mgprot)	46.13b	51.85a	28.72a	44.33b	2.68	<0.01	<0.01	<0.01
Complex II (μmol DCPIP/min/mgprot)	26.48	27.55	29.03	27.62	2.09	0.17	0.14	0.81
Complex III (μmol CoQH2/min/mgprot)	26.52	27.62	23.26	27.52	2.02	0.86	0.71	0.63
Complex IV (μmol Cyt-C/min/mgprot)	18.70ab	18.92a	9.45c	18.05bc	0.63	0.02	0.05	<0.01
Complex V (μmol NADH/min/mgprot)	38.60a	36.15ab	24.2c	26.27c	3.01	0.02	0.81	0.01

^a,b,c Different superscripts within the same row indicate significant differences (P < 0.05).

SEM, Standard error of the mean (n = 6 broilers per treatment).

Effect of QG on hepatic mtDNA copy number, ATP content, MMP, and ROS levels

As shown in Fig. 4A, DQ challenge significantly decreased the hepatic mtDNA copy number (main effect of DQ); whereas dietary QG supplementation significantly increased it (main effect of QG).

Fig. 4.

Effect of QG on hepatic mtDNA content, ATP levels, MMP, and ROS production in broilers challenged with DQ. (A) Liver mtDNA copy number. (B) Liver ATP content. (C) Liver MMP. (D) Liver ROS level.

CON, control; DQ, diquat; D_QG, diquat+quercetagetin; QG, quercetagetin;

^a-c Different letters indicate significant differences between the mean values for a given behavior (P < 0.05).

As shown in Fig. 4B–D, DQ challenge significantly decreased ATP content and MMP, while significantly increasing ROS levels in broilers on day 42. In contrast, dietary QG supplementation had the opposite effect (P < 0.05). Significant DQ×QG interactions were also observed for ATP content, MMP, and ROS levels.

Effect of QG on hepatic antioxidant function and mitophagy-related markers

As shown in Fig. 5, DQ challenge significantly decreased hepatic SOD, CAT, and GPx activities in broilers and reduced the mRNA expression of GPx (main effect of DQ). Dietary QG supplementation significantly increased GPx activity and upregulated the mRNA expression of SOD and GPx (main effect of QG). In addition, a significant DQ×QG interaction was observed for GPx activity.

Fig. 5.

Effect of QG on liver antioxidant function and mitochondrial autophagy-related indicators in DQ-challenged broilers. (A) Liver antioxidant enzyme activities. (B) Gene expression of liver-related antioxidant enzymes. (C) Expression of genes related to liver mitophagy.

CON, control; DQ, diquat; D_QG, diquat+quercetagetin; QG, quercetagetin;

^a-c Different letters indicate significant differences between the mean values for a given behavior (P < 0.05).

Dietary QG supplementation significantly increased hepatic Parkin mRNA expression (main effect of QG). Significant DQ×QG interactions were detected for the expression of PINK1 and LC3-II. Specifically, DQ challenge increased the expression of PINK1 and LC3-II (P < 0.05); whereas dietary QG supplementation partially alleviated these changes in DQ-challenged broilers.

Effect of QG on cecal microbiota alpha diversity

Alpha diversity indices on day 42 are reported in Fig. 6. DQ challenge significantly decreased the cecal microbial Chao1 index, Shannon index, and OTUs in broilers (main effect of DQ). Dietary QG supplementation significantly increased the Shannon index (main effect of QG). A significant DQ×QG interaction was observed for the ACE index; whereby DQ challenge decreased the ACE index (P < 0.05) and QG supplementation partially alleviated this effect.

Fig. 6.

Effect of QG on cecal microbiota alpha diversity in DQ-challenged broilers.

(A) ACE index; (B) Chao1 index; (C) Shannon index; (D) Simpson index; (E) Venn diagram of OTUs.

CON, control; DQ, diquat; D_QG, diquat+quercetagetin; QG, quercetagetin;

^a-c Different letters indicate significant differences between the mean values for a given behavior (P < 0.05).

Effect of QG on the relative abundance of cecal microbiota

The composition of the cecal microbiota is shown in Fig. 7. At the phylum level (Fig. 7A, B), DQ challenge significantly increased the relative abundance of Firmicutes and decreased that of Bacteroidetes (main effect of DQ). At the genus level (Fig. 7C, D), DQ significantly increased the abundance of Lachnospiraceae_unclassified and decreased that of Alistipes (main effect of DQ). However, dietary QG supplementation had no significant effect on these parameters (main effect of QG, P > 0.05) and no significant DQ×QG interactions were observed (P > 0.05).

Fig. 7.

Effect of QG on the relative abundance of cecal microbiota in DQ-challenged broilers. (A, B) Phylum level; (C, D) genus level.

CON, control; DQ, diquat; D_QG, diquat+quercetagetin; QG, quercetagetin;

^a-c Different letters indicate significant differences between the mean values for a given behavior (P < 0.05).

Correlation between the cecal microbiota and physiological parameters in broilers

As shown in Fig. 8, at the phylum level, Firmicutes correlated positively with ROS (P < 0.05) and negatively with MMP and VH (P < 0.05). In contrast, Bacteroidetes correlated positively with MMP and VH (P < 0.05) and negatively with ROS (P < 0.05). At the genus level, Alistipes correlated positively with MMP and VH (P < 0.05) and negatively with ROS (P < 0.05). Lachnospiraceae_unclassified correlated negatively with ADG and MMP (P < 0.05), strongly negatively with VH (P < 0.01), and positively with ALT, AST, and ROS (P < 0.05 or P < 0.01). Additionally, Negativibacillus correlated negatively with MMP and positively with ROS (P < 0.05).

Fig. 8.

Correlation analysis of cecal microbiota with growth performance, serum biochemistry, intestinal health, and mitochondrial function in broilers (Pearson’s correlation analysis).

*P < 0.05; **P < 0.01.

Discussion

Oxidative stress poses a strong constraint on broiler growth performance, primarily because of excessive ROS production, which disrupts the cellular redox balance and metabolic homeostasis. Persistent oxidative pressure interferes with protein accretion and energy utilization, ultimately manifesting as reduced BW gain and impaired feed efficiency [12]. DQ promotes the continuous generation of ROS and has been extensively employed to induce oxidative stress models in poultry [13]. DQ challenge markedly decreases BW and ADG, while increasing F/G, which is closely associated with redox imbalance-induced tissue injury and metabolic dysfunction [14]. In the present study, DQ exposure significantly reduced BW and ADG in broilers on day 42. This reduction may be associated with metabolic disturbances and impaired nutrient utilization, further highlighting the adverse effects of oxidative stress on poultry production. In recent years, natural flavonoids have attracted considerable interest as nutritional interventions because of their antioxidant, anti-inflammatory, and metabolic regulatory properties. They improve growth performance under stress conditions by enhancing endogenous antioxidant defenses, such as SOD and GPx, while simultaneously attenuating pro-inflammatory signaling [15, 16]. QG, a structurally stable polymethoxylated flavonoid, exhibits strong free radical-scavenging activity and high antioxidant capacity. Liang et al. reported that dietary QG supplementation significantly enhanced apparent nutrient digestibility, crude protein, ether extract, and total phosphorus, and increased serum GPx activity, thereby improving the growth performance of broilers [17]. In line with these findings, our results demonstrate that QG supplementation effectively mitigated the growth-suppressive effects of DQ challenge. The observed improvements in BW, ADG, and F/G suggest that QG ensures growth and development under oxidative stress conditions, likely through attenuation of the oxidative burden, stabilization of metabolic processes, and allocation of energy toward growth.

The liver is a central metabolic organ and is the primary target of oxidative stress, making it particularly susceptible to excessive ROS accumulation. Oxidative injury to hepatocytes, especially when accompanied by mitochondrial structural and functional damage, can compromise hepatic energy metabolism and ultimately reduce whole-body metabolic capacity [18]. Our previous study demonstrated that DQ-induced oxidative stress led to pronounced mitochondrial dysfunction in the liver of broiler chickens, manifested as lower MMP, suppression of electron transport chain activity, and impaired ATP synthesis, eventually disrupting hepatic energy homeostasis [10]. Similar pathological features have been reported in other oxidative stress models. Qi et al. showed that paraquat exposure induced severe hepatic injury, including fibrosis, steatosis, and enhanced hepatocyte apoptosis, largely through excessive ROS production and activation of inflammatory signaling pathways such as NF-κB [19]. Consistent with these observations, the present study revealed that DQ challenge induced marked histopathological alterations in the broiler liver, including hepatocellular vacuolation, edema, and inflammatory cell infiltration. These structural abnormalities were accompanied by profound mitochondrial impairment, as evidenced by decreased activity of respiratory chain complexes I and V, reduced ATP production, diminished mtDNA copy number, and loss of MMP. Flavonoids exert hepatoprotective effects under oxidative stress by preserving mitochondrial function and enhancing antioxidant defense. Lin et al. reported that total flavonoids from rhododendron attenuated aflatoxin B1-induced oxidative damage and apoptosis in broiler hepatocytes by suppressing ROS accumulation, reinforcing antioxidant enzyme activity, stabilizing MMP, and preventing mitochondrial swelling and rupture [20]. Similarly, Xie et al. demonstrated that flavonoid-rich bamboo leaf extract promoted mitochondrial biogenesis, improved mitochondrial energy metabolism, and boosted antioxidant capacity in both intestinal and hepatic tissues, contributing to the maintenance of mtDNA stability [21]. Consistent with these reports, our findings indicate that dietary supplementation with QG markedly alleviated DQ-induced hepatic histopathological damage in broilers. QG supplementation significantly enhanced mitochondrial complex I activity, increased ATP production, and elevated the mtDNA copy number; while concurrently reducing mitochondrial ROS levels. These results suggested that QG effectively preserved mitochondrial integrity and bioenergetic function in the liver under oxidative stress, thereby mitigating DQ-induced metabolic disruption. Notably, QG supplementation significantly increased hepatic GPx activity and upregulated GPx gene expression in DQ-challenged broilers. Together, these results indicate that QG attenuates oxidative stress-induced hepatic injury through a dual mechanism involving both reinforced mitochondrial function and enhanced endogenous antioxidant capacity, ultimately contributing to the maintenance of hepatic metabolic stability.

Mitochondria are indispensable regulators of cellular metabolism, proliferation, and survival. Preserving mitochondrial quality is essential for maintaining cellular homeostasis. Mitophagy, a selective autophagic process responsible for the removal of dysfunctional mitochondria, is a central mechanism governing mitochondrial quality control. Among known regulatory pathways, PINK1/Parkin-mediated signaling coordinates the identification and clearance of damaged organelles [22]. Appropriate activation of this pathway limits excessive ROS accumulation, inhibits inflammatory signaling, and preserves mitochondrial integrity. Increasing evidence suggests that flavonoids modulate PINK1/Parkin-dependent mitophagy, thereby conferring protection against hepatic injury, metabolic dysregulation, and toxic stress in mammalian models [23, 24]. Using a mouse model of diabetic nephropathy, Liu et al. found that quercetin alleviated renal tubular epithelial cell senescence and ameliorated renal fibrosis by activating the SIRT1/PINK1/mitophagy axis, thereby revealing the mitochondrial quality control mechanism underlying the renoprotective effects of flavonoids [25]. Chen et al. demonstrated that dietary rutin attenuated the HS-induced decline in meat quality and antioxidant capacity of broilers, which may be related to inhibition of the AMPK/PINK1–Parkin signaling pathway to attenuate mitochondrial damage [26]. However, the regulatory role of this pathway in broiler chickens remains unknown. In the present study, QG supplementation reduced the hepatic mRNA expression of PINK1 and LC3-II in broilers subjected to oxidative stress, suggesting the potential involvement of mitophagy-related signaling in the protective effects of QG. A plausible explanation for these observations is that DQ-induced oxidative stress triggers MMP depolarization, leading to stabilization and accumulation of PINK1 on the outer mitochondrial membrane. This event may promote the recruitment of autophagic adaptor proteins such as p62, which subsequently interact with LC3 to initiate mitophagy-related responses. Although mitophagy is essential for mitochondrial turnover, sustained overactivation may exacerbate mitochondrial loss and impair cellular bioenergetics. Notably, the antioxidant properties of QG appear to attenuate this stress-induced signaling cascade, thereby helping maintain mitophagy quality control at a physiologically appropriate level, rather than completely inhibiting the process. Although species-specific differences in mitochondrial regulation and autophagy signaling may exist between mammals and avian species, evidence from mammalian studies may provide valuable mechanistic insights into oxidative stress-induced mitophagy responses. Sun et al. demonstrated that Cd exposure induced mitochondrial structural and functional damage in BALB/c mice and AML12 hepatocytes, along with upregulation of Drp1 and subsequent activation of the PINK1/Parkin pathway to enhance mitochondrial autophagy [27]. Unlike mammals, broilers exhibit distinct metabolic characteristics, including high basal body temperature, rapid growth rate, and unique hepatic lipid metabolism, which may influence the regulation and sensitivity of mitophagy-related pathways under oxidative stress conditions. Nevertheless, the conserved role of the PINK1/Parkin pathway in mitochondrial quality control across vertebrates suggests that certain regulatory responses to oxidative stress are partially shared between mammals and poultry. Together with these findings, our results suggest that PINK1/Parkin-related mitophagy signaling may be involved in stress-induced mitochondrial remodeling and that QG may contribute to maintaining mitochondrial homeostasis under oxidative stress in broilers. However, it should be noted that the present study evaluated only the mRNA expression of mitophagy-related genes, which does not directly reflect mitophagy activity at the protein level. Further protein-level validation and the use of autophagy inhibitors are required to clarify the precise regulatory role of QG in mitophagy.

The intestinal barrier not only governs nutrient digestion and absorption, but serves also as a major defensive interface that protects extraintestinal organs from pathogenic insults [28]. The liver is anatomically and functionally linked to the intestine via portal circulation, through which gut-derived nutrients, microbial metabolites, and endotoxins are directly delivered to the hepatic tissue. This connection highlights the pivotal role of intestinal barrier integrity in maintaining normal liver function. Disruption of the intestinal barrier facilitates the translocation of pathogenic bacteria and toxic metabolites into the blood, thereby increasing hepatic exposure to inflammatory stimuli and predisposing the liver to injury. Oxidative stress is widely recognized as a major contributor to intestinal barrier dysfunction. It markedly reduces VH, disrupts tight junction protein expression, and increases intestinal permeability in livestock, including pigs [29]. Compromised barrier function promotes the entry of endotoxins into the portal vein, where they activate hepatic Kupffer cells and initiate inflammatory cascades, ultimately exacerbating liver injury [3, 30]. In agreement with these observations, the present study demonstrates that intraperitoneal DQ administration significantly reduced VH and V/C, along with downregulation of the tight junction proteins Claudin-1 and ZO-1 in the ileum, indicating a substantial impairment of intestinal barrier integrity in broilers. Notably, dietary supplementation with QG markedly alleviated oxidative stress–induced intestinal damage, as evidenced by improved intestinal morphology and the restoration of tight junction protein expression. Preservation of intestinal barrier integrity limits the translocation of gut-derived inflammatory mediators, while simultaneously enhancing nutrient absorption efficiency. These improvements are likely to provide a more stable supply of metabolic substrates to the liver, thereby supporting hepatic mitochondrial energy production and antioxidant defense systems. Collectively, these findings suggest that the beneficial effects of QG on intestinal barrier function indirectly contribute to hepatic metabolic homeostasis via gut–liver axis communication, complementing its direct protective actions on hepatic mitochondria and antioxidant capacity.

The cecal microbiota is a central regulator of host physiology. It influences intestinal barrier function, nutrient utilization, immune signaling, and liver metabolism [31]. Consequently, microbial homeostasis constitutes a crucial component of the gut–liver axis. Oxidative stress disrupts epithelial integrity and reshapes the intestinal microbial ecosystem, leading to reduced microbial diversity, compositional imbalance, and increased delivery of microbial-derived products to the liver via portal circulation [32, 33]. In the present study, DQ challenge markedly reduced cecal microbial richness, as reflected by lower ACE, Chao1, and OTU indices, pointing to loss of microbial diversity upon oxidative stress. At the phylum level, DQ treatment increased the relative abundance of Firmicutes and decreased that of Bacteroidetes, a pattern commonly associated with metabolic disturbances and intestinal dysfunction. At the genus level, an increase in Lachnospiraceae_unclassified along with a decline in Alistipes further linked microbial dysbiosis with oxidative stress. Dietary QG partially reversed these effects. The D_QG group exhibited increased OTU richness and a reduced Simpson index, indicating recovery of microbial diversity. Moreover, QG supplementation promoted the enrichment of Alistipes while suppressing Negativibacillus. Alistipes has been associated with anti-inflammatory activity, maintenance of epithelial integrity, and the production of beneficial metabolites; whereas the excessive proliferation of Negativibacillus has been linked to intestinal dysfunction and inflammatory responses [34, 35]. Collectively, these microbial shifts suggest that QG contributes to the restoration of microbial homeostasis under oxidative stress. The restored microbial balance may further enhance intestinal barrier integrity, reduce endotoxin translocation, and alleviate the hepatic inflammatory burden. Therefore, modulation of the cecal microbiota likely represents an additional mechanism through which QG exerts systemic protective effects along the gut–liver axis.

The microbial shifts induced by DQ challenge further highlight the functional relevance of cecal dysbiosis in oxidative stress-related injury. Reduced microbial diversity has previously been associated with an increased susceptibility to intestinal inflammation and mitochondrial dysfunction [36], suggesting that the microbial imbalance observed in this study may have contributed to systemic metabolic disturbances. Correlation analyses provided additional insights into the potential functional significance of specific microbial taxa. The increased abundance of Firmicutes in DQ-challenged broilers was strongly associated with elevated ROS levels and was inversely related to MMP and VH. Accordingly, expansion of this phylum may aggravate oxidative injury and compromise intestinal integrity. In contrast, Bacteroidetes was positively associated with mitochondrial function and intestinal morphology, and negatively associated with ROS accumulation. This observation is consistent with the recognized role of Bacteroidetes in producing short-chain fatty acids, which serve as key regulators of energy metabolism, epithelial renewal, and antioxidant defense [37]. At the genus level, enrichment of Lachnospiraceae_unclassified under DQ challenge was closely linked to impaired growth performance, disrupted intestinal morphology, and increased hepatic injury markers. The positive association of this taxon with ROS and liver enzymes further supports its potential involvement in inflammation-related metabolic dysfunction, in agreement with recent reports connecting members of Lachnospiraceae to oxidative stress and liver injury [38]. Conversely, Alistipes exhibited beneficial associations with mitochondrial function and intestinal structure while showing an inverse relationship with oxidative stress markers. These findings are consistent with those of previous studies, indicating that Alistipes contributes to anti-inflammatory activity and epithelial protection [39]. Negativibacillus, which was enriched under oxidative stress conditions, showed correlations consistent with impaired mitochondrial function and increased oxidative burden, and has recently been linked to mucosal damage and endotoxin production [40]. Collectively, these results indicate that DQ-induced microbial dysbiosis is closely associated with mitochondrial dysfunction, intestinal barrier impairment, and hepatic injury. Therefore, maintaining a balanced cecal microbiota appears essential for preserving gut–liver axis homeostasis under oxidative stress.

Conclusion

This study demonstrates that dietary QG effectively alleviates DQ-induced oxidative stress in broilers through the coordinated regulation of hepatic mitochondrial function, mitophagy, and the gut–liver axis. QG may contribute to the maintenance of mitochondrial homeostasis by modulating PINK1/Parkin-related mitophagy signaling, enhancing antioxidant capacity, and mitigating hepatic oxidative injury. Meanwhile, QG improved intestinal barrier integrity and reshaped cecal microbiota, which may lower any gut-derived oxidative and inflammatory stimuli that reach the liver (Fig. 9). Collectively, these findings establish a mechanistic link between dietary flavonoids, mitochondrial quality control, and gut–liver axis regulation, highlighting QG as a promising nutritional supplement for enhancing oxidative stress resilience and supporting sustainable broiler production.

Fig. 9.

Proposed mechanism by which QG improves gut–liver axis function and cecal microbiota in broilers through PINK1/Parkin-mediated mitophagy during DQ-induced oxidative stress. QG may modulate PINK1/Parkin-related mitophagy signaling, restore mitochondrial function, and reduce ROS accumulation. Improved mitochondrial quality contributes to enhanced gut barrier integrity and increases hepatic antioxidant capacity. QG helps stabilize the cecal microbiota, thereby supporting overall gut–liver axis homeostasis.

Ethics Approval

All experimental procedures were reviewed and approved by the Animal Care and Use Committee of Hebei University of Engineering (Handan, China). This study was conducted in accordance with the institutional guidelines for the Care and Use of Animals (approval no. BER-YXY-2025013).

Funding

This work was supported by the Science Research Project of the Hebei Education Department (Grant No. QN2024100).

Acknowledgments

We express our sincere gratitude for the financial assistance that enabled us to conduct this study. We also extend our appreciation to our laboratory colleagues for their invaluable assistance, which contributed significantly to this study.

Author Contributions

Conceptualization: Yang and Huo; Data curation: Sun MX; Formal analysis: Huo M; Methodology: Yang S; Software: Qu WY; Writing of the original draft: Huo M; Writing, reviewing, and editing: Yang S.

Conflict of Interest

The authors declare no conflicts of interest associated with this study. All authors confirm that the research was conducted in the absence of any commercial or financial relationships that could be construed as potential conflicts of interest.

Declaration of AI and AI-assisted Technologies

AI tools were not used in this study.

Data Availability Statement

The data are available from the corresponding author upon request. The RNA sequencing data were uploaded to the National Center for Biotechnology Information (accession number PRJNA1413516).

References

• [1]  Chen Z, Xing T, Li J, Zhang L, Jiang Y andGao F. Oxidative stress impairs the meat quality of broiler by damaging mitochondrial function, affecting calcium metabolism and leading to ferroptosis. Anim Biosci, 35: 1616–1627. 2022. PMID:35507847, https://doi.org/10.5713/ab.22.0019
• [2]  Zou Y, Zhang S, Yang J, Qin C, Jin B, Liang Z, Yang S, Li L andLong M. Protective effects of astaxanthin on ochratoxin a-induced liver injury: effects of endoplasmic reticulum stress and mitochondrial fission-fusion balance. Toxins (Basel), 16: 68. 2024. PMID:38393146, https://doi.org/10.3390/toxins16020068
• [3]  Pabst O, Hornef MW, Schaap FG, Cerovic V, Clavel T andBruns T. Gut–liver axis: barriers and functional circuits. Nat Rev Gastroenterol Hepatol, 20: 447–461. 2023. PMID:37085614, https://doi.org/10.1038/s41575-023-00771-6
• [4]  Zhou G, Fu Y, Chen J, Yang W, Jiao N, Jiang S, Yuan X andLi Y. Alleviating effects of dietary formic acid polymer supplementation on lipopolysaccharide-induced inflammatory injury in gut-liver axis of broilers. Poult Sci, 104: 104698. 2025. PMID:39721259, https://doi.org/10.1016/j.psj.2024.104698
• [5]  Cao S, Xiao H, Li X, Zhu J, Gao J, Wang L andHu C. AMPK-PINK1/Parkin mediated mitophagy is necessary for alleviating oxidative stress-induced intestinal epithelial barrier damage and mitochondrial energy metabolism dysfunction in IPEC-J2. Antioxidants, 10: 2010. 2021. PMID:34943113, https://doi.org/10.3390/antiox10122010
• [6]  Ma Z, Zhang D, Sun J, Zhang Q, Qiao Y, Zhu Y, Niu J, Ren Q, Zhou L, Wen A andWang J. Formononetin inhibits hepatic I/R-induced injury through regulating PHB2/PINK1/Parkin pathway. Oxid Med Cell Longev, 2022: 6481192. 2022. PMID:36506934, https://doi.org/10.1155/2022/6481192
• [7]  Hu B, Li J, Gong D, Dai Y, Wang P, Wan L andXu S. Long-term consumption of food-derived chlorogenic acid protects mice against acetaminophen-induced hepatotoxicity via promoting PINK1-dependent mitophagy and inhibiting apoptosis. Toxics, 10: 665. 2022. PMID:36355956, https://doi.org/10.3390/toxics10110665
• [8]  Wu F, Wang H, Li S, Wei Z, Han S andChen B. Effects of dietary supplementation with quercetagetin on nutrient digestibility, intestinal morphology, immunity, and antioxidant capacity of broilers. Front Vet Sci, 9: 1060140. 2022. PMID:36619942, https://doi.org/10.3389/fvets.2022.1060140
• [9]  Yang S, Su Z, Huo M, Zhong C, Wang F, Zhang Y, Song Y andShi Y. Effect of supplementation of quercetagetin on the antioxidant function, liver mitochondrial function and gut microbiota of broilers at high stocking density. Animals, 15: 398. 2025. PMID:39943168, https://doi.org/10.3390/ani15030398
• [10]  Yang S, Huo M, Su Z, Wang F, Zhang Y, Zhong C andShi Y. The impact of dietary supplementation of quercetagetin on growth, antioxidant capacity, and gut microbiota of diquat-challenged broilers. Front Microbiol, 15: 1453145. 2024. PMID:39539705, https://doi.org/10.3389/fmicb.2024.1453145
• [11]  Hakamata Y, Watanabe K, Amo T, Toyomizu M andKikusato M. Characterization of mitochondrial content and respiratory capacities of broiler chicken skeletal muscles with different muscle fiber compositions. J Poult Sci, 55: 210–216. 2018. PMID:32055177, https://doi.org/10.2141/jpsa.0170141
• [12]  Zha P, Wei L, Liu W, Chen Y andZhou Y. Effects of dietary supplementation with chlorogenic acid on growth performance, antioxidant capacity, and hepatic inflammation in broiler chickens subjected to diquat-induced oxidative stress. Poult Sci, 102: 102479. 2023. PMID:36669355, https://doi.org/10.1016/j.psj.2023.102479
• [13]  Duan J, Song Y, Zhang X andWang C. Effect of ω-3 polyunsaturated fatty acids-derived bioactive lipids on metabolic disorders. Front Physiol, 12: 646491. 2021. PMID:34113260, https://doi.org/10.3389/fphys.2021.646491
• [14]  Chen Y, Chen Y, Zhang H andWang T. Pterostilbene as a protective antioxidant attenuates diquat-induced liver injury and oxidative stress in 21-day-old broiler chickens. Poult Sci, 99: 3158–3167. 2020. PMID:32475452, https://doi.org/10.1016/j.psj.2020.01.021
• [15]  Wang M, He Z, Xiong Z, Liu H, Zhou X andHe J. Supplementation with grape seed extract, onion peel extract, or rosemary extract in the diet alleviates growth inhibition, liver damage, and oxidative stress induced by diquat in Lohmann chicks. Anim Biotechnol, 34: 5067–5074. 2023. PMID:37878368, https://doi.org/10.1080/10495398.2023.2271532
• [16]  Shi L, Jin X, Xu Y, Xing Y, Yan S, Guo Y, Cheng Y andShi B. Effects of total flavonoids of Artemisia ordosica on growth performance, oxidative stress, and antioxidant status of lipopolysaccharide-challenged Broilers. Antioxidants, 11: 1985. 2022. PMID:36290707, https://doi.org/10.3390/antiox11101985
• [17]  Liang H, Fan D, Hu W, Wu F, Tan K, Zhao P, Han S andChen B. Effects of quercetagetin on the growth performance, nutrient digestibility, slaughter performance, meat quality, and antioxidant capacity of broiler chickens. Anim Sci J, 95: e70008. 2024. PMID:39552132, https://doi.org/10.1111/asj.70008
• [18]  Allameh A, Niayesh-Mehr R, Aliarab A, Sebastiani G andPantopoulos K. Oxidative stress in liver pathophysiology and disease. Antioxidants, 12: 1653. 2023. PMID:37759956, https://doi.org/10.3390/antiox12091653
• [19]  Qi M, Wang N, Xiao Y, Deng Y, Zha A, Tan B, Wang J, Yin Y andLiao P. Ellagic acid ameliorates paraquat-induced liver injury associated with improved gut microbial profile. Environ Pollut, 293: 118572. 2022. PMID:34838710, https://doi.org/10.1016/j.envpol.2021.118572
• [20]  Lin L, Fu P, Chen N, Gao N, Cao Q, Yue K, Xu T, Zhang C, Zhang C, Liu F, Wang X andHuang S. Total flavonoids of Rhizoma Drynariae protect hepatocytes against aflatoxin B1-induced oxidative stress and apoptosis in broiler chickens. Ecotoxicol Environ Saf, 230: 113148. 2022. PMID:34995912, https://doi.org/10.1016/j.ecoenv.2021.113148
• [21]  Xie Z, Yu G, Yun Y, Zhang X, Shen M, Jia M, Li A, Zhang H, Wang T, Zhang J andZhang L. Effects of bamboo leaf extract on energy metabolism, antioxidant capacity, and biogenesis of small intestine mitochondria in broilers. J Anim Sci, 101: skac391. 2023. PMID:36440554, https://doi.org/10.1093/jas/skac391
• [22]  Li R, Wang Z, Wang Y, Sun R, Zou B, Tian X, Liu D, Zhao X, Zhou J, Zhao Y andYao J. SIRT3 regulates mitophagy in liver fibrosis through deacetylation of PINK1/NIPSNAP1. J Cell Physiol, 238: 2090–2102. 2023. PMID:37417912, https://doi.org/10.1002/jcp.31069
• [23]  Liu P, Lin H, Xu Y, Zhou F, Wang J, Liu J, Zhu X, Guo X, Tang Y andYao P. Frataxin-mediated PINK1-Parkin-dependent mitophagy in hepatic steatosis: the protective effects of quercetin. Mol Nutr Food Res, 62: 1800164. 2018. PMID:29935106, https://doi.org/10.1002/mnfr.201800164
• [24]  Williams JA andDing WX. Targeting Pink1-Parkin-mediated mitophagy for treating liver injury. Pharmacol Res, 102: 264–269. 2015. PMID:26655101, https://doi.org/10.1016/j.phrs.2015.09.020
• [25]  Liu T, Yang Q, Zhang X, Qin R, Shan W, Zhang H andChen X. Quercetin alleviates kidney fibrosis by reducing renal tubular epithelial cell senescence through the SIRT1/PINK1/mitophagy axis. Life Sci, 257: 118116. 2020. PMID:32702447, https://doi.org/10.1016/j.lfs.2020.118116
• [26]  Chen S, Liu H, Zhang J, Zhou B, He X, Wang T andWang C. Dietary rutin improves breast meat quality in heat‐stressed broilers and protects mitochondria from oxidative attack via the AMPK / PINK1–PARKIN pathway. J Sci Food Agric, 103: 2367–2377. 2023. PMID:36606563, https://doi.org/10.1002/jsfa.12431
• [27]  Sun J, Yu F, Wang T, Bian J, Liu Z andZou H. The role of DRP1- PINK1-Parkin-mediated mitophagy in early cadmium-induced liver damage. Toxicology, 466: 153082. 2022. PMID:34952138, https://doi.org/10.1016/j.tox.2021.153082
• [28]  Zhu W, Zhou Y, Tsao R, Dong H andZhang H. Amelioratory effect of resistant starch on non-alcoholic fatty liver disease via the gut-liver axis. Front Nutr, 9: 861854. 2022. PMID:35662935, https://doi.org/10.3389/fnut.2022.861854
• [29]  Da Silva EO, Gerez JR, Hohmann MSN, Verri WA, Jr andBracarense APFRL. Phytic acid decreases oxidative stress and intestinal lesions induced by fumonisin B1 and deoxynivalenol in intestinal explants of pigs. Toxins, 11: 18. 2019. PMID:30621150, https://doi.org/10.3390/toxins11010018
• [30]  Martin-Grau M andMonleón D. The role of microbiota-related co-metabolites in MASLD progression: a narrative review. Curr Issues Mol Biol, 46: 6377–6389. 2024. PMID:39057023, https://doi.org/10.3390/cimb46070381
• [31]  Sun L, Jia H, Li J, Yu M, Yang Y, Tian D, Zhang H andZou Z. Cecal gut microbiota and metabolites might contribute to the severity of acute myocardial ischemia by impacting the intestinal permeability, oxidative stress, and energy metabolism. Front Microbiol, 10: 1745. 2019. PMID:31428065, https://doi.org/10.3389/fmicb.2019.01745
• [32]  Marcolla CS, Ju T, Lantz HL andWilling BP. Investigating the cecal microbiota of broilers raised in extensive and intensive production systems. Microbiol Spectr, 11: e02352-23. 2023. PMID:37754552, https://doi.org/10.1128/spectrum.02352-23
• [33]  Fuerniss LK, Kreikemeier KK, Reed LD, Cravey MD andJohnson BJ. Cecal microbiota of feedlot cattle fed a four-species Bacillus supplement. J Anim Sci, 100: skac258. 2022. PMID:35953238, https://doi.org/10.1093/jas/skac258
• [34]Zhang SW, Wang RS, Zhao RQ, Lu Y, Xu MC, Lin XY, Lan RT, Zhang SP, Tang HJ, Fan QH, Yang J, Liu LY, and Xu JG. Alistipes putredinis ameliorates metabolic dysfunction-associated steatotic liver disease in rats via gut microbiota remodeling and inflammatory suppression. Nutrients, 17:17122013.2025.
• [35]  Wang J, Liu S, Ma J, Dong X, Long S andPiao X. Growth performance, serum parameters, inflammatory responses, intestinal morphology and microbiota of weaned piglets fed 18% crude protein diets with different ratios of standardized ileal digestible isoleucine to lysine. Anim Nutr, 16: 313–325. 2024. PMID:38362516, https://doi.org/10.1016/j.aninu.2023.11.008
• [36]  Feng S, Liu Y, Xu J, Fan J, Li J, Wu Z, Sun Y andXiong W. Three strains of lactobacillus derived from piglets alleviated intestinal oxidative stress induced by diquat through extracellular vesicles. Nutrients, 15: 4198. 2023. PMID:37836484, https://doi.org/10.3390/nu15194198
• [37]  Peng L, Li ZR, Green RS, Holzmanr IR andLin J. Butyrate enhances the intestinal barrier by facilitating tight junction assembly via activation of AMP-activated protein kinase in Caco-2 cell monolayers. J Nutr, 139: 1619–1625. 2009. PMID:19625695, https://doi.org/10.3945/jn.109.104638
• [38]  Zhou W, Wu W, Si Z, Liu H, Wang H, Jiang H, Liu Y, Alolga RN, Chen C, Liu S, Bian X, Shan J, Li J, Tan N andZhang Z. The gut microbe Bacteroides fragilis ameliorates renal fibrosis in mice. Nat Commun, 13: 6081. 2022. PMID:36241632, https://doi.org/10.1038/s41467-022-33824-6
• [39]  Xu C, Qiao L, Ma L, Guo Y, Dou X, Yan S, Zhang B andRomán A. Biogenic selenium nanoparticles synthesized by Lactobacillus casei ATCC 393 alleviate intestinal epithelial barrier dysfunction caused by oxidative stress via Nrf2 signaling-mediated mitochondrial pathway. Int J Nanomedicine, 14: 4491–4502. 2019. PMID:31417254, https://doi.org/10.2147/IJN.S199193
• [40]  Song D, Zhang S, Chen A, Song Z andShi S. Comparison of the effects of chlorogenic acid isomers and their compounds on alleviating oxidative stress injury in broilers. Poult Sci, 103: 103649. 2024. PMID:38552567, https://doi.org/10.1016/j.psj.2024.103649