The Journal of Toxicological Sciences
Online ISSN : 1880-3989
Print ISSN : 0388-1350
ISSN-L : 0388-1350
Original Article
Alterations of NMDA and AMPA receptors and their signaling apparatus in the hippocampus of mouse offspring induced by developmental arsenite exposure
Fenghong ZhaoZijiang WangYingjun LiaoGaoyang WangYaping Jin
Author information
JOURNALS FREE ACCESS FULL-TEXT HTML

2019 Volume 44 Issue 11 Pages 777-788

Details
Abstract

Loss of cognitive function due to arsenic exposure is a serious health concern in many parts of the world, including China. The present study aims to determine the molecular mechanism of arsenic-induced neurotoxicity and its consequent effect on downstream signaling pathways of mouse N-methyl-D-aspartate receptors (NMDARs) and α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors (AMPARs). Drinking water containing 0, 25, 50 or 100 mg/L arsenite was provided each day to mother mice throughout gestation period until postnatal day (PND) 35 to expose the newborn mice to arsenite during early developmental period. The effect of arsenite in the expressions of different components of NMDAR (NR1, NR2A, NR2B) and AMPAR (GluR1, GluR2, GluR3), including calcium/calmodulin-dependent protein kinase II (CaMKII) and phosphorylated-CaMKII (p-CaMKII), at PND 7, 14, 21 and 35 was estimated and analyzed from the hippocampus of mice. A significant inhibition in the protein and mRNA expressions of NR1, NR2A, NR2B and GluR1 was observed in mice exposed to 50 mg/L arsenite since PND 7. Down regulation of GluR2 and GluR3 both at mRNA and protein levels was observed in mice exposed to 50 mg/L arsenite till PND 14. Moreover, both CaMKII as well as p-CaMKII expressions were significantly limited since PND 7 in 50 mg/L arsenite exposed mice group. Findings form this study suggested that the previously reported impairment in learning and memorizing abilities in later stage due to early life arsenite exposure is associated with the alterations of NMDARs, AMPARs, CaMKII and p-CaMKII expressions.

INTRODUCTION

Arsenic contamination of underground water is a serious environmental and health concern in different parts of the world (Smith et al., 2011). Chronic exposure to inorganic arsenic (iAs) is linked to different cardiovascular, neuronal and skin diseases (McClintock et al., 2014; Rocha et al., 2011). A large number of investigations have demonstrated that long-term exposure to iAs via drinking water may lead to cognitive dysfunctions along with impaired learning and communication abilities (Rodríguez-Barranco et al., 2013; Wasserman et al., 2014). Despite several investigations on arsenic exposure, the mechanistic aspects of iAs-induced neurotoxicity have not been fully elucidated.

It is well known that hippocampus is a key brain structure involved in learning and memory. Long-term potentiation (LTP) is the key cellular phenomena of the hippocampus that requires durable increase in synaptic efficacy for acquiring fresh memories. Accumulating evidence has demonstrated that arsenite and its metabolites modulates the LTP threshold for expression in animal models (Krüger et al., 2009). It has been accepted that the activities of α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors (AMPARs) and the N-methyl-D-aspartate receptors (NMDARs) in the hippocampus are crucial for the expression of LTP. The AMPAR is a heterotetramer of GluR1, 2, 3 and 4 in different combinations, and is a key mediator for fast transmission of excitatory synapses (Kumar and Mayer, 2013). Despite several possible combinations, AMPARs are primarily composed of ionotropic glutamate receptor subunits GluR1/2 or GluR2/3 in the hippocampus (Hanley, 2010). Like AMPAR, the NMDAR is also a heterotetrameric constituent of NR1, NR2 (NR2A-D) and NR3 (NR3A and NR3B) subtypes. NR1 is the obligate subunit and along with combination of either NR2A or NR2B or both, they form the most common types of NMDARs (Kaniakova et al., 2012). The cellular and physiological properties of neurons are dependent upon the subunit composition. NR1 and NR2 assembled NMDARs indicate high permeability to Ca2+, while AMPARs represent neurons with regulated Ca2+ permeability (Jonas et al., 1994). GluR2 assembled AMPARs are known to restrict influx of Ca2+ while those assembled with GluR1 and GluR3 are known to allow Ca2+ permeability.

1-2% of the total proteins in the brain comprise of a Ca2+-activated enzyme- calcium/ calmodulin dependent protein kinase II (CaMKII) and is a major component postsynaptic density (PSD) protein fractions. It has been accepted that persistent activation of CaMKII by NMDARs is crucial for LTP expression (Lisman et al., 2002). Moreover, activated CaMKII can phosphorylate a number of synaptic proteins, including AMPARs, nitric oxide synthase, that contribute to improved synaptic functions for cognitive and learning abilities (Kristensen et al., 2011; Sanhueza et al., 2011).

Our previous study found that developmental arsenite exposure lead to impaired spatial learning and memory abilities in mice (Zhao et al., 2017). Since NMDARs, AMPARs, CaMKII and phosphorylated-CaMKII (p-CaMKII) play important role in neuronal functions of cognitive and intellectual abilities, we hypothesized that developmental arsenite exposure might induce cognitive deficits with altered expression of NMDAR subunits, AMPAR subunits, CaMKII and p-CaMKII in the hippocampus of offspring mice.

MATERIALS AND METHODS

Scientific Research Committee of China Medical University approved the studies on mice. All the experiments involving animals were carried out following the guidelines of Chinese National Guidelines for the Care and Use of Laboratory animal.

Animals

Kunming albino mice used for the study weighed 25 ± 2 g and were procured from the animal laboratory of China Medical University. The mice were housed in plastic cages at ambient conditions of 20 ± 2°C, 50-60% humidity with abundant food and water and beddings of wood shavings. A 12-hr alternating light and dark cycle was also maintained for the mice.

Experimental procedures

The mice were allowed to acclimatize for 1 week, following which they were allowed to mate, with one male and two females placed in each cage. Pregnant mice were distributed in 4 groups of 6 having access to either 0 or 25 or 50 or 100 mg/L freshly dissolved (less than 24 hr) sodium arsenite (NaAsO2) containing drinking water. The protocol for arsenite exposure was continued throughout the gestation and lactation period. Postnatal day (PND) was counted with the initiation of birth days. On PND 21, the pups were housed separately in colony room and were also provided with arsenic dissolved drinking water as prescribed for their mothers.

On PND 7, 14, 21 and 35, a set of 6 pups from separate litters per group were sacrificed to collect hippocampal tissues which were stored in −80°C until use. On the mentioned PNDs, a set of 3 pups from separate litters per group were used for immunofluorescence.

Reagents

Sodium arsenite (NaAsO2, ≥ 99.0%) was purchased from the Shanghai Chemical, Shanghai, China. The primary antibodies against NR1 (goat anti-mouse), NR2A (goat anti-mouse), NR2B (goat anti-mouse) and CaMKII (rabbit anti-mouse) were obtained from Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA; p-CaMKII (rabbit anti-mouse) was purchased from Millipore, Hayward, CA, USA; GluR1 (rabbit anti-mouse), GluR2 (rabbit anti-mouse) and GluR3 (rabbit anti-mouse) were purchased from Abcam, Inc., Cambridge, MA, USA. BCA protein assay kit was the product of Thermo Fisher Scientific, Waltham, MA, USA. Goat serum, horseradish peroxidase and goat anti-rabbit fluorescein isothiocyanate (FITC) conjugated secondary antibody were purchased from Zhongshan Goldbridge Biotechnology in Beijing, China. Donkey serum and donkey anti-goat FITC conjugated secondary antibody were purchased from Jackson ImmunoResearch, West Grove, PA, USA. Hoechst 33258 was purchased from Sigma-Aldrich, Allentown, PA, USA. Trizol Reagent, SYBR Premix Ex Taq II, and PrimeScript RT reagent kit were purchased from Takara, Shiga, Japan. Enhanced chemiluminescence (ECL) plus kit was obtained from Amersham Life Science, Buckinghamshire, UK.

All reagents used in the present study were of analytical grade, and acids were of specific grade for pollutant metal analysis. All glasses and plastic wares were washed with detergent and acid, and rinsed with redistilled water to be free of metal leaching. Water used in this study was doubly distilled.

Immunofluorescence observation

0.02% heparin containing 0.9% saline was perfused though the heart of mice and then with 4% paraformaldehyde. After that, brain tissues were quickly fixed with 4% paraformaldehyde solution overnight and embedded in paraffin. Then, 4 μm thick hippocampal slices were made, rehydrated and labeled with primary antibodies against NR1 (1:100), NR2A (1:100), NR2B (1:100), GluR1 (1:100), GluR2 (1:100) or GluR3 (1:100) overnight at 4°C, and incubated with secondary antibodies for 30 min at 37°C. Hoechst 33258 was also used for staining of the cell nuclei and the fluorescent images were captured using an Olympus BX50 microscope.

Western blot

The hippocampal tissue lysates were made by homogenization and centrifugation at 12,000 × g for 20 min at 4°C and the concentration of proteins were estimated by using BCA protein assay kit. 30 μg proteins from each sample lysates were electrophoretically resolved on 7% SDS-PAGE and transferred to PVDF membranes. After blocking, the membranes were treated with primary antibodies against NR1 (1:1000), NR2A (1:1000), NR2B (1:1000), GluR1 (1:1000), GluR2 (1:1000), GluR3 (1:1000), CaMKII (1:800), p-CaMKII (1:800) and β-actin (1:2000) overnight at 4°C and after washing treated with respective secondary antibodies. Chemiluminescence was used for detection of specific protein bands and densitometric analysis was carried out using Gel-Pro analyzer v4.0. And β-actin band was considered as reference band for quantitative analysis and normalization.

Real-time RT-PCR

Trizol extraction method was used to isolate total RNA which were then reverse transcribed to cDNA by using PrimeScript RT reagent kit (Takara). PCR amplification of NR1, NR2A, NR2B, GluR1, GluR2, GluR3 and GAPDH cDNA templates were probed by using SYBR Premix Ex Taq II (Takara). The details of primers are provided in Table 1. The conditions used for PCR amplification cycle were at 95°C for 5 sec and 60°C for 34 sec repeated 40 times. Fold changes in gene specific mRNA expression were denoted as 2–ΔΔCt normalized against Ct values of GAPDH (reference gene).

Table 1. Primers used for real-time RT-PCR.
Gene Primer (5’-3’) Product (bp)
NR1 CACAGAAGTGCGATCTGGTGAC
GGCATTGCTGCGGGAGT
191
NR2A CTCTGATAATCCTTTCCTCCAC
GACCGAAGATAGCTGTCATTTACT
123
NR2B TCCATCAGCAGAGGTATCTACAG
CCGTTGACTCCAGACAGGTT
161
GluR1 TATCATCTCCTCATACACAGCCA
GTCCACATCTTCTCAAACACAGC
183
GluR2 TTACCCTCATCATCATCTCCTC
TCCACATTTTATCAAACACTGC
192
GluR3 AGAACCTCGTGACCCACAA
GAAGAACCACCAAACCCCT
157
GAPDH CAATGTGTCCGTCGTGGATCT
GTCCTCAGTGTAGCCCAAGATG
124

Statistical Analysis

SPSS for Windows, version 16.0 (SPSS Inc., Chicago, IL, USA) data analysis software was used. Data are represented as mean ± standard deviation (SD) and one-way ANOVA with post hoc Student-Newman-Keuls test (SNK) was used to determine difference between the groups considering P < 0.05 as significant.

RESULTS

General health of mice during experimental period

As described in our previous study (Zhao et al., 2017), no poisoning symptoms in both the mother mice and their pups were observed during experimental period. Furthermore, the body weights of the pups in all the groups increased along with the number of postnatal days. However, those of PND 14, 21 and 35 mice decreased significantly and dose dependently.

In the Morris water maze, the spatial learning ability may have been significantly impaired by 25 mg/L arsenite exposure from the third day (data not shown).

Developmental arsenite exposure induced alteration in the expression of NMDARs

Developmental arsenite exposure induced alteration in the expression of NR1

Effects of developmental arsenite exposure on NR1 protein and mRNA expressions in the hippocampus at different developmental stages are shown in Figs. 1 and 2. As shown in Fig. 1, the immunoreactivities to NR1 in arsenite exposure groups decreased dose dependently as compared to each control group. Consistent with the results of immunofluorescence staining, expression of NR1 at transcriptional as well as translational level in 50 and 100 mg/L arsenite exposed mice was also significantly lower than the age-matched control and 25 mg/L arsenite exposed groups (Fig. 2). Of which, levels of NR1 protein in 100 mg/L arsenite exposed mice decreased approximately 19.8%, 31.1%, 46.0% and 33.3% at different developmental stages, respectively. In addition, those of 100 mg/L arsenite exposed mice were also significantly lower than 50 mg/L arsenite exposed mice at the same age. And those of 25 mg/L arsenite exposed mice also decreased significantly as compared to the control groups on PND 21 and 35 (Figs. 2A and 2B). Furthermore, except for PND 7 mice in 25 mg/L arsenite exposed group, mRNA levels of NR1 in all the arsenite exposed groups decreased obviously as compared to the control group at the same age during different developmental stages (Fig. 2C).

Fig. 1

Comparison of NR1 (green) protein expression in the hippocampal CA1 region among groups at early developmental stages. Notes: PND postnatal day. The micrographs were the representative results of three independent experiments and captured with Olympus BX50 microscope (× 400). Scale bar = 50 μm.

Fig. 2

Changes in the expression of NR1 induced by developmental arsenite exposure. Notes: Mice were sacrificed on PND 7, 14, 21, and 35, and their hippocampal tissues were immediately dissected out. Total proteins (30 μg /lane) in the hippocampus were separated by SDS-PAGE, transferred to PVDF membranes and immunoblotted for NR1. (A) Western blot analysis. Images were the representative results of six separate experiments for each group. (B) Densitometric analysis of western blots. The relative intensity in arbitrary units compared to β-actin. (C) Quantitation of mRNA by real-time RT-PCR. Gene expression was normalized to GAPDH and presented as fold change vs the control group. Data were expressed as mean ± SD, n = 6. Significant difference was defined as p < 0.05, * vs control group, # vs 25 mg/L arsenite exposed group, and + vs 50 mg/L arsenite exposed group.

Developmental arsenite exposure induced alteration in the expression of NR2A

Figures 3 and 4 illustrate the effects of developmental arsenite exposure on NR2A protein and mRNA expressions in the hippocampus at the early developmental stages. Representative micrographs in Fig. 3 showed the immunoreactivities to NR2A in all the groups. The fluorescence intensities in arsenite exposure groups decreased apparently as compared to each control group. Likewise, as shown in Fig. 4, both protein and mRNA levels of NR2A in 50 and 100 mg/L arsenite exposed groups were also decreased significantly than the other groups. Especially, compared to those in the control, the protein levels of NR2A in 100 mg/L arsenite exposed groups decreased approximately 24.0%, 33.0%, 39.6% and 28.6%, respectively. On the other hand, those of 100 mg/L arsenite exposed groups decreased obviously as compared to 50 mg/L arsenite exposed groups at the same age. Moreover, both protein and mRNA levels of NR2A in 25 mg/L arsenite exposed groups also decreased apparently as compared to each control group at the same age.

Fig. 3

Comparison of NR2A (green) protein expression in the hippocampal CA1 region among groups at early developmental stages. Notes: PND postnatal day. The micrographs were the representative results of three independent experiments and captured with Olympus BX50 microscope (× 400). Scale bar = 50 μm.

Fig. 4

Changes in the expression of NR2A induced by developmental arsenite exposure. Notes: Mice were sacrificed on PND 7, 14, 21, and 35, and their hippocampal tissues were immediately dissected out. Total proteins (30 μg /lane) in the hippocampus were separated by SDS-PAGE, transferred to PVDF membranes and immunoblotted for NR2A. (A) Western blot analysis. Images were the representative results of six separate experiments for each group. (B) Densitometric analysis of western blots. The relative intensity in arbitrary units compared to β-actin. (C) Quantitation of mRNA by real-time RT-PCR. Gene expression was normalized to GAPDH and presented as fold change vs the control group. Data were expressed as mean ± SD, n = 6. Significant difference was defined as p < 0.05, * vs control group, # vs 25 mg/L arsenite exposed group, and + vs 50 mg/L arsenite exposed group.

Developmental arsenite exposure induced alteration in the expression of NR2B

The alterations of protein and mRNA levels of NR2B in all the groups are shown in Figs. 5 and 6. The fluorescence intensities of NR2B in arsenite exposure groups decreased along with increased exposure dose (shown in Fig. 5). In this study, both protein and mRNA levels of NR2B in 50 and 100 mg/L arsenite exposed groups decreased remarkably as compared to the other groups, which were similarly with the above results of immunoreactivity. (Fig. 6). Particularly, levels of NR2B protein in 100 mg/L arsenite exposed groups decreased approximately 19.4%, 22.8%, 36.1% and 39.2% at the same age, respectively. Moreover, there were also significant differences between 50 and 100 mg/L arsenite exposed groups at the same age. On the other hand, compared to each control group, both protein and mRNA levels of NR2B in 25 mg/L arsenite exposed groups also decreased remarkably on PND 21 and 35.

Fig. 5

Comparison of NR2B (green) protein expression in the hippocampal CA1 region among groups at early developmental stages. Notes: PND postnatal day. The micrographs were the representative results of three independent experiments and captured with Olympus BX50 microscope (× 400). Scale bar = 50 μm.

Fig. 6

Changes in the expression of NR2B induced by developmental arsenite exposure. Notes: Mice were sacrificed on PND 7, 14, 21, and 35, and their hippocampal tissues were immediately dissected out. Total proteins (30 μg /lane) in the hippocampus were separated by SDS-PAGE, transferred to PVDF membranes and immunoblotted for NR2B. (A) Western blot analysis. Images were the representative results of six separate experiments for each group. (B) Densitometric analysis of western blots. The relative intensity in arbitrary units compared to β-actin. (C) Quantitation of mRNA by real-time RT-PCR. Gene expression was normalized to GAPDH and presented as fold change vs the control group. Data were expressed as mean ± SD, n = 6. Significant difference was defined as p < 0.05, * vs control group, # vs 25 mg/L arsenite exposed group, and + vs 50 mg/L arsenite exposed group.

Developmental arsenite exposure induced alteration in the expression of AMPARs

Developmental arsenite exposure induced alteration in the expression of GluR1

Changes of GluR1 expression in the hippocampus of mice induced by arsenite exposure during different developmental stages were shown in Figs. 7 and 8. Figure 7 show representative micrographs illustrating immunoreactivity of GluR1 in the hippocampus, captured at the early stages. It was found that the immunoreactivities to GluR1 in arsenite exposure groups decreased gradually along with the exposure levels of arsenite. Consistent with the changes of immunostaining, compared to control and 25 mg/L arsenite exposed groups, both protein and mRNA levels of GluR1 in 50 and 100 mg/L arsenite exposed groups decreased apparently (Fig. 8). Moreover, it was also found that the protein levels of GluR1 in 100 mg/L arsenite exposed groups decreased approximately 28.3%, 35.4%, 48.0% and 55.0% as compared to each control group. Furthermore, the differences between 50 and 100 mg/L arsenite exposed groups were significant at different age. Additionally, as shown in Fig. 8, compared with control, both GluR1 protein and mRNA expressions of 25 mg/L arsenite exposed groups on PND 21 and 35 also significantly decreased.

Fig. 7

Comparison of GluR1 (green) protein expression in the hippocampal CA1 region among groups at early developmental stages. Notes: PND postnatal day. The micrographs were the representative results of three independent experiments and captured with Olympus BX50 microscope (× 400). Scale bar = 50 μm.

Fig. 8

Changes in the expression of GluR1 induced by developmental arsenite exposure. Notes: Mice were sacrificed on PND 7, 14, 21, and 35, and their hippocampal tissues were immediately dissected out. Total proteins (30 μg /lane) in the hippocampus were separated by SDS-PAGE, transferred to PVDF membranes and immunoblotted for GluR1. (A) Western blot analysis. Images were the representative results of six separate experiments for each group. (B) Densitometric analysis of western blots. The relative intensity in arbitrary units compared to β-actin. (C) Quantitation of mRNA by real-time RT-PCR. Gene expression was normalized to GAPDH and presented as fold change vs the control group. Data were expressed as mean ± SD, n = 6. Significant difference was defined as p < 0.05, * vs control group, # vs 25 mg/L arsenite exposed group, and + vs 50 mg/L arsenite exposed group.

Developmental arsenite exposure induced alteration in the expression of GluR2

Results of protein and mRNA expression for GluR2 were found in Figs. 9 and 10. Photos shown in Fig. 9 revealed that, except for PND 7 mice, the immunoreactivities to GluR2 in arsenite exposed groups decreased in a dose-dependent manner compared with those in control. Similarly, levels of GluR2 protein and mRNA of PND 14, 21 and 35 mice in 50 and 100 mg/L arsenite exposed groups decreased obviously and dose-dependently compared to control and 25 mg/L arsenite exposed groups at the same age (Fig. 10). As in our data, it was found that levels of GluR2 protein in 100 mg/L arsenite exposed mice decreased approximately 10.9%, 27.8%, 41.3% and 39.4% at different developmental stages, respectively. On the other hand, except for PND 7 groups, those of 100 mg/L arsenite exposed groups were remarkably lower than 50 mg/L arsenite exposed groups at the same age. In addition, our results also demonstrated that both GluR2 protein and mRNA expressions of 25 mg/L arsenite exposed mice decreased remarkably as compared to each control group on PND 14, 21 and 35.

Fig. 9

Comparison of GluR2 (green) protein expression in the hippocampal CA1 region among groups at early developmental stages. Notes: PND postnatal day. The micrographs were the representative results of three independent experiments and captured with Olympus BX50 microscope (× 400). Scale bar = 50 μm.

Fig. 10

Changes in the expression of GluR2 induced by developmental arsenite exposure. Notes: Mice were sacrificed on PND 7, 14, 21, and 35, and their hippocampal tissues were immediately dissected out. Total proteins (30 μg /lane) in the hippocampus were separated by SDS-PAGE, transferred to PVDF membranes and immunoblotted for GluR2. (A) Western blot analysis. Images were the representative results of six separate experiments for each group. (B) Densitometric analysis of western blots. The relative intensity in arbitrary units compared to β-actin. (C) Quantitation of mRNA by real-time RT-PCR. Gene expression was normalized to GAPDH and presented as fold change vs the control group. Data were expressed as mean ± SD, n = 6. Significant difference was defined as p < 0.05, * vs control group, # vs 25 mg/L arsenite exposed group, and + vs 50 mg/L arsenite exposed group.

Developmental arsenite exposure induced alteration in the expression of GluR3

Figures 11 and 12 describe the comparison of both protein and mRNA levels of GluR3 among groups at the early stages. As illustrated in Fig. 11, except for PND 7, the immunoreactivities to GluR3 in all the arsenite exposure groups decreased apparently and dose dependently compared with each control. As shown in Fig. 12, consistent with the alteration of fluorescence intensities, both protein and mRNA levels of GluR3 in 50 and 100 mg/L arsenite exposed groups were also significantly lower than the age-matched control and 25 mg/L arsenite exposed groups on PND 14, 21 and 35. Meanwhile, as compared with each control group, the protein levels of GluR3 in 100 mg/L arsenite exposed groups decreased approximately 5.3%, 33.3%, 31.1% and 29.6% at different stages, respectively. Moreover, the significant differences also existed between 50 and 100 mg/L arsenite exposed groups on PND 14, 21 and 35. On the other hand, both protein and mRNA levels of GluR3 in 25 mg/L arsenite exposed groups also decreased remarkably as compared to each control group on PND 21 and 35.

Fig. 11

Comparison of GluR3 (green) protein expression in the hippocampal CA1 region among groups at early developmental stages. Notes: PND postnatal day. The micrographs were the representative results of three independent experiments and captured with Olympus BX50 microscope (× 400). Scale bar = 50 μm.

Fig. 12

Changes in the expression of GluR3 induced by developmental arsenite exposure. Notes: Mice were sacrificed on PND 7, 14, 21, and 35, and their hippocampal tissues were immediately dissected out. Total proteins (30 μg /lane) in the hippocampus were separated by SDS-PAGE, transferred to PVDF membranes and immunoblotted for GluR3. (A) Western blot analysis. Images were the representative results of six separate experiments for each group. (B) Densitometric analysis of western blots. The relative intensity in arbitrary units compared to β-actin. (C) Quantitation of mRNA by real-time RT-PCR. Gene expression was normalized to GAPDH and presented as fold change vs the control group. Data were expressed as mean ± SD, n = 6. Significant difference was defined as p < 0.05, * vs control group, # vs 25 mg/L arsenite exposed group, and + vs 50 mg/L arsenite exposed group.

Developmental arsenite exposure induced alteration in the expression of CaMKII and p-CaMKII

As shown in Figs. 13 and 14, both CaMKII and p-CaMKII at protein level in 50 and 100 mg/L arsenite exposure groups were obviously lower than the control and 25 mg/L arsenite exposure groups at the same age. As shown in our data, it was found that the protein levels of CaMKII in 100 mg/L arsenite exposed groups decreased approximately 25.0%, 30.1%, 42.0% and 34.0%, and those of p-CaMKII decreased 27.7%, 33.0%, 33.7% and 38.6% at different developmental stages, respectively. Furthermore, there were also significant differences between 50 and 100 mg/L arsenite exposed groups at the same age. On the other hand, except for CaMKII in PND 7 mice, both levels of CaMKII and p-CaMKII in 25 mg/L arsenite exposed groups were obviously lower than those in the control, respectively.

Fig. 13

Changes in the expression of CaMKIIinduced by developmental arsenite exposure. Notes: Mice were sacrificed on PND 7, 14, 21, and 35, and their hippocampal tissues were immediately dissected out. Total proteins (30 μg /lane) in the hippocampus were separated by SDS-PAGE, transferred to PVDF membranes and immunoblotted for CaMKII. (A) Western blot analysis. Images were the representative results of six separate experiments for each group. (B) Densitometric analysis of western blots. The relative intensity in arbitrary units compared to β-actin. Data were expressed as mean ± SD, n = 6. Significant difference was defined as p < 0.05, * vs control group, # vs 25 mg/L arsenite exposed group, and + vs 50 mg/L arsenite exposed group.

Fig. 14

Changes in the expression of p-CaMKII induced by developmental arsenite exposure. Notes: Mice were sacrificed on PND 7, 14, 21, and 35, and their hippocampal tissues were immediately dissected out. Total proteins (30 μg /lane) in the hippocampus were separated by SDS-PAGE, transferred to PVDF membranes and immunoblotted for p-CaMKII. (A) Western blot analysis. Images were the representative results of six separate experiments for each group. (B) Densitometric analysis of western blots. The relative intensity in arbitrary units compared to β-actin. Data were expressed as mean ± SD, n = 6. Significant difference was defined as p < 0.05, * vs control group, # vs 25 mg/L arsenite exposed group, and + vs 50 mg/L arsenite exposed group.

DISCUSSION

The NMDAR in the hippocampus has been reported to be crucial for transmission of excitatory synapses, and regulation of synaptic plasticity modulating spatial learning and cognitive abilities (Morin et al., 2016). Activity-dependent synaptic plasticity in terms of LTP and long-term depression are crucial for cognitive and intellectual processing and are dependent on activation of NMDAR (Chandrasekar, 2013). Of which, the NR1 subunit is thought to have functional roles, and the NR2 subunit modulates channel activities (Huo et al., 2015).

The present study reported that the mRNA and protein expression of NR1, NR2A and NR2B subunits in the hippocampus decreased during different developmental stages, suggesting that arsenite exposure could inhibit the expression of NR1, NR2A and NR2B subunits in the hippocampus at the transcriptional level, and then resulted in their hypofunction. It has been reported that increased oxidative stress on arsenite exposure might inhibit the levels of NMDAR subunits expression (Srivastava et al., 2014; Tyler and Allan, 2014). Furthermore, our results revealed that the protein levels of NR1 in 100 mg/L arsenite exposure group were inhibited by 19.8%, 31.1%, 46.0% and 33.3%, those of NR2A by 24.0%, 33.0%, 39.6% and 28.6% at different developmental stages, respectively. In these results, both protein expression of NR1 and NR2A in PND 7, 14 and 21 arsenite exposure groups decreased time dependently. However, the inhibition of these two protein expressions in PND 35 arsenite exposed groups was slightly alleviated, which was possibly due to the blood-brain barrier. In PND 35, the barrier of mice might be mature, which could limit efficiently the transfer of iAs from blood into brain as that shown in our previous studies (Jin et al., 2010; Zhao et al., 2017). Additionally, the protein levels of NR2B in the 100 mg/L arsenite exposure group were inhibited by 19.4%, 22.8%, 36.1% and 39.2% at different developmental stages, respectively. One possible mechanism underlying the down regulation of NR2B might be due to cumulative effect of early arsenite exposure; another possible reason was that NR2B subunit will switch to NR2A subunit during brain development (Qiu et al., 2011). Consistent with our findings, Ramos-Chávez et al. (2015) clearly showed that gestational exposure to iAs could induce a negative modulation of NR2B in the hippocampus.

The AMPARs are known to induce fast glutamatergic neurotransmission and it has been reported that an impaired AMPAR functional activity leads to cognitive defects. AMPAR activation is necessary for the process of memory consolidation and retention (Yoshihara and Ichitani, 2004). Recent studies have suggested that hippocampal post-synaptic membrane GluR1 levels are critical for rodent learning and memory, and rodent cognitive behaviors were accompanied by hippocampal GluR1-containing AMPA receptor trafficking (Matsuo et al., 2008; Schmitt et al., 2004). GluR2 is selectively permeable to Na+ and K+ and impermeable to Ca2+ and plays important role during genesis of LTP in excitatory neurons (Santos et al., 2009). Several studies have reported that GluR3 is involved in cognitive processes such as learning and memory, but until now, the knowledge on the role of GluR3 is limited (Falsafi et al., 2012; Mokin et al., 2007).

In this study, except for GluR2 and GluR3 of PND 7 mice, the mRNA and protein expression of GluR1, GluR2 and GluR3 in the hippocampus decreased during different developmental stages, suggesting that arsenite exposure could inhibit the expression of GluR1, GluR2 and GluR3 at the transcriptional level. Several studies have shown that the protein expression of GluR1 and GluR2 was down regulated by arsenite exposure, which was consistent with our results (Maekawa et al., 2013; Nelson-Mora et al., 2018). It has been reported that the inhibited GluR1 protein expression might be caused by cytoskeletal dysfunction in response to oxidative stress induced by arsenite exposure (Anggono and Huganir, 2012; Maekawa et al., 2013). Furthermore, it was observed that the protein expression of GluR1 in 100 mg/L arsenite exposure group was reduced by 28.3%, 35.4%, 48.0% and 55.0% at different developmental stages, respectively. These results indicated that the effects of arsenite on GluR1 expression were cumulative at the early developmental stages. Moreover, those of GluR2 in 100 mg/L arsenite exposure group were reduced by 10.9%, 27.8%, 41.3% and 39.4% at different developmental stages, respectively. In these results, the protein expression of GluR2 in PND 7, 14 and 21 arsenite exposure groups decreased time dependently. However, the inhibition of GluR2 protein expression in PND 35 arsenite exposed groups was slightly alleviated, which was possibly due to the blood-brain barrier. In PND 35, the barrier of mice might be mature, which could limit efficiently the transfer of iAs from blood into brain as was shown in our previous studies (Jin et al., 2010; Zhao et al., 2017). Additionally, those of GluR3 in 100 mg/L arsenite exposure group were reduced by 5.3%, 33.3%, 31.1% and 29.6% at the same age. In these results, the protein expression of GluR3 in PND 7 and 14 arsenite exposure groups decreased time dependently. However, the inhibition of GluR3 protein expression in PND 21 and 35 arsenite exposed groups was slightly alleviated. Our results indicated that the expression of GluR3 might be sensitive to iAs, since the eyes of offspring mice opened on PND 13, and then they began to drink and were exposed directly to iAs through drinking water, so the levels of iAs in the brain increased promptly on PND 14, which was supported by our previous studies (Jin et al., 2010; Zhao et al., 2017). To date, to our knowledge, our paper was the first report concerning the effect of early arsenite exposure on GluR3 protein expression in the hippocampus of rodents.

The findings from this study revealed that the protein expression of CaMKII and p-CaMKII in the hippocampus might be down-regulated by developmental arsenite exposure. To date, a few studies have been showed that arsenic exposure could suppress the protein expression of CaMKII in adult rodents and in vitro (Zhang et al., 2014). In this work, our main concern was the effect of early arsenite exposure on the expression of CaMKII and p-CaMKII in the hippocampus of offspring mice. Since expression of CaMKII and p-CaMKII were determined at protein level only, it is uncertain whether decreased expression of CaMKII or p-CaMKII is regulated at the transcription or translation level. Moreover, our results also revealed that compared to the control group, the protein levels of CaMKII in 100 mg/L arsenite exposure group were reduced by 25.0%, 30.1%, 42.0% and 34.0% at different developmental stages, respectively. It was found that the protein levels of CaMKII in PND 7, 14 and 21 arsenite exposure groups decreased time dependently. However, the inhibition of CaMKII protein expression in PND 35 arsenite exposure groups were slightly alleviated, which was possibly due to the blood-brain barrier. In PND 35, the barrier of mice might be mature, which could limit efficiently the transfer of iAs from blood into brain. Furthermore, those of p-CaMKII were reduced by 27.7%, 33.0%, 33.7% and 38.6% at different developmental stages, respectively. These data suggested that the effects of arsenite on p-CaMKII expression were cumulative at the early developmental stages.

It has been reported that the insertion of AMPARs into cell membrane is crucial for NMDARs activity and function during LTP, and down regulation NMDARs could also negatively hamper assembly and functional signaling pathways of AMPARs. NMDARs hypofunction could also reduce CaMKII activity, thereby reducing AMPARs phosphorylation and in turn impairing LTP induction, eventually causing deficits in learning and memory ability. Furthermore, in our previous study, exposure to arsenite during developmental phase was observed to decrease the thickness of PSD, which may be due to the decreased expression of PSD-95 (Zhao et al., 2017). Growing evidence reveals that PSD-95 is a core component of the PSD, where it functions to cluster proteins such as NMDARs and AMPARs on the postsynaptic membrane and couple them with downstream signaling molecules (Petralia, 2012; Yokoi et al., 2012). And PSD-95 plays essential roles for maintaining and regulating synaptic NMDAR and AMPAR functions (Sturgill et al., 2009). The findings impel us to propose that early arsenite exposure might affect NMDAR and AMPAR synaptic trafficking, clustering or functions by inhibiting the expression of PSD-95 in the hippocampus of offspring mice. However, we could not clarify the mechanism of these alterations at the transcriptomic regulation level. More studies need to focus on clarifying the mechanism underlying arsenite-induced neurotoxicity.

ACKNOWLEDGMENT

Fund was provided by National Natural Science foundation of China under the project numbers 30972441 and 30530640.

Conflict of interest

The authors declare that there is no conflict of interest.

REFERENCES
 
© 2019 The Japanese Society of Toxicology
feedback
Top