The Journal of Toxicological Sciences
Online ISSN : 1880-3989
Print ISSN : 0388-1350
ISSN-L : 0388-1350
Original Article
Mechanisms of silver nanoparticles-induced cytotoxicity and apoptosis in rat tracheal epithelial cells
Juan Tang, Xiangjun Lu, Bin Chen, Enqi Cai, Wenli Liu, Jinxiao Jiang, Feifei Chen, Xiaodong Shan, Hangjun Zhang
Author information
JOURNAL FREE ACCESS FULL-TEXT HTML

2019 Volume 44 Issue 3 Pages 155-165

Details
Abstract

Silver nanoparticles (AgNPs) are increasingly utilized in a number of applications. This study was designed to investigate AgNPs induced cytotoxicity, oxidative stress and apoptosis in rat tracheal epithelial cells (RTE). The RTE cells were treated with 0, 100 μg/L and 10,000 μg/L of the AgNPs with diameters of 10 nm and 100 nm for 12 hr. The cell inhibition level, apoptosis ratio, reactive oxygen species (ROS), malondialdehyde (MDA) and metallothionein (MT) content were determined. The mRNA expression of cytoc, caspase 3, and caspase 9 was measured by quantitative real-time polymerase chain reaction (qRT-PCR). In addition, we also analyzed the cytoc, caspase 3, pro-caspase 3, caspase 9, and pro-caspase 9 protein expression by western blotting. Electric cell-substrate impedance sensing (ECIS) analysis showed that the growth and proliferation of RTE cells were significantly inhibited in a dose-dependent manner under AgNPs exposure. The cell dynamic changes induced by 10 nm AgNPs were more severe than that of the 100 nm AgNPs exposure group. The intracellular MT, ROS, and MDA content increased when the exposure concentration increased and size reduced, whereas Ca2+-ATPase activity and Na+/K+-ATPase activity changed inversely. The relative expression of protein of cytoc, caspase 3, and caspase 9 were upregulated significantly, which indicated that AgNPs induced apoptosis of RTE cells through the caspase-dependent mitochondrial pathway. Our results demonstrate that AgNPs caused obvious cytotoxicity, oxidative stress, and apoptosis in RTE cells, which promoted the releasing of cytochrome C and pro-apoptotic proteins into the cytoplasm to activate the caspase cascade and finally led to apoptosis.

INTRODUCTION

With the development of nanotechnology, nanomaterials have been widely used in various domains. Silver nanomaterial, a typical metal nanomaterial, is often used in industrial production and medical industries because of its strong antibacterial properties and conductivity. In vivo studies showed that the silver nanoparticulates (AgNPs) enter the body through a variety of biological barriers, for example the mouth, skin, digestive tract, and intravenous injection (Park et al., 2011; Samberg et al., 2010). The liver and lungs are the main target organs of AgNPs, and as the AgNPs enter the organism, they migrate through the respiratory tract and cause toxicity to target cells. As AgNPs are distributed to these body tissues and organs, they cause genotoxicity (Al Gurabi et al., 2015; Dobrzyńska et al., 2014), inflammatory response (Park et al., 2010), immunotoxicity (Vandebriel et al., 2014), and neurotoxicity (Zhang et al., 2013). Nevertheless, the potential bio-health risk of respiratory tract from AgNPs still lacks effective analysis (Chen and Schluesener, 2008; Lem et al., 2012).

The health risks caused by the toxic effects to the respiratory system induced by AgNPs are a matter of great concern. AgNPs are ultra-fine particles that can be deposited on the alveolar space possibly by binding to epithelial surface proteins, through uptake by epithelial cells, or via translocation over the alveolar epithelium (Kreyling et al., 2006). Since initial contact with NPs occurs at the epithelium in the respiratory tract (or lungs, skin, or eyes), in vitro cell studies need to focus on epithelial cell barrier integrity to estimate the respiratory toxicity of AgNPs, and the electric cell-substrate impedance sensing (ECIS) is an effective evaluation method (Theodorou et al., 2014). ECIS, a real-time, noninvasive, and label-free electrical detection method, has gained increasing popularity, owing to its great potential in microscale sensing (Giaever and Keese, 1993, 1986), which can be utilized to assess barrier formation and cell motility (Lo et al., 1999). ECIS is now capable of becoming an effective and noninvasive analytical method that facilitates a more direct and continuous early assessment of the cytotoxicity of drugs and environmental toxins in vitro more conveniently (Xie et al., 2012). An ECIS device that was developed using nano-grooves to simulate the internal extracellular matrix, with grooves 75 nm in depth and 200 nm in width, generated less intense resistance signals in human foreskin fibroblast (HFF) cell migration and proliferation, and HaCaT cell migration, but more intense ones in HaCaT cell proliferation (Cui et al., 2017). FKBP51-mediated inhibition of ISOC leads to decreased calcium entry-induced inter-endothelial gap formation and, thus, preserved the endothelial barrier by decreasing actin stress fiber and inter-endothelial cell gap formation in addition to attenuating the decrease in resistance observed with control cells using ECIS (Hamilton et al., 2018). Although there are many research studies on nanomaterial-induced airway cytotoxicity, it is necessary to discover the toxic effect mechanism combined with the impact on the motility and barrier of epithelial cells.

The effects of AgNPs on the dynamic behavior of epithelial cells and the destruction of the cell barrier are closely related to the cytotoxicity. In vitro studies proved that AgNPs can penetrate the cell membrane into the organelles, induce cell morphological changes, decrease cell viability, and cause mitochondrial damage, which were confirmed in bovine retinal endothelial cells, the D3 murine embryonic stem cell line (Park et al., 2011), and J774 A1 murine macrophages (Yen et al., 2009). Apoptosis may be an important endpoint for the toxicity of AgNPs. Nanomaterial induced apoptosis by initiating various molecular signals to activate the extrinsic or death receptor pathway (González-Ballesteros et al., 2017) and the intrinsic or mitochondrial pathway (Mata et al., 2016). It has been shown that AgNPs led to apoptosis via mitochondria-dependent and caspase-dependent intrinsic pathways mediated by ROS and c-Jun N-terminal kinase (Piao et al., 2011). However, AgNPs also activated apoptosis via extrinsic pathways proved by mRNA and protein expression of caspase-3 and caspase-7, TNF-alpha, and NF-kappa B after easily entering and accumulating into the cytosol and nucleus (Sivakumar et al., 2017). Therefore, it is necessary to explore the effect of AgNPs on the toxicity mechanism related to cellular dynamic changes andapoptosis in epithelial cells.

In this study, we focused on AgNPs-induced cytotoxicity, with the hypothesis that AgNPs-induced oxidative stress and apoptosis may be associated with the ROS, MDA, MT, Ca2+-ATPase and Na+/K+-ATPase activity changes and cytochrome C, caspase 3, and caspase 9 expression in rat tracheal epithelial cells (RTE). This study may help to provide theoretical support for the biosafety assessment of nanosilver, nanotoxicology research, and the safe utilization of nanomaterials.

MATERIALS AND METHODS

Test materials

The reagent AgNPs was procured from Sigma (St. Louis, MO, USA) which had the properties as stated: AgNPs of average nominal diameters of 10 nm and 100 nm, 0.02 mg/mL in aqueous buffer with sodium citrate.

Preparation of nanoparticulates

AgNPs were diluted in Dulbecco’s modified Eagle’s medium (DMEM, GIBCO, Madison, WI, USA) at final concentrations of 100 μg/L and 10 mg/L. The bath-type sonicator (Bioruptor, Cosmo Bio, Tokyo, Japan) was used to make the suspensions homogeneous f immediately before diluting. All reagents were conserved at 4ºC for no longer than 2 weeks.

Cell culture and NP treatment

The RTE cells were maintained in DMEM, containing 10% fetal bovine serum (FBS), 4 mM L-glutamine, and 1 mM sodium pyruvate. The cells were incubated and exposed to NPs at 37ºC and 5% CO2. All NPs were supplied in DMEM. Following sonication, all samples were kept on ice before use within 30 min. The same dispersion protocol was used before all the study experiments.

Observation of uptake of Ag by inductively coupled plasma emission spectrometer

Cells were seeded at 5 × 103 per well before replacing the medium with fresh medium containing AgNPs at concentrations of 0, 100, and 10,000 μg/L. The cells were washed with PBS (pH 7.4) for one time and transferred to digestion tubes with 20 mL concentrated nitric acid after 12 hr. First, the sample was decomposed with the full automatic microwave (Mars 5, GEM, New York, NY, USA) for 30 min. Acid drivers (HD-G12, Hunan Haode Instrument and Equipment, Shanghai, China) were used to catch acid at 120ºC for 30 min. Samples were then transferred into colorimetric tubes and analyzed by the ICP (Prodigy7, Leeman Labs, Wilmington, DE, USA). The silver standard solutions of 0.1 mg/L, 0.5 mg/L, 1 mg/L, 10 mg/L, and 20 mg/L were established, and each concentration has four parallel. Operating conditions: manual sampling, RF power of 1200 kw, improve time of 18 sec, peristaltic pump increase rate of 25 rpm, cooling gas of 18 LPM, atomizer of 33 psi, integration time of 10 sec, spectral line: Ag 241.323.

Detection of cellular dynamic behavior change by ECIS

The cell dynamic behavior was detected by the ECIS Zθ (Applied Biophysics, Wilmington, DE, USA). The new 8W10E electrode plate was incubated with 200 μL of 10 mM cysteine per well for 15 min and incubated with 400 μL of complete media overnight. We connected the ECIS Zθ, attached the tending electrode plates to the stage, checked the circuit, and adjusted the electrical balance. After balancing the resistance and capacitance, we turned on the instrument and obtained 20 to 30 baseline data at 400 Hz, and then 400 μL per well of the cell suspension was transferred into the electrode plate at a concentration of 5.0 × 105 cells/mL. When cell growth was stable, we added the corresponding AgNP suspension to each well, and then added serum-free medium as a control, continuously monitoring for approximately 24 hr.

Real-Time dynamic changes of RTE Cell Responses to AgNPs

The real-time dynamic changes of RTE cells induced by AgNPs were calculated according to the method verified by Xiao (Xiao et al., 2002). Three key factors decide the resistance change (ΔRs) of the well which was the number (No) of initial cells, the concentration (C), and the exposure time (t). The cells response to the AgNPs can be defined as the resistance change normalized by No measured by ECIS.

f (C, t)) =ΔRs/No

Cell proliferation inhibitory rate by Cell Counting Kit-8

Cells were seeded at 5 × 103 per well for one night before the medium was replaced with 100 μL of DMEM with 10% CCK8 (Dojindo Laboratories, Tokyo, Japan). The Multiskan Spectrum Microplate Reader (Thermo Fisher Scientific Inc., New York, NY, USA) was used to determine the absorbance of the solution after incubated at 37°C for 20 min at 450 nm. The following formula was used to calculate cell proliferation inhibitory rate: cell proliferation inhibitory rate (%) = [A450 (control)-A450 (sample) /A450 (control) - A450 (blank)] × 100.

Detection of Apoptosis by Flow Cytometer

The Guava easyCyte 8HT Flow Cytometer (Merck Millipore, New York, NY, USA) was used to detect the apoptotic cells rate after cells were seeded at 5 × 103 per well and treated with fresh medium containing AgNPs for 12 hr. AnnexinV-FITC Apoptosis Detection Kit (Jiancheng Biotechnology, Nanjing, China) were utilized according to the protocol, and the data were analyzed on GuavaSoft (Merck Millipore).

Detection of MT content

We performed the metallothionein assay by ELISA method based on indirect immunomodulation technology, a microplate coated with MT-specific monoclonal antibody (Ji Ning Industrial Co., Ltd., Shanghai, China). When a standard or sample is added to the wells of the microplate, the MT is bound to the coating. Adding horseradish peroxidase-labeled enzyme (HRP) can specifically bind MT into a “sandwich” type. MT was immobilized on a microplate, and the unbound enzyme was eluted. Through the color reaction of labeling, enzyme HRP can be indirectly derived from MT content. After the cells were blown off, the cells were collected at the bottom of wells after 4000 r/min centrifuged for 10 min, the supernatant was taken. We added 50 μL of the standard and sample to the coated wells and added 10 μL of biotin to the sample well. Then, 100 μL of enzyme-labeled solution was added per well, the microtiter plate was sealed with a sealing compound and then incubated at incubator for 1 hr. After the reaction with the washing solution to fully clean the plate 3 to 5 times (until the hole is completely dry), we added the color reagent A, B liquid 50 μL, dark reaction at room temperature for 10 min. Finally, we added 50 μL terminating liquid to stop the reaction and read the OD value of each well on a microplate reader at 450 nm.

Detection of ROS level, and MDA content

The dichlorodihydrofluorescein diacetate (DCFH-DA) (Jiancheng Biotechnology) was used to measure the level of ROS. Cells were seeded at 5 × 103 per well and treated with fresh medium containing treatment NPs with a range concentration of 0, 100 and 10000 μg/L for 12 hr. Then, the medium was replaced by 100 μL PBS buffer per well with 10 μM DCFH-DA (Jiancheng Biotechnology) at incubator for 20 min. Then, the Multiskan Spectrum Microplate Reader (Thermo Fisher Scientific Inc.) was used to measure data.

The MDA assay kit (Jiancheng Biotechnology) was used to measure the intracellular MDA after cells were added at 5.0 × 105 cells per well into six-well plates and treated with the AgNPs suspensions. MDA content was respectively measured according to the protocol of the kit and the absorbance was determined at 532 nm and calculated according to following formula: MDA Content = [OD (Sample-Control) /OD (Standard-Blank)] × Standard Concentration (10 nmol/mL) × Dilution Factor.

Detection of Ca2+-ATPase and Na+/K+-ATPase

ATPase can decompose ATP to generate ADP and inorganic phosphorus, and the level of ATPase activity can be determined by measuring the content of inorganic phosphorus by using kits (Jiancheng Biotechnology). The cells in the 24-well plate were repeatedly beaten until completely detached, then centrifuged and resuspended to 1 × 106/mL with phosphate-free D-Hank’s solution. The cell suspensions were frozen at -20°C and thawed, repeating three times. BCA kits were used to determine the protein content. The enzyme activity test included enzymatic reaction and the determination of phosphorus; the method of operation was according to kit instructions. We measured the absorbance of each tube with the wavelength 636 nm, optical path 0.5 cm.

Detection of genes by real-time PCR

Cells were seeded at 5.0 × 105 cells per well into six-well plates and treated with the AgNPs suspensions. The cells were collected using PBS and a trypsin solution, which were centrifuged and lysed. The RNA extracted and isolated using a Total RNA Isolation System (Promega, USA), and the concentration and purity measured utilizing RNase-Free DNase Set (Qiagen, Munich, Germany), then transcribed into cDNA by the SuperScript™ III First-Strand Synthesis SuperMix for qRT-PCR (Invitrogen, Wilmington, DE, USA) according to the protocol. The CFX384 Touch™ Real-Time PCR Detection System (Bio-Rad, Wilmington, DE, USA) with a 384-well plate (Applied Biosystems) was used to detect the PCRs conducted in triplicate using Power SYBR® Green PCR Master Mix for 40 cycles after 300 ng of cDNA was used in RT reactions. The PCR primers were designed and synthesized by Bioethics Engineering (Shanghai, China), and are shown in Table 1.

Table 1. Primer sequences used for detecting of gene relative expression by qRT-PCR in this study.
Gene Accession No. Primer sequence (5' to 3') Product Size (bp)
cytoc NM_031543.1 F: 5’-GACTTTGGCCGACCTGTTCTTT-3’
R: 5’-CATGAGGATCAGGAGCCCATATCT-3’
167
caspase 9 NM_031632.1 F: 5’-GGTGAAGAACGACCTGACTGCTAA-3’
R: 5’-TCAGCTCACGTTCATCGCATCCG-3’
100
caspase 3 NM_012922.2 F: 5'-AGAGTTGGAGCACTGTAGCACACA-3'
R: 5'-TCATGTCCACCACTGAAGGATGGT-3'
115
GAPDH NM_017008.4 F: 5'- GAAGGTCGGTGTGAACGGATTTG -3'
R: 5'- CATGTAGACCATGTAGTTGAGGTCA -3'
223

Western blot analysis

The total protein extraction kit with a protease inhibitor cocktail (Thermo Pierce Co., Ltd., Wilmington, DE, USA) and a BCA quantitation kit (Haogene Co., Ltd., Hangzhou, China) were used to determine the total protein and total protein quantitation of the RTE cells treated with AgNPs. The blots were incubated with cytoc (1: 1000), pro-caspase3 (1: 1000), cleaved- caspase3 (1: 200), pro-caspase9 (1: 1000), cleaved-caspase9 (1: 1000), and β-actin (1: 1500) antibodies (Abcam, London, UK) in 3% casein TTBS at 4°C after the samples were electrophoresed and transferred onto polyvinylidene fluoride membranes (Millipore), blocked and rinsed with 3% casein in TTBS. The membranes were rinsed and the SuperSignal® West Dura Extended Duration Substrate (Pierce) was used to detect each membrane incubated with horseradish peroxidase-conjugated goat anti-rabbit IgG (Pierce) in 2% casein TTBS, and the density of each band was quantified thrice using the densitometry function of Bands can 5.0 software.

Statistical analysis

Experimental data are presented as means ± the standard deviations (SD) of six independent experiments performed in triplicate. All calculations and statistical analyses were performed using SPSS for Windows version 20.0 (SPSS Inc., Chicago, IL, USA). The significance level was set at *P < 0.05, #P < 0.05, **P < 0.01 or ##P < 0.01.

RESULTS

Uptake of Ag in RTE Cells

The content of Ag in cells was detected by ICP (Table 2). Intracellular Ag concentration increases with the increased concentration of exposure and the decrease of particulate size (P < 0.01). Moreover, the cell uptake of the 10 nm AgNPs exposed group was 1.13 times that of the 100 nm exposed group when the exposure concentration was 10 mg/L.

Table 2. The content of sliver in RTE cells was detected by ICP.
Concentration (μg/L) Ag-10 nm Ag-100 nm
0 nd nd
100 1.03 ± 0.054** 0.65 ± 0.005*
10000 1.07 ± 0.011** 0.80 ± 0.010**

Values are expressed as mean ± SEM (n = 6); nd, not detected; Compared to corresponding control, *P < 0.05; **P < 0.01

Cellular dynamic changes

Compared with the control group with added serum-free medium, the electrical resistance of RTE cells fluctuated within 0.5 hr after exposure to AgNPs (Fig. 1). When the exposure concentration was 100 μg/L, the result of f (C, t) of the 10 nm treatment group was 1.6-fold lower than that of the 100 nm treatment group, when the concentration was10 mg/L, the result of f (C, t) of the 10 nm exposure group was approximately 1.4-fold lower than that of 100 nm exposure group.

Fig. 1

Responses (Ω per cell) of RTE cells to different concentrations (0, 100, and 10,000 μg/L) of AgNPs (10 nm and 100 nm). The dynamic changes of control group treated by serum-free medium showed in a), the results of Ag-100 nm exposure group with 100 μg/L and 10 mg/L depicted in b) and d), and the results of Ag-10 nm exposure group with 100 μg/L and 10 mg/L illustrated in c) and e), respectively.

Proliferation inhibition and apoptosis changes induced by AgNPs in RTE cells

The cell viability decreases with increases in the concentrations of NPs by 12 hr compared with control cells (Table 3). At the same concentration, the AgNP 100 nm exposure group has the largest cell activity reduction rate, followed by the AgNP 10 nm exposure group; both of them had a significant dose-dependent effect (P < 0.01). The apoptosis percentage increased with the increasing exposure concentration and had a dose- and size-dependent effect (Table 3). When the exposure concentration reached 10 mg/L, the apoptosis percentage of the treatment group reached 39.43% and 32.7%, which was 3.3 times and 2.7 times that of the control group.

Table 3. Cellular functional indicators changes induced by AgNPs in RTE cells.
Ag-10 nm (μg/L) Ag-100 nm (μg/L)
0 100 1000 0 100 1000
Cell inhibition level (%) nd 41.67 ± 0.60 59.18 ± 1.19** nd 11.93 ± 2.96 59.32 ± 2.59**
Apoptosis cells (%) 11.97 ± 0.43 32.73 ± 1.33** 39.43 ± 0.35** 12.30 ± 0.90 29.93 ± 0.62** 32.70 ± 1.96**
MT (μg/L) 1.15 ± 0.004 1.27 ± 0.059** 1.44 ± 0.058** 1.17 ± 0.016 1.28 ± 0.056** 1.43 ± 0.063**
ROS (FL/mgprotein) 2.64 ± 0.054 8.14 ± 0.033** 15.83 ± 0.030** 2.21 ± 0.324 4.38 ± 0.292** 7.56 ± 0.877**
MDA (nmol/mgprotein) 0.37 ± 0.02 6.37 ± 0.19** 49.02 ± 1.83** 0.85 ± 0.15 1.98 ± 0.17** 2.67 ± 0.19**
Ca2+-ATPase (mmol/mgprotein) 0.51 ± 0.010 1.67 ± 0.001** 0.12 ± 0.001** 0.52 ± 0.014 0.29 ± 0.003** 0.03 ± 0.002**
Na+/K+-ATPase (mmol/mgprotein) 12.79 ± 0.112 0.71 ± 0.072** 0.46 ± 0.003** 9.57 ± 0.124 6.43 ± 0.028** 1.17 ± 0.016**

Values are expressed as mean ± SEM (n = 6); nd, not detected; Compared to corresponding control, **P < 0.01.

Metallothionein (MT) content changes induced by AgNPs in RTE cells

Metallothionein (MT) content in RTE cells exposed to 0, 100, and 10,000 μg/L AgNPs (10 nm and 100 nm) is shown in Table 3. MT content was significantly increased in the groups exposed to 100 and 1000 μg/L AgNPs (10 nm and 100 nm) (P < 0.01) compared with the control groups. When the Ag-100 nm was treated, the intracellular MT content was 1.09 times and 1.25 times that of the control group, respectively.

ROS level and MDA content changes induced by AgNPs in RTE cells

ROS level and MDA content changes after AgNPs exposure are shown in Table 3. ROS level increased significantly after the RTE cells were exposed to 100, and 10,000 μg/L of AgNPs (10 nm and 100 nm) compared with the control group (P < 0.01) and presented in a dose-dependent manner. The Ag-10 nm exposure group in 10 mg/L had the highest ROS growth rate of 7.5 times compared with the control group. In addition, after exposure to 100, and 10,000 μg/L AgNPs (10 nm and 100 nm), MDA content decreased significantly compared with the control group (P < 0.01). However, compared with the control group, a 129-fold significant elevation in the MDA content occurred following Ag-10 nm exposure at the dose of 10 mg/L.

Ca2+-ATPase and Na+/K+-ATPase activity changes induced by AgNPs in RTE cells

When exposed to Ag-10 nm, the enzymatic activity of the control group was 0.513 mmol/mg.pro, which was 4.2 times higher than the intracellular Ca2+-ATPase activity (Table 3). Intracellular Ca2+-ATPase activity was significantly increased (P < 0.01), which is 3.2 times that of the control group. After treatment with Ag-100 nm, the intracellular Ca2+-ATPase activity decreased with increasing exposure concentration (P < 0.01).

When exposed to Ag-10 nm, the enzymatic activity of the control group was 12.791 mmol/mg.pro, which was 18 times and 27.6 times that of the treatment group, and the difference was significant (P < 0.01) (Table 3). With the increase of exposure concentration, the activity of Na+/K+-ATPase induced by AgNPs significantly decreased, in a dose- and size-dependent manner.

cytoc gene and protein expression changes

The changes of relative expression of cytochrome C gene and protein induced by AgNPs in RTE cells are shown in Fig. 2, and the results of intracellular cytoc protein bands are shown. Compared with the control group, cytoc protein expressions were significantly enhanced in 100, and 10,000 μg/L AgNPs (10 nm and 100 nm) treatment groups, which showed a dose-dependent effect (P < 0.01) (Fig. 3A, C). The results of RT-PCR showed that the expression of cytoc increased significantly in 1000 μg/L AgNPs-10 nm (P < 0.01), but decreased significantly in 100 μg/L AgNPs (10 nm and 100 nm) and 1000 μg/L AgNPs-100 nm (P < 0.01) (Fig. 2B).

Fig. 2

Gene and protein expression of cytoc detected by rtPCR and western blotting by AgNPs (10 nm and 100 nm) with a range concentration of 0, 100, and 10,000 μg/L. (A) cytoc protein levels. (B)Gene expression of cyto. (C) cyto proteins band densities. Values are expressed as mean ± SD (n = 6); Compared to corresponding control, **P < 0.01; ##P < 0.01.

Fig. 3

Gene and protein expression of caspase 9 detected by rtPCR and western blotting by AgNPs (10 nm and 100 nm) with a range concentration of 0, 100, and 10,000 μg/L. (A) pro-caspase 9 and cleaved-caspase 9 protein levels. (B) Caspase 9 Gene expression. (C and D) Caspase 9 proteins band densities. Values are expressed as mean ± SD (n = 6); Compared to corresponding control, **P < 0.01; ##P < 0.01.

Caspase 9 gene and protein expression changes

Figure 3A shows that the relative expression of the pro-caspase 9 protein was downregulated with increasing concentration, whereas the cleaved-caspase 9 was opposite (P < 0.01) (Fig. 3C and D). Figure 3B shows that the relative expression of the intracellular caspase 9 gene was significantly upregulated with the increase of exposure concentration (P < 0.01), with a dose-dependent effect.

Caspase 3 gene and protein expression changes

Figure 4 A shows that the relative expression of pro-caspase 3 protein was downregulated as the concentration was increased, whereas the cleaved-caspase 3 was opposite, with a significant difference (P < 0.01) (Fig. 4C and D). With the increase of exposure concentration, the relative expression level of the caspase 3 gene and the relative expression of cleaved-caspase 3/pro-caspase 3 protein were significantly increased (P < 0.01).

Fig. 4

Gene and protein expression of caspase 3 detected by QRTPCR and western blotting by AgNPs (10 nm and 100 nm) with a range concentration of 0, 100, and 10,000 μg/L. (A) pro-caspase 3 and cleaved-caspase 3 protein levels. (B) Caspase 3 gene expression. (C and D) Caspase 3 proteins band densities. Values are expressed as mean ± SD (n = 6); Compared to corresponding control, **P < 0.01; ##P < 0.01.

Figure 4B shows that the relative expression level of the caspase 3 gene was significantly upregulated (P < 0.01) with a dose-dependent increase. The relative expression level of the caspase 3 gene was 10-fold and 5.9 times. The relative gene expression of caspase 9 in the 10 nm-treated group was significantly higher than that in the 100 nm-treated group, with a significant size-dependent effect (P < 0.01).

DISCUSSION

Silver nanoparticles (AgNPs) are often used in industrial electroplating, medical treatment, and circuit components, due to their good conductivity, antibacterial ability, and surface effect, which leads to their widespread existence in the ecological environment and then poses a strong bio-health risk. The changes of cell growth, proliferation, motility, and barrier of epithelial cells are closely related to the AgNP-induced cytotoxicity on the respiratory tract (Sambale et al., 2015). In this study, the cell proliferation inhibition, dynamic changes, and barrier dysfunction induced by AgNPs were detected with a dose- and size-dependent manner according to the decrease of electrical resistance after treatment with AgNPs for approximately 12 hr.

Respiratory epithelial cells are effective tissues that resist the attack of harmful substances, and their damage directly or indirectly leads to the toxicity of cells, tissues, and organs. Due to their small size, AgNPs can easily pass through the cell membrane and enter the cell interior, inhibiting cell growth and causing cell apoptosis and necrosis (Yin et al., 2013). By measuring the uptake of Ag elements in cells by ICP (Table 2), it was found that the particle size, the intercellular contents of Ag, and the exposure concentration of NPs were the main factors determining the cytotoxicity. The ECIS was used to detect the cellular dynamic changes of RTE cells induced by AgNPs, and the results showed that under the exposure, the result of f (C, t) of RTE cells were significantly decreased with the dose- and time-dependent manner. The dynamic changes and barrier dysfunction of cells treated with Ag-10 nm were more severe than in the Ag-100 nm exposure group. Thrombin-induced endothelial cells contracted and the intercellular space increased, leading to cell barrier damage; cytotoxicity occurred with a dose-dependent decrease in the resistance values combined with both the ECIS and MTT experimental study (Kling et al., 2014). Cell viabilities were inhibited after AgNP treatment detected by both MTT and ECIS on fibroblasts (NIH-3T3), on a human lung adenocarcinoma epithelial cell line (A549), on PC-12 cells, a rat adrenal pheochromocytoma cell line, and on HEP-G2-cells, a human hepatocellular carcinoma cell line (Sambale et al., 2015). Enhanced motility of alveolar cancer cells was induced by CpG-ODN-functionalized NPs, which efficiently stimulate endogenous TLR-9, resulting in enhanced micromotility and a loss of barrier properties by ECIS (Rother et al., 2013). Thus, AgNP-induced cell dynamic changes are closely related to cytotoxic effects.

AgNPs can be transferred through the cell membrane to induce cytotoxicity; however, Ag is mainly distributed to MTs (Arai et al., 2015). MT is involved not only in metal detoxification and homeostasis, but also in scavenging free radicals during oxidative damage. Our results showed that intracellular MT content increased with the increase of exposure concentration, which also proved that AgNPs can penetrate the cell membrane into the RTE cells and induce MT activity to alleviate the toxicity of AgNPs. Hyper-expressed MT induced after exposure of low-level arsenite in a rat liver epithelial cell line (TRL 1215) became a trait of metal tolerance (Romach et al., 2000). After cadmium treatment, these resistant cells had 2.5-fold more MT than untreated control cells in normal human prostate epithelial cells, which induced apoptosis (Achanzar et al., 2000). It was found that the increase of MT content induced by AgNPs in this study is much lower than that induced by low concentrations of arsenic and cadmium. This may be due to the low tolerance to Ag that RTEs cell had, or the characteristics of AgNPs to avoid from forming a complex with MT, and the remaining AgNPs in cells will further affect the ion transition and cell membrane permeability.

Besides MT, the cytotoxicity of NPs is also closely related to Na+/K+-ATPase activity and Ca2+/Mg2+-ATPase activity (Jiang et al., 2016). Ca2+-ATPase is a calmodulin (CaM)-dependent enzyme that is responsible for clearance of Ca2+ and maintenance of cell homeostasis, which can protect cells from apoptosis (Kasai, 1999). The results showed that the activity of intracellular Ca2+-ATPase induced by AgNPs with a size of 100 nm decreased with the increase of exposure concentration. With the increase of exposure concentration, the activity of Na+/K+-ATPase induced by AgNPs decreased significantly. AgNPs reduced intracellular Na+/K+-ATPase activity, resulting in intracellular K+ efflux, and the K+ in the cytoplasm decreased. The acute toxicity of Ag appeared to be caused solely by ionic Ag+ interacting at the gills in freshwater fish, inhibiting basolateral Na+/K+-ATPase activity, which then caused the toxicity (Wood et al., 1999). Zinc oxide NPs also could apparently decrease the plasma membrane calcium ATPase expression, generate excessive ROS, and, finally, initiate cell death (Guo et al., 2013). ATPase is a sensitive target of oxidative stress, which would be inactivation under prolonged oxidative stress (Zaidi et al., 2009; Zaidi and Michaelis, 1999).

Inactivation of Ca2+-ATPase and Na+/K+-ATPase can sustain accumulation of ROS, which leads to apoptosis (Chichova et al., 2014) . In this study, the results of ROS and MDA contents showed that AgNPs significantly increased intracellular ROS and MDA levels in dose- and size-dependent manners. Different upregulation levels of ROS and mitochondrial damage were observed in the AgNP-treated human glioblastoma cells (AshaRani et al., 2009), BRL3A rat hepatocytes (Hussain et al., 2005), and PC-12 neurons (Hussain et al., 2006). And, all of the examples indicated that the upregulated ROS induced by AgNPs is closely related to apoptosis.

In vitro studies have reported that AgNPs can induce apoptosis through the death receptor pathway, mitochondrial pathway, and endoplasmic reticulum pathway (Gopinath et al., 2010; Singh and Ramarao, 2012). The mitochondrial pathway, also known as endogenous apoptosis pathway, under the influence of various pro-apoptotic signals such as intracellular redox and electron transfer imbalance, releases pro-apoptotic proteins into the cytoplasm (Li and Li, 2000). The results in the present study showed that under the exposure of AgNPs, an excessive intracellular ROS level promotes mitochondrial cytoc synthesis and release by upregulating the cytoc mRNA and protein expression. And upregulation of the relative expression of caspase 3 and 9 exposed to AgNPs indicated that increase of ROS and MDA levels resulted in oxidative stress, destruction of the mitochondrial membrane, release of cytochrome C, and cleaved downstream activation of caspase 9 and 3 protein, which eventually results in apoptosis. The similar conclusion was proposed in human hepatocytes induced by AgNPs (Piao et al., 2011) and rat cerebellum granule cells (Yin et al., 2013). This series of conclusions are basically consistent with this study.

In summary, AgNPs have a dose and size effect on the cytotoxicity of RTE which is related to the dynamic changes of RTE cells. AgNP-induced apoptosis of RTE cells via the caspase-dependent mitochondrial pathway can affect cell dynamic changes, damage the cell barrier, inactivate ATPase activity to cause inactivation of Ca2+-ATPase and Na+/K+-ATPase, excessively generate and accumulate of ROS and MDA, sensitize cell signaling to release cytochrome C and pro-apoptotic protein into the cytoplasm, activate the caspase cascade, and finally lead to apoptosis (Fig. 5).

Fig. 5

The proposed signaling pathway of regulating cytotoxicity related to gene expression associated with the silver nanoparticles-induced apoptosis signaling pathway in rat tracheal epithelial cells.

ACKNOWLEDGMENTS

This work was financially supported by the Natural Science Foundation of Zhejiang Province of China (No. LY15B070014), Hangzhou Science and Technology Program (No. 20150533B02), the Program for 151 Talents in Zhejiang Province (No. 4108Z061700303), the Program for 131 Talents in Hangzhou City (No. 4105F5061700104), the Program for New Bud Talents of College Students in Zhejiang Province (No. 2017R423082).

Conflict of interest

The authors declare that there is no conflict of interest.

REFERENCES
 
2019 The Japanese Society of Toxicology
feedback
Top