Identification and physiological function of one microRNA (Po-MilR-1) in oyster mushroom Pleurotus ostreatus

Abstract

MicroRNAs are essential regulators of gene expression and have been extensively studied in plants and animals; however, few reports have been published in mushrooms. Po-MilR-1 is a novel microRNA with a length of 22 bp in Pleurotus ostreatus. The secondary structures of five precursors and the target genes of Po-MilR-1 were predicted. Expression profile analysis showed Po-MilR-1 had specific expression in the primordium and fruiting body. To explore its physiological function, Po-MilR-1 was overexpressed in P. ostreatus. The transformants showed slow mycelium growth rate and abnormal pileus with irregular edge, which suggested Po-MilR-1 plays an important role in P. ostreatus development. Additionally, Po-MilR-1 and one of its target hydrophobin genes POH1 had opposite temporal expression profiles in the primordium and fruiting body, which revealed that Po-MilR-1 may perform its physiological function through the negative regulation of POH1. This study explored the development-related function of a mushroom microRNA and will provide a reference for other microRNAs.

1. Introduction

MicroRNAs (miRNAs), with a length of 20–30 nt, are endogenous, non-coding small RNAs (Bartel, 2009; Dang, Yang, Xue, & Liu, 2011). In plants and animals, miRNAs have been studied extensively and some of them express in a stage-specific or tissue-specific manner and are regarded as conserved regulators of gene expression (Bartel, 2004; Wienholds & Plasterk, 2005; Shamimuzzaman & Vodkin, 2012). MiRNAs are involved in various biological processes, such as cell proliferation and differentiation, apoptosis, stress response, tissue morphogenesis and developmental processes (Bartel, 2004; Wienholds & Plasterk, 2005; Zhang, Pan, Cobb, & Anderson, 2006; Chen, Schaffert, Fragoso, & Loh, 2013). In addition, the regulatory mechanisms of miRNAs have been explored. miRNAs are non-coding and cannot perform their physiological functions independently, but their precursors can pair with target mRNAs completely or imprecisely and form a stem-loop RNA. Subsequently, like in RNA interference, the double-stranded RNAs are processed by dicer-like enzymes, and finally the specific mRNAs are degraded or the translation process is inhibited (Carrington & Ambros, 2003;Tay, Zhang, Thomson, Lim, & Rigoutsos, 2008; Bartel, 2009; Hyun et al., 2009). Therefore, miRNAs perform their functions through the negative regulation of target mRNAs.

Compared with plant and animal miRNAs, research on fungal miRNAs has been relatively low, and the production mechanisms have some differences in that not only polymerase II, but also polymerase III enzymes are responsible for fungal miRNA transcription and at least four different pathways have been uncovered for miRNA production (Lee et al., 2010; Yang et al., 2013). Recently, however, more and more fungal miRNAs have been reported, such as miRNAs from Cryptococcus neoformans (Jiang, Yang, Janbon, Pan, & Zhu, 2012), Sclerotinia sclerotiorum (Zhou et al., 2012a), Metarhizium anisopliae (Zhou, Wang, Zhang, Meng, & Huang, 2012b), Trichoderma reesei (Kang et al., 2013), Penicillium marneffei (Lau et al., 2013), Fusarium oxysporum (Chen et al., 2014), Antrodia cinnamomea (Lin et al., 2015) and Penicillium chrysogenum (Dahlmann & Kück, 2015), which has shed light on the evolutionary origins, production mechanisms and biological function of fungal miRNAs. In T. reesei, small RNAs libraries from cellulose induction and non-induction conditions were compared, which implied that miRNAs might play a role in growth and cellulose production (Kang et al., 2013). In Penicillium marneffei, the differential expression of miRNAs in the mycelial and yeast phases was explored, which showed the possible role of post-transcriptional control in governing thermal dimorphism (Lau et al., 2013). In S. sclerotiorum, miRNA sequencing revealed some miRNAs related to sclerotial development, and in Coprinopsis cinerea, miRNAs identified in the vegetative mycelium and primordium showed potential roles in regulating fruiting body development (Zhou et al., 2012a; Lau et al., 2018). However, the physiological functions of these miRNAs were suggested based on bioinformatics analysis and their exact functions need to be explored through further experiments (Chen et al., 2013; Lin et al., 2015).

Pleurotus ostreatus is an important edible and medicinal mushroom, and is a useful model for researching the mechanism of fruiting body development in mushrooms (Sánchez, 2010; Fang et al., 2014; Gąsecka, Mleczek, Siwulski, & Niedzielski, 2016). In our previous work, miRNA-Seq and RNA-Seq were performed in four different developmental stages of P. ostreatus including the mycelium (Myc), primordium (Pri), young fruiting body (Yfb), and mature fruiting body (Mfb) (Xu et al., 2019). After screening the differentially expressed miRNAs, one miRNA (named Po-MilR-1) was found to be barely expressed in Myc, but its expression increased dramatically in Pri with a |log₂ Pri/Myc| value of 16.04, and showed an increasing trend in the fruiting body, with the RPKM value of 2867.2 in Yfb and 10210.0 in Mfb, which suggested that it may play a potential role in fruiting body development. To learn more about the physiological function of Po-MilR-1 in P.ostreatus development, overexpression strains were constructed and the relationship between Po-MilR-1 and its potential target gene related to fruiting body development was explored in this paper.

2. Materials and methods

2.1. Strains, media, and growth conditions

Pleurotus ostreatus Pd739, kept in the Laboratory of Food Microbiology, Huazhong Agricultural University, was maintained and cultured at 25 °C on potato dextrose agar (PDA; BD Difco, Sparks, MD) (Ma et al., 2007). Agrobacterium tumefaciens GV3101 (IMCAS, Beijing, China) was grown at 28 °C in YEB medium (tryptone 5 g/L, nutrient broth 5 g/L, sucrose 5 g/L, yeast extract 1 g/L, MgSO₄·7H₂O 0.49 g/L). Escherichia coli DH5α (Takara, Dalian, China) was grown in Luria-Bertani medium (tryptone 10 g/L, yeast extract 5 g/L, NaCl 10 g/L) at 37 °C.

2.2. Expression profile of Po-MilR-1 in different developmental stages

Four developmental stages of P. ostreatus , including mycelium (Myc), primordium (Pri, 2–3 mm diam), young fruiting body (Yfb, no gill formed), and mature fruiting body (Mfb, gills formed and spores dispersed), were produced and their RNA samples were harvested and stored at –80 °C as previously described (Xu et al., 2019). Then expression level of Po-MilR-1 from four developmental stages were analyzed by quantitative real-time PCR (qRT-PCR) with SYBR Green Master Mix (VAZYME, Nanjing, China) using the ABI ViiA7 Real-Time PCR System (Applied Biosystems, Fosterusing City, USA). Primers of Po-MilR-1 and 5S rRNA (internal reference) were listed in Table 1. All tested with three independent biological replicates and the relative expression was analyzed using 2^-ΔΔct method (Yin, Zheng, Zhu, Chen, & Ma, 2015).

Table 1. Primers for qRT-PCR in this study.

Primers	Sequences (5'-3')	Descriptions
Loop primer	GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCAATCCTT	Primers for Po-MilR-1
QMilR-F	TGCGCGGTGGCGGCCGCAAG
QMilR-R	CCAGTGCAGGGTCCGAGGTATT
5S rRNA-F	GACTCTGAAAGCACCGCATC	Primers for 5S rRNA
5S rRNA-R	TCCCCCACCGTGGTACTAAC
Tubulin-F	GTTGGCGTTGGTGGGAGC	Primers for tubulin
Tubulin-R	CGGTTTCCACTATCGGCGAGTACTT
QPOH1-F	AAGTTATTGGAGTCGGGGCA	Primers for POH1
QPOH1-R	TTAGATGAGTTTGATGGGCG

2.3. Characterizations of Po-MilR-1

Based on the miRNA sequencing, characterizations of Po-MilR-1 were analyzed by bioinformatics. The secondary structure of Po-MilR-1 were explored by mireap (http://sourceforge.net/projects/mireap/) and target genes were predicted by psRobot and TargetFinder softwares (Bo & Wang, 2005; Dai & Zhao, 2011).

2.4. Construction of Po-MilR-1 overexpression vector

To construct Po-MilR-1 overexpression vector, the binary vector pGEH with enhanced green fluorescent protein gene (eGFP ) and hygromycin phosphotransferase gene (hph ) expressed under the control of P. ostreatus glyceraldehyde-3-phosphate dehydrogenase gene (gpd ) promoter on the left border was used (Ding et al., 2011). The overexpression cassette including the promoter gpd and overexpression fragment ov60 were amplified with the primers of gpdF/R and MilR1-F/R (Table 2). The PCR products were digested with Sac I/Bam HI, Bam HI/Eco 065I, respectively, and ligated into the vector pGEH digested with Sac I/Eco 065I. The ligation products were transformed into E. coli DH5α for sequencing to make sure no nucleotide changes, then the overexpression vector pOV60 was constructed (Fig. 1). Finally, the vector pOV60 was introduced into A. tumefaciens GV3101 by electroporation as the manufacturer’s protocol (Bio-Rad, Hercules, USA).

Table 2 Primers for PCR amplification in this study.

Primers	Sequences (5'-3')	Descriptions
gpdF	CGAGCTCGAATTCGTTGCCCTCAAGGGT	Primers for gpd amplification
gpdR	CGGGATCCCATAGTCACAAGGATGGGTGG
MilR1-F	CGGGATCCTCTAGAGATTACCATGGTC	Primers for Po-MilR-1 amplification
MilR1-R	GGGTGACCAGCGTAGCAGCAATCCTT
Hph-F	CTCGTGCTTTCAGCTTCGATGTAGG	Primers for hph gene amplification
Hph-R	CGGTTTCCACTATCGGCGAGTACTT

The recognition sequences for restriction enzyme are underlined.

Fig. 1 - The overexpression vector of pOV60. On the left border, the eGFP-hph fusion cassette is driven by the Pleurotus ostreatus gpd promoter. On the right border, the ov60 is driven by the P. ostreatus gpd promoter.

2.5. Agrobacterium-mediated transformation and transformant verification

Agrobacterium-mediated transformation of P. ostreatus mycelium was followed as previously described (Yin et al., 2015). All the strains were screened by PDA medium with 50 μg/mL hygromycin more than three times. Then the survival transformants were verified for the hph gene and overexpression cassette with the primers of HphF/R and gpdF/MilR1-R. Besides, mycelium of transformants and wild-type strain grew on glass slides was further examined for the expression of the reporter gene eGFP by fluorescence microscope (DM 6000 B, Leica Microsystems, Germany) using a green fluorescence filter (546 nm). Images were taken under 40× objective for randomly selected transformants and processed with imaging software Ocular (Photometrics, Tucson, USA).

To make sure Po-MilR-1 overexpressed in the transformants, expression levels of Po-MilR-1 in the mycelium between transformants and wild-type strain were analyzed by qRT-PCR (5S rRNA was used as internal reference and primers were showed in Table 1). Isolation of total RNA and qRT-PCR were performed as described above.

2.6. Phenotype characterization of Po-MilR-1 overexpression strains

To compare the mycelium growth rate, wild-type strain and transformants were cultured on PDA medium at 25 °C. The colony diameters were measured with three repetitions at the 6th day. To investigate the fruiting body formation, the mycelium of wild-type strain and the transformants were cultured on the 280 g sterile substrate bag (500 g/L cottonseed shell, 15 g/L bran, 2.5 g/L gypsum, 2.5 g/L lime and about 700 mL distilled water) in dark and developed to fruiting body as previously described (Xu et al., 2019). The times when mycelium covered the bag and primordium formation were recorded. In addition, the morphology of primordium, young fruiting body, and mature fruiting body were observed.

2.7. The relationship between Po-MilR-1 and one potential target gene POH1

The duplex formation of Po-MilR-1 and POH1 were predicted according to the miRNA sequencing. The relative expression of Po-MilR-1 and POH1 in wild-type strain and transformants were analyzed by qRT-PCR. 5S rRNA was used as the internal reference for Po-MilR-1 and tubulin was for POH1. All the primers were shown in Table 1. All tested with three independent biological replicates and the relative expression was analyzed using the 2^-ΔΔct method (Yin et al., 2015).

3. Results

3.1. Verification of Po-MilR-1 expression profile in different developmental stages

According to the miRNA sequencing, Po-MilR-1 was barely expressed in Myc, but was abundant with increasing trend in Pri, Yfb and Mfb. To verify the expression profile, the expression level of Po-MilR-1 in the four development stages were detected by qRT-PCR, which showed the consistent expression profile with miRNA sequencing (Fig. 2). Therefore, it suggested that Po-MilR-1 may play an important role in the development of P. osteatus , especially in the primordium and fruiting body.

Fig. 2 - The relative expression of Po-MilR-1 verified by qRT-PCR. Data were presented as mean values of three replicates with the corresponding standard deviations.

3.2. Characterizations of Po-MilR-1

Based on the bioinformatics analysis, the length of Po-MilR-1was just 22 bp with the sequence of GGUGGCGGCCGCAAGGAUUG. For the secondary structure, the precursorsof Po-MilR-1were searched and finally total of five precursors were predicted. All the precursors were in the length from 62 bp to 113 bp and can form the stable stem-loop RNAs by the minimum free energy analyzed (Fig. 3).

Fig. 3 - The detailed information of Po-MilR-1 precursors.

When predicted by psRobot and TargetFinder softwares, seventy-one transcriptswere found as the potential targetgenes of Po-MilR-1 via binding partially or perfectly (Supplementary Table S1). The potential target genes were annotated as 3-ketoacyl-CoA thiolase, hydrophobin, GTP cyclohydrolase II, and Cerato-platanin-domain-containing protein. Among them, hydrophobin had been reported with developmental expression, including one hydrophobin gene POH1 specifically expressed in the fruiting body which was reported as the important gene involved in fruiting body development (Ásgeirsdóttir, de Vries, & Wessels, 1998). As miRNAs can perform the function through the negative regulation of target genes (Dang et al., 2011), it speculated that Po-MilR-1 may have the development-related function through the regulation of hydrophobin gene POH1.

3.3. Contruction of Po-MilR-1 overexpression strains

The overexpression vector pOV60 was constructed and transformed into P. ostreatus Pd739 via A. tumefaciens. After the hygromycin resistance screening, forty-eight transformants were survival whose genome may contain the exogenous gene (hygromycin resistance gene). Then the survival transformants were initially verified by PCR that the transformants' genomes include the two DNA fragments, 0.8 kb of partial hph gene and 1.072 kb of the overexpression cassette (Fig. 4). To further verification by the expression of reporter gene eGFP, total of sixteen transformants can observe the green fluorescence, while the wild-type strain cannot (Fig. 5).

Fig. 4 - Transformant verification by PCR reaction. A: Verification of hph gene. B: Verification of the overexpression cassette. Lane M: Trans2K® Plus II DNA marker. Lane 1–6: Transformants.

Fig. 5 - Detection of green fluorescence in Pleurotus ostreatus strains. A: Transformant strain. B: Wild-type strain. Left column was detected for fluorescence under blue light and right column was corresponding phase-contrast micrographs. Images were taken with 40× fields of view. Bars: 50 μm.

To make sure Po-MilR-1 was really overexpressed in transformants, qRT-PCR was performed to compare the expression level in wild-type strain and transformants. As Fig. 6 showed, the expression level of Po-MilR-1 in transformants displayed some degree increase from 1.63-fold to 4.56-fold, which indicated they were the overexpression strains of Po-MilR-1. The two transformants with the highest efficiency (OV60-1 and OV60-4) were used for the phenotype characterization analysis.

Fig. 6 - Relative expression of Po-MilR-1 in wild-type strain and transformants. OV60-1–OV60-5 were the Po-MilR-1 transformants. Data were presented as mean values of three replicates with the corresponding standard deviations.

3.4. Phenotype characterization of Po-MilR-1 overexpression strains

Phenotype characteristics of wild-type strain and Po-MilR-1overexpression strains (OV60-1 and OV60-4) were compared (Fig. 7). In the mycelium, when cultivated on PDA medium, overexpression strains showed slower growth rate with irregular margins; when on substrate bag, they covered the bag for 22 d on average while wild-type one just needed 21 d. Therefore, Po-MilR-1 overexpression strains showed slow mycelium growth. For fruiting body development, morphology of the primordium and young fruiting body had no difference between transformants and wild-type strains. But in the mature fruiting body, both overexpression strains seemed harder to open the pileus with irregular edge, thus it can be seen that Po-MilR-1 had an impact on the mycelium growth and the pileus development of mature fruiting body in P. ostreatus.

Fig. 7 - The morphology of the wild-type strain (Pd739) and overexpression strains (OV60-1 and OV60-4).

3.5. Po-MilR-1 has the negative regulation of POH1 gene

To explore the relationship between Po-MilR-1 andPOH1, at first, for the duplex prediction, Po-MilR-1 andPOH1 can bind partially to form the double stranded RNA (Fig. 8A). In addition, for the expression level analysis, in the wild-type strain, both Po-MilR-1 and POH1were barely expressed in the mycelium while had an opposite spatial expression in the primordium and fruiting body that the higher expression level of Po-MilR-1, the lower of POH1(Fig. 8B). In the overexpression strain OV60-1, the relative expression of POH1had some degree decrease by compared to the wild-type strain (Fig. 8C). The above analysis suggested that Po-MilR-1may perform the development-related function through the negative regulation of POH1 in fruiting body development.

Fig. 8 - Relationship of Po-MilR-1 and POH1. A: Duplex formation. B: Relative expression of Po-MilR-1 and POH1 in wild-type strain. C: Relative expression of POH1 in the wild-type strain Pd739 and overexpression strain OV60-1. Data were presented as mean values of three replicates with the corresponding standard deviations.

4. Discussion

Edible mushrooms, with high nutritional value and bioactive compounds, are regarded as important materials for food and medicine, so increasing interest has been directed towards the mechanism of fruiting body development, which results from the interaction of multiple genes, transcription factors and pathways (Zhang et al., 2015). To date, miRNAs from two mushrooms (Antrodia cinnamomea and Coprinus cinereus) have been reported to have potential roles as regulatory factors, involved in metabolite synthesis, transport and development (Lin et al., 2015; Lau et al., 2018 In this study, Po-MilR-1,a novel miRNA with temporal differences in expression, was found to have a potential regulatory role inP.ostreatus development.

To explore miRNA functions, many artificially synthesized miRNA products have been made, such as mature miRNA analogs (miRNA mimics), which can significantly increase the expression of miRNAs in a short time. Another method involving building miRNA-overexpression strains has shown broad application prospects with low cost (Bader, Brown, & Winkler, 2010). In overexpression strains, the expression of a T. reesei miRNA was 2.70-fold to 133.77-fold higher than in the wild-type strain, with an efficiency similar to that for miRNA mimics (Kang et al., 2013). In this study, overexpression strains of Po-MilR-1 were constructed, and the highest expression level was 4.56 times that of the wild-type strain. In phenotype characterization analysis, the overexpression strains showed decreased mycelium growth rate and abnormal pileus morphology, providing the first evidence that miRNAs regulate P. ostreatus development.

In a study of the relationship between miRNAs and their target genes, two miRNAs (miR1 and miR2) of Cryptococcusneoformanswere found to silence their target genes, which showed that fungal miRNAs can perform their functions by silencing gene expression (Jiang et al., 2012). For Po-MilR-1, seventy-one transcripts were predicted as target genes and one of them,POH1, was chosen to explore its relationship with Po-MilR-1. They formed a stable duplex and had opposite expression profiles in fruiting body development, including the functions of Po-MilR-1 and POH1were related. POH1 is an important gene involved in fruiting body development and is specifically expressed in the pileus, but not the stipe (Ásgeirsdóttir et al., 1998), which corresponded with Po-MilR-1 in this study, confirming that it plays an important role in fruiting body development and especially pileus development. The above analysis suggested that Po-MilR-1 may perform its function through the negative regulation of POH1 in fruiting body development. However, there remains some confusion as to why both Po-MilR-1 and POH1 are barely expressed in the mycelium. The reason may be that the switch to start the expression of POH1 is controlled by another factor, possibly related to light or cold stimulation, and when POH1 expression begins, its expression level is regulated by Po-MilR-1 to control fruiting body development of. Nevertheless, more advanced molecular biological approaches are needed to explore how Po-MilR-1 regulates the target gene POH1.

In conclusion, Po-MilR-1 is a novel miRNA and have specific expression in the primordium and fruiting body of P.ostreatus. Besides, Po-MilR-1 plays an important role in P.ostreatus development and may have the negative regulation of POH1. This study will provide the reference to dig up more miRNAs involved in the mushroom development.

Disclosure

The authors declare no conflicts of interest. All the experiments undertaken in this study comply with the current laws of the country where they were performed.

Acknowledgement

This research was supported by a grant from the National Natural Science Foundation of China (NSFC) (No. 31172011) to Aimin Ma.

References

• Ásgeirsdóttir, S. A. , de Vries, O. M. , & Wessels, J. G. (1998). ldentif ication of three differentially expressed hydrophobins in Pleurotus ostreatus (oyster mushroom). Microbiology, 144, 2961- 2969, https://doi.org/10.1099/00221287-144-11-2961
• Bader, A. G. , Brown, D. , & Winkler M. (2010). The promise of microRNA replacement therapy. Cancer Research, 70, 7027- 7030. https://doi.org/10.1158/0008-5472.can-10-2010
• Bartel, D. P. (2004). MicroRNAs: Genomics, biogenesis, mechanism, and function. Cell, 116, 281- 297. https://doi.org/10.1016/S0092-8674(04)00045-5
• Bartel, D. P. (2009). MicroRNAs: Target recognition and regulatory functions. Cell, 136, 215- 233. https://doi.org/10.1016/j.cell.2009.01.002
• Bo, X. , & Wang, S. (2005). TargetFinder: a software for antisense oligonucleotide target site selection based on MAST and secondary structures of target mRNA. Bioinformatics, 21, 1401- 1402. https://doi.org/10.1093/bioinformatics/bti211
• Carrington, J. C. , & Ambros, V. (2003). Role of MicroRNAs in Plant and Animal Development. Science, 301, 336- 338. https://doi.org/10.1126/science.1085242
• Chen, C. Z. , Schaffert, S. , Fragoso, R. , Loh, C. (2013). Regulation of immune responses and tolerance: the microRNA perspective. Immunological Reviews, 253, 112- 128 https://doi.org/10.1111/imr.12060
• Chen, R. , Jiang, N. , Jiang, Q. , Sun, X. , Wang, Y. , Zhang, H. , & Hu, Z. (2014). Exploring microRNA-like small RNAs in the filamentous fungus Fusarium oxysporum PloS One 9, e104956. https://doi.org/10.1371/journal.pone.0104956
• Dahlmann, T. A. , & Kück U. (2015). Dicer-Dependent Biogenesis of Small RNAs and Evidence for MicroRNA-Like RNAs in the Penicillin Producing Fungus Penicillium chrysogenum. PloS One, 10, e0125989. https://doi.org/10.1371/journal.pone.0125989
• Dai, X. , & Zhao, P. X. (2011). psRNATarget: a plant small RNA target analysisserver. Nuclc Acids Research, 39, 155- 159. https://doi.org/10.1093/nar/gkr319
• Dang, Y. , Yang, Q. , Xue, Z. , & Liu, Y. (2011). RNA interference in fungi: Pathways, functions, and applications. Eukaryotic Cell, 10, 1148- 1155. https://doi.org/10.1128/EC.05109-11
• Ding, Y. , Liang, S. , Lei, J. , Chen, L. , Kothe, E. , & Ma, A. (2011). Agrobacterium tumefaciensmediated fused egfp-hphgene expression under the control of gpdpromoter in Pleurotus ostreatus. Microbiological Research, 166, 314- 322. https://doi.org/10.1016/j.micres.2010.07.001
• Fang, G. , Tang, B. , Liu, Z. , Gou, J. , Zhang, Y. , Xu, H. , & Tang, X. (2014). Novel hydrophobin-coated docetaxel nanoparticles for intravenous delivery: In vitro characteristics and in vivo performance. European Journal of Pharmaceutical Sciences, 60, 1- 9. https://doi.org/10.1016/j.ejps.2014.04.016
• Gqsecka, M. , Mleczek, M. , Siwulski, M. , & Niedzielski, P. (2016). Phenolic composition and antioxidant properties of Pleurotus ostreatus and Pleurotus eryngiien riched with selenium and zinc. European Food Research and Technology, 242, 723-732. https://doi.org/10.1007/s00217-015-2580-1
• Hyun, S. , Lee, J. H. , Jin, H. , Nam, J. , Namkoong, B. , Lee, G. , Chung, J. , & Kim, V. N. (2009). Conserved microRNA miR-8/miR-200 and its target USH/FOG2 control growth by regulating PI3K. Cell, 139, 1096-1108. https://doi.org/10.1016/j.cell.2009.11.020
• Jiang, N. , Yang, Y. , Janbon, G. , Pan, J. , & Zhu, X. (2012). Identification and functional demonstration of miRNA in the fungus Cryptococcus neoformans. PloS One, 7, e52734. https://doi.org/10.1371/journal.pone.0052734
• Kang, K. , Zhong, J. , Jiang, L. , Liu, G. , Gou, C. Y. , Wu, Q. , Wang, Y. , Luo, J. , & Gou, D. (2013). Identification of microRNA-like RNAs in the filamentous fungus Trichoderma reesei by solexa sequencing. PloS One, 8, e76288. https://doi.org/10.1371/journal.pone.0076288
• Lau, A. , Cheng, X. , Cheng, C. K. , Nong, W. , Cheung, M. K. , Chan, R. H. , Hui, J. H. L. , & Kwan, H. S. (2018).Discovery of microRNA-like RNAs during early fruiting body development in the model mushroom Coprinopsis cinerea. PloS One, 13, e0198234. https://doi.org/10.1371/journal.pone.0198234
• Lau, S. K. , Chow, W. N. , Wong, A. Y. , Yeung, J. M. , Bao, J. , Zhang, N. , Lok, S. , Woo, P. C. Y. , & Yuen, K. (2013). Identification of microRNA-like RNAs in mycelial and yeast phases of the thermal dimorphic fungus, Penicillium marneffei. PloS Neglected Tropical Diseases, 7, e2398. https://doi.org/10.1371/journal.pntd.0002398
• Lee, H. C. , Li, L. , Gu, W. , Xue, Z. , Crosthwaite, S. K. , Pertsemlidis, A. , Lewis, Z. A. , Freitag, M. , Selker, E. U. , Mello, C. C. , & Liu, Y. (2010). Diverse pathways generate microRNA-like RNAs and dicer-independent small interfering RNAs in fungi. , Molecular Cell, 38, 803- 814. https://doi.org/10.1016/j.molcel.2010.04.005
• Lin, Y. L. , Ma, L. T. , Lee, Y. R. , Lin, S. S. , Wang, S. Y. , Chang, T. T. , Shaw, J. , Li, W. , & Chu, F. (2015). MicroRNA-like small RNAs prediction in the development of Antrodia cinnamomea. PloS One, 10, e0123245. https://doi.org/10.1371/journal.pone.0123245
• Ma, A. , Shan, L. , Wang, N. , Zheng, L. , Chen, L. , & Xie, B. (2007).Characterization of a Pleurotus ostreatus fruiting body-specific hydrophobin gene, Po.hyd. Journal of Basic Microbiology, 47, 317- 324. https://doi.org/10.1002/jobm.200710317
• Sánchez C (2010). Cultivation of Pleurotus ostreatus and other edible mushrooms. Applied Microbiology And Biotechnology, 85, 1321- 1337. https://doi.org/10.1007/s00253-009-2343-7
• Shamimuzzaman, M. , & Vodkin, L. (2012). Identification of soybean seed developmental stage-specific and tissue-specific miRNA targets by degradome sequencing. BMC Genomics, 13, 310. https://doi.org/10.1186/1471-2164-13-310
• Tay, Y. , Zhang J. , Thomson, A. M. , Lim, B. , & Rigoutsos I. (2008). MicroRNAs to Nanog, Oct4 and Sox2 coding regions modulate embryonic stem cell differentiation. Nature, 455, -1124-1128. https://dx.doi.org/10.1038/nature07299
• Wienholds, E. , & Plasterk, R. H. (2005).MicroRNA function in animal development. FEBS Letters, 579, 5911- 5922. https://doi.org/10.1016/j.febslet.2005.07.070
• Xu, D. , Lu, J. , Wang, Y. , Keerio, A. A. , Zheng, L. , Chen, L. , & Ma, A. (2019). Identification and in silico analysis of lectins in gray oyster culinary-medicinal mushroom Pleurotus ostreatus (Agaricomycetes) based on the transcriptomes. International Journal of Medicinal Mushrooms, 21, 1193- 1205. https://doi.org/10.1615/intjmedmushrooms.2019032886
• Yang, Q. , Li, L. , Xue, Z. , Ye, Q. , Zhang, L. , Li, S. , & Liu, Y. (2013). Transcription of the major Neurospora crassa microRNA-like small RNAs relies on RNA polymerase III. PloS Genetics, 9 , e1003227. https://doi.org/10.1371/journal.pgen.1003227
• Yin, C. , Zheng, L. , Zhu, J. , Chen, L. , & Ma, A. , (2015). Enhancing stress tolerance by overexpression of a methionine sulfoxide reductase a (MsrA) gene in Pleurotus ostreatus. Applied Microbiology and Biotechnology, 99, 3115- 3126. https://doi.org/10.1007/s00253-014-6365-4
• Zhang, B. , Pan, X. , Cobb, G. P. , & Anderson, T. A. (2006). Plant microRNA: A small regulatory molecule with big impact. Developmental Biology, 289, 3- 16. https://doi.org/10.1016/j.ydbio.2005.10.036
• Zhang, J. , Ren, A. , Chen, H. , Zhao, M. , Shi, L. , Chen, M. , Wang, H. , & Feng, Z. (2015). Transcriptome analysis and its application in identifying genes associated with fruiting body development in basidiomycete Hypsizygus marmoreus. PloS One, 10, e0123025. https://doi.org/10.1371/journal.pone.0123025
• Zhou, J. , Fu, Y. , Xie, J. , Li, B. , Jiang, D. , Li, G. , & Cheng, J. (2012a). Identification of microRNA-like RNAs in a plant pathogenic fungus Sclerotinia sclerotiorum by high-throughput sequencing. Molecular Genetics and Genomics, 287, 275- 282. https://doi.org/10.1007/s00438-012-0678-8
• Zhou, Q. , Wang, Z. , Zhang, J. , Meng, H. , & Huang, B. (2012b). Genome-wide identification and profiling of microRNA-like RNAs from Metarhizium anisopliae during development. Fungal Biology, 116, 1156- 1162. https://doi.org/10.1016/j.funbio.2012.09.001