Efficient PCR - based Approach for Rapid Identification of Earth Star Mushrooms Employing Species-Specific Primers

Abstract

Astraeus species are valuable edible ectomycorrhizal mushrooms, particularly in Asia. The partial hypogenous nature of Astraeus fruit bodies in soil present challenges for sample collection and studying species distribution. In this study, we developed a PCR-based approach for identifying Astraeus. Two universal primers (AUPF1/AUPR1 and AUPF3/AUPR3) and specific primers for A. asiaticus (AAF4/AAR4), A. odoratus (AOF4/AOR4), and A. sirindhorniae (ASF2/ASR4) were designed based on the alignment of internal transcribed spacer sequences from various Astraeus species. Primer verification was performed by generating amplicons from extracted DNA of Astraeus fruit bodies and 130 soil samples collected from beneath various host plants of Astraeus spp. These novel primers were efficient and precise in identifying Astraeus species. Our results have implications for multi-sample assays for Astraeus identification and investigations into species distribution through large-scale inventories.

1. Introduction

Astraeus Morgan is a common gasteromycetous genus belonging to Diplocystaceae, Boletales, Agaricomycetes, Basidiomycota, with 11 recognized species (Wijayawardene et al., 2020). Astraeus is an ectomycorrhizal (ECM) mushroom group with a worldwide distribution, including North and South America, Africa, Europe, Asia, and Australasia (Wilson et al., 2011). It forms ECM associations with host tree families, including Betulaceae, Ericaceae, Fagaceae, Malvaceae, Pinaceae, and Dipterocarpaceae (Fangfuk et al., 2010; Phosri et al., 2014; Wilson et al., 2011). In Thailand, Astraeus was previously misidentified, primarily as Astraeus hygrometricus (Pers.) Morgan, due to its perceived ease of identification (Phosri et al., 2004). Astraeus collected from numerous sites in Thailand have been documented as A. hygrometricus without thorough examination. After revision of Thai Astraeus species, three new species have been described from Thailand, namely A. asiaticus Phosri, M.P. Martín & Watling (Phosri et al., 2007), A. odoratus Phosri, Watling, M.P. Martín & Whalley (syn. A. thailandicus Petcharat; Phosri et al., 2004), and A. sirindhorniae Watling, Phosri, Sihan., A.W. Wilson & M.P. Martín (Phosri et al., 2014). In Thailand, Astraeus species are commonly found in deciduous dipterocarp forests and pine-deciduous dipterocarp forests, particularly widespread distribution across the northern and northeastern regions of the country (Kaewgrajang et al., 2013, 2019; Phosri et al., 2004, 2007). Among these species, A. sirindhorniae is characterized by a limited understanding of its natural distribution. Only two sites, encompassing Chaing Mai province in the northern region and Chaiyaphum province in the northeastern region of Thailand, have been recognized as known localities for this species. The genus Astraeus is one of the most commonly consumed wild edible ECM mushrooms in Thailand and several Asian countries (Łuczaj et al., 2021; Mortimer et al., 2012; Pavithra et al., 2015; Sanmee et al., 2003). Therefore, it serves as an important food source for local communities and an indigenous delicacy, providing a valuable bioresource during the monsoon season. Despite its long history of study, knowledge related to species diversity, distribution, and ecological niche of the genus in Asia remains limited. Moreover, the immature basidiomata of these mushroom species are partially hypogeous and often fruit only for a few months during the rainy season, resulting in challenges for large-scale exploration.

Given that molecular identification requires DNA from only small quantities of tissues, it is an effective method for identifying species in conditions where conventional taxonomy is not suitable because of incomplete morphological characteristics, lack of certain developmental stages, sex, cryptic species, and species with phenotypic plasticity. For mushroom species identification, relying on a morphological species concept can be challenging due to limited distinguishing morphological features and significant instances of convergent evolution, where different species independently evolve similar physical characteristics for functions like shape and spore dispersal mechanisms. This makes it difficult to differentiate species based solely on macroscopic features (Petersen & Hughes, 1999). DNA barcoding, a conventional method, uses short sequences (500-600 bp) of a standard gene, e.g., cytochrome oxidase subunit I (COI or COX1) in animals (Hebert et al., 2003), 16S rDNA in bacteria (Lebonah et al., 2014), 18S rDNA in protists (Pawlowski et al., 2012), and internal transcribed spacer (ITS) in fungi and plants (Nilsson et al., 2019; Xu, 2016). In mushrooms, DNA barcoding is especially advantageous for identifying hyphal stage where morphological identification is uncapable. This technique usually requires amplifying the barcoding region using universal primers, followed by sequencing (White et al., 1990). However, conventional DNA barcoding, as opposed to metabarcoding, requires sample purity because of limitations of Sanger sequencing. For the identification of species in impure samples such as soil and environmental DNA, metabarcoding or ITS-based metagenome analysis is an alternative method that can be used to identify multiple species in a sample (Kirse et al., 2021; Rosa et al., 2020; Skelton et al., 2022). Despite its cost-effectiveness and ability to generate large amounts of data, metabarcoding or ITS-based metagenome analysis still requires significant time and resources, particularly when the aim is just to detecting certain taxonomic groups or species in large number of samples. In contrast, a simple PCR with high specificity to amplify target DNA is more simplicity, affordability, and rapid screening capabilities, is suitable for the efficient processing of large sample sizes with a high sensitivity even when dealing with minimal DNA quantities. Nonetheless, prior to application, it is essential to experimentally validate the primer pairs' ability to specifically amplify target DNA, without relying on DNA sequencing, thereby ensuring the accuracy of subsequent test results.

To expand the knowledge of the distribution of Astraeus spp. in Thailand, we designed two pairs of Astraeus- universal primers and applied this method to detect the presence of Astraeus spp. in soil samples collected from various regions of Thailand by using a simple PCR technique. Additionally, we developed specific primers tailored to three Astraeus species found in Thailand, enabling targeted detection of these species in a sample based on PCR. These species-specific primers had not been developed previously, except for the primers of A. sirindhorniae (Suwannasai et al., 2020). Species-specific primers could be used to detect the presence/absence of each species in soil of each region without the limitation of mushroom season as it is possible that two or three Astraeus species may co-habit together, which applicable for Astraeus's geographic distribution study. To broaden the knowledge on species distribution and host symbiosis, these primers can be used to test either the DNA from soil and root tip of the host plants (Suwannasai et al., 2020), allowing expansion knowledge on mycorrhizal and host interaction. In addition, using both species-specific and universal primers to cross-check the same samples allows more precision of detection by just a simple PCR. Therefore, this study can be applied for taxonomy, species distribution, fungal and plant interaction, and fungal ecology.

2. Materials and Methods

2.1. Primer design

Primers were designed by aligning the ITS sequences from 11 Astraeus species (Table 1; Diplocystaceae Table S1; Supplementary Figs. S1-S4) using MAFFT (Katoh & Standley, 2013). Conserved regions were used to design the universal Astraeus primers, whereas distinct regions of A. odoratus, A. asiaticus, and A. sirindhorniae were used for species-specific primers (Supplementary Figs. S5-S10). Selected primer sequences were analyzed to determine their melting temperature, potential hairpin formation, self-annealing, and cross-annealing between forward and reverse primer using the Multiple Primer Analyzer (Thermo Fisher Scientific, Waltham, MA, USA; https://www.thermofisher.com/).

Table 1. Universal and species-specific primers for Astraeus species and annealing temperature for each pair of primers.

Primer Name	Amplified Species	Sequence	Ta	Product size (bp)
AUPF1 AUPR1	Astraeus (universal)	5' GGATCTCTTGGCTCTCGCATCG 3' 5' CAGGCCGTGCCRTGCAAAG 3'	70	290
AUPF3 AUPR3	Astraeus (universal)	5' CTGTTTGAGTGTCATYGAAATCTC 3' 5' CGCGACGATCACTACGACG 3'	65	200
AOF4 AOR4	Astraeus odoratus	5' GTCTAGTTAGTATTTCGGAGTGC 3' 5' CGAGCTCGCTCCGAGTCG 3'	60	490
AAF4 AAR4	Astraeus asiaticus	5' GTTCTAGCATTTCGGAGTGC 3' 5' CTTAGAGAAAAGGACACACG 3'	65	690
ASF2 ASR4	Astraeus sirindhorniae	5' CTACCTCTCCGAAGTGTCCTG 3' 5' TGAGACAAGTCGATTCCCGAG 3'	65	533

2.2. Sample collection

This study encompassed 13 sampling sites distributed across six floristic regions (i.e., the Northern, North-eastern, Eastern, South-western, Central, and Peninsular regions) and eight provinces of Thailand (Supplementary Table S2). These floristic regions follow the classification outlined in the Flora of Thailand (volume 4 [3.3]; The Forest Herbarium, Department of National Parks, Wildlife and Plant Conservation, 2023). The predominant host tree species for Astraeus spp. were identified within Dipterocarpaceae and Pinaceae families (Phosri et al., 2004). Therefore, our study analyzed soil samples from 12 host species representing five genera within Dipterocarpaceae, along with two Pinus species (P. kesiya Royle ex Gordon and P. latteri Mason) from the family Pinaceae. The host plant species were identified by consulting taxonomic literature (e.g. Phengklai, 1972; Pooma et al., 2017), and by comparing with herbarium specimens deposited in the following herbaria: Bangkok Herbarium, Plant Varieties Protection Office, Department of Agriculture (BK); The Forest Herbarium, Department of National Parks, Wildlife and Plant Conservation (BKF, https://www.dnp.go.th/botany/collections/collectionsPage.html); Queen Sirikit Botanic Garden Herbarium, The Botanical Garden Organization (QBG) and those included in the digital herbarium databases of Aarhus University (AAU, https://www.aubot.dk/search_form.php), Royal Botanic Garden Edinburgh (E, https://data.rbge.org.uk/search/herbarium/), Naturalis Biodiversity Center (L, https://bioportal.naturalis.nl/), and Muséum National d'Histoire Naturelle (P, https://science.mnhn.fr/institution/mnhn/collection/p/item/search/form?lang=en_US). The accepted names of the host plant species were examined using the taxonomic literature and online databases (IPNI, 2023; POWO, 2023).

During the fruiting season of Astraeus species (Jun-Aug 2023), a total of 130 soil samples were collected. Each sample was located 1-1.5 m from the host tree stem and soil was obtained at a depth of 5-10 cm. Four positions around the target host tree were collected soil samples, of which 50 g were combined to create composite samples with a total volume of 200 g. After collection, the soil samples were mixed thoroughly and passed through a sterile 0.1-mm sieve. Then, approximately 250 mg of each soil sample was transferred to a 5-mL sterile Eppendorf tube and stored at −80 °C until further processing.

2.3. DNA extraction, PCR amplification, and sequence verification

After Astraeus mushrooms were dried in a hot air oven for 24 h at 45-50 °C, the DNA from the sporocarps was extracted using the CTAB method (Doyle & Doyle, 1990) with some modifications, including the addition of 0.3% betamercaptoethanol and 2.5 mg/mL proteinase K. Soil DNA was extracted using DNeasy PowerSoil Pro Kits (Qiagen, Hilden, Germany). All soil DNA samples were used at the concentration of 10 ng/µL. PCR reactions were carried out in 50 µL of reaction mixture containing PCR buffer, 2 mM MgCl₂, 0.2 mM dNTP mix, 0.5 µM of each forward and reverse primers, template DNA at various concentrations, and 0.5 U of Taq polymerase (Apsalagen, Bangkok, Thailand). The amplification protocol included initial denaturation at 94 °C for 3 min, followed by 40 cycles of touchdown PCR with the annealing temperature decreasing by 0.5 °C per cycle for 20 cycles, and then a constant annealing temperature for another 20 cycles. The PCR cycle started with denaturation at 94 °C for 40 s, annealing at 55-60 °C for 30 s (see Table 1 for the annealing temperature of each pair of primers), extension at 72 °C for 30 s, and a final elongation step at 72 °C for 5 min. PCR products (5 µL) were visualized on 2% agarose gels. PCR-positive samples were further sequenced in some selected samples using BIT sequencing service (Bionics Co., Ltd., Korea), which uses Illumina's MiSeq system. The obtained sequences were analyzed using BLAST (blastn) (Camacho et al., 2009), a bioinformatic method to find the most similar nucleotide sequences from the database to the DNA query (input sequence). The partial sequences generated in this study were deposited in GenBank.

2.4. Primer sensitivity and specificity based on mushroom samples

To measure how much DNA is sensitive enough for amplifying by PCR, sensitivity test was performed for each pair of primers by using serial dilution of mushroom DNA with five concentrations, 5 ng/µL, 500 pg/µL, 50 pg/µL, 5 pg/µL, and 500 fg/µL.

Specificity was measured by ability of primers to produce only specific band of target DNA from each Astraeus species in a mixed DNA sample. Four types of DNA mixtures include A. asiaticus and A. odoratus (A+O), A. odoratus and A. sirindhorniae (O+S), A. asiaticus and A. sirindhorniae (A+S), and A. asiaticus, A. odoratus, and A. sirindhorniae (A+O+S). These mixtures were prepared using equal amount of DNA from each mushroom species (15 ng/µL). The mixture of two species DNA would then add one third of the volume of water to make the concentration of each mixture to 5 ng/µL. Serial dilution was made in five concentrations, 5 ng/µL, 500 pg/µL, 50 pg/µL, 5 pg/µL, and 500 fg/µL, respectively. Specificity was determined by the absence of cross-species amplification.

2.5. True positive rate, true negative rate, and accuracy based on soil samples

False positive was determined when the sequence of PCR product was not Astraeus. The false negative of Astraeus-universal primers was determined when PCR band was absent in the universal primer tests, but the band was present in one of the species-specific amplifications and the sequence confirmed Astraeus DNA. False negative of species-specific primers was determined when the PCR band was absent in that species test but present in universal primer test, and the sequence confirmed such species.

True positive was determined by the sequence of target DNA. True negative was determined when the PCR showed no band, but the sample showed positive band when amplified with the fungus-universal primers (ITS1 and ITS4) (White et al., 1990). In fact, all of 130 soil samples were tested with this pairs of primers (Supplementary Fig. S11) to confirm that our samples had no problem with DNA quality and thus negative band from PCR with our designed primers were true negative.

Sensitivity and specificity were determined according to the method described by Altman and Bland (1994). We calculated the false positive rate (FPR) and false negative rate (FNR) using the following formulae:

  

$$\mathrm{FNR}=\mathrm{FN}/(\mathrm{FN}+\mathrm{TP})$$(1)

  

$$\mathrm{FPR}=\mathrm{FP}/(\mathrm{FP}+\mathrm{TN})$$(2)

Furthermore, the true positive rate of primers for the detection of samples was calculated using the following formula:

  

$$\mathrm{TPR}=1\mathrm{-}\mathrm{FNR}=\mathrm{TP}/(\mathrm{TP}+\mathrm{FN})$$(3)

The true negative rate of primers was calculated using the following formula:

  

$$\mathrm{TNR}=1\mathrm{-}\mathrm{FPR}=\mathrm{TN}/(\mathrm{TN}+\mathrm{FP})$$(4)

The accuracy of primers was calculated using the following formula, as described previously (Metz, 1978):

  

$$\mathrm{ACC}=(\mathrm{TP}+\mathrm{TN})/(\mathrm{TP}+\mathrm{TN}+\mathrm{FP}+\mathrm{FN})$$(5)

where ACC is the accuracy, TNR is the true negative rate, TPR is the true positive rate, FN is the number of false negatives, FP is the number of false positives, TN is the number of true negatives, and TP is the number of true positives.

3. Results

3.1. Primer verification on mushroom DNA

3.1.1. Universal primers for Astraeus spp.

We designed two pairs of universal primers for Astraeus spp., namely AUPF1/AUPR1, and AUPF3/AUPR3. First, we verified the amplification product with DNA from mushrooms of three Astraeus species, including A. odoratus, A. asiaticus, and A. sirindhorniae. The sizes of amplified products were as expected (290 and 200 bp) (Table 1), and the amplified fragments were further confirmed by sequencing (accession nos. OR539883-OR539916). Then, we performed a sensitivity test by serial dilution from 5 ng/µL to 500 fg/µL, which revealed that the two primer pairs successfully detected DNA from the three mushroom species at the lowest concentration tested (i.e., 500 fg) (Fig. 1).

Fig. 1. - Sensitivity test of the universal primers for Astraeus spp. AUPF1 and AUPR1 (A), and AUPF3 and AUPR3 (B).

3.1.2. Species-specific primers

The three sets of primers designed for each Astraeus species exhibited specific and highly sensitive amplification. The primer pair AAF4/AAR4, designed for A. asiaticus, successfully amplified DNA at the lowest concentration of 50 pg/µL (Fig. 2A), whereas the primers AOF4/AOR4 for A. odoratus (Fig. 2B) and ASF2/ASR4 for A. sirindhorniae (Fig. 2C) demonstrated successful amplification at a concentration as low as 500 fg/µL. Additionally, these primers demonstrated no cross-amplification among species when tested with DNA from two or three Astraeus species (Fig. 3). For example, the primers designed for A. asiaticus amplified samples containing a mixture of A. asiaticus with A. odoratus, A. asiaticus with A. sirindhorniae, and A. asiaticus with A. odoratus and A. sirindhorniae (Fig. 3A), with the same sensitivity (at 50 pg/µL) observed when solely amplifying A. asiaticus DNA (Fig. 2A). Similarly, the primers designed for A. odoratus effectively amplified A. odoratus DNA, even when it was mixed with DNA from A. asiaticus, A. sirindhorniae, and both (Fig. 3B). Furthermore, the primers for A. sirindhorniae exclusively amplified A. sirindhorniae DNA, as evidenced by the test involving mixed DNA (A. odoratus with A. sirindhorniae, A. asiaticus with A. sirindhorniae, and A. asiaticus with A. odoratus and A. sirindhorniae), which revealed the specific band for A. sirindhorniae (Fig. 3C). Furthermore, the primers designed for A. odoratus and A. sirindhorniae exhibited equivalent sensitivity (at 500 fg/µL) in mixed DNA samples (Fig. 3B, C) compared to that with the sole DNA of each species (Fig. 2B, C).

Fig. 2. - Sensitivity test of species-specific primers AAF4 and AAR4 (A), AOF4 and AOR4 (B) and ASF2 and ASR4 (C) using DNA with different concentrations; N = negative control.

Fig. 3. - Sensitivity and specificity test of the species-specific primers for Astraeus asiaticus (AAF4 and AAR4) (A), A. odoratus (AOF4 and AOR4) (B), and A. sirindhorniae (ASF2 and ASR4) (C) using mixed DNA from two or three Astraeus spp.: A. asiaticus and A. odoratus (A+O), A. odoratus and A. sirindhorniae (O+S), A. asiaticus and A. sirindhorniae (A+S) and all three species (A+O+S); N = negative control.

3.2. Screening for mushroom DNA in soil

3.2.1. Accuracy of universal primers

We employed the two pairs of universal primers specific to Astraeus spp. for PCR testing of 130 DNA samples extracted from the soil collected from the 14 host species of Astraeus spp. (Figs. 4, 5, 6, 7, 8, 9). Most samples (121 of 130) exhibited results consistent with both pairs of primers, with 88 samples testing positive and 33 testing negative for Astraeus spp. Conversely, only nine samples yielded a positive result with one pair of primers but tested negative with the other (Table 2; Supplementary Table S2). Furthermore, we tested the accuracy of these primers using species-specific primers and sequencing to verify whether the results were true or false. The primer pair AUPF1/AUPR1, which produced positive bands of 290 bp in 94 samples, demonstrated true positive results in 89 samples and false positive results in five samples (Supplementary Table S3). Among the 36 samples that tested negative for AUPF1/AUPR1, 33 were true negative results and three were false negative results. Conversely, the primer pair AUPF3/AUPR3, revealing positive bands of 200 bp in 91 samples, exhibited true positive results in 89 samples and false positive results in two samples. Among the 39 samples that lacked the 200 bp band, 36 were true negative results and three were false negative results (Table 2).

Fig. 4. - PCR testing the presence of Astraeus spp. in the DNA from soil samples surrounded by the host Shorea obtusa (SO) using the universal primers for Astraeus spp.: AUPF1 and AUPR1 (A), and AUPF3 and AUPR3 (B). The 290 bp and 200 bp bands are the positive products of the two pairs of primers, respectively.

Fig. 5. - PCR testing the presence of Astraeus spp. in the DNA from soil samples surrounded by the host Pentacme siamensis (PES) using the universal primers for Astraeus spp.: AUPF1 and AUPR1 (A), and AUPF3 and AUPR3 (B). The 290 bp and 200 bp bands are the positive products of the two pairs of primers, respectively.

Fig. 6. - PCR testing the presence of Astraeus spp. in the DNA from soil samples surrounded by the host Anthoshorea roxburghii (AR), Hopea odorata (HO), and Anisoptera scaphula (AS) using the universal primers for Astraeus spp.: AUPF1 and AUPR1 (A), and AUPF3 and AUPR3 (B). The 290 bp and 200 bp bands are the positive products of the two pairs of primers, respectively.

Fig. 7. - PCR testing the presence of Astraeus spp. in the DNA from soil samples surrounded by the host Pinus latteri (PL), Pinus kesiya (PK), Parashorea stellata (PS), and Dipterocarpus obtusifolius (DO) using the universal primers for Astraeus spp.: AUPF1 and AUPR1 (A), and AUPF3 and AUPR3 (B). The 290 bp and 200 bp bands are the positive products of the two pairs of primers, respectively.

Fig. 8. - PCR testing the presence of Astraeus spp. in the DNA from soil samples surrounded by the host Dipterocarpus obtusifolius (DO), Dipterocarpus tuberculatus (DT), Dipterocarpus turbinatus (DTB), Dipterocarpus gracilis (DG), and Dipterocarpus costatus (DC) using the universal primers for Astraeus spp.: AUPF1 and AUPR1 (A), and AUPF3 and AUPR3 (B). The 290 bp and 200 bp bands are the positive products of the two pairs of primers, respectively.

Fig. 9. - PCR testing the presence of Astraeus spp. in the DNA from soil samples surrounded by the host Dipterocarpus baudii (DB), Pentacme siamensis (PES), Shorea obtusa (SO), Dipterocarpus obtusifolius (DO), and Hopea odorata (HO) using the universal primers for Astraeus spp.: AUPF1 and AUPR1 (A), and AUPF3 and AUPR3 (B). The 290 bp and 200 bp bands are the positive products of the two pairs of primers, respectively.

Table 2. Accuracy of designed primer pairs for Astraeus species.

Calculation	Primer pair
	AUPF1/AUPR1	AUPF3/AUPR3	AAF4/AAR4	AOF4/AOR4	ASF2/ASR4
No. of positive samples (detected by PCR)	94	91	23	68	25
True positive (TP)	89	89	20	68	25
True negative (TN)	33	36	105	61	104
False positive (FP)	5	2	3	0	0
False negative (FN)	3	3	2	1	1
Total samples	130	130	130	130	130
False positive rate	0.1316	0.0526	0.0278	0	0
False negative rate	0.0326	0.0326	0.0909	0.0145	0.0385
Sensitivity (true positive rate)	0.8684	0.9474	0.9722	1	1
Specificity (true negative rate)	0.9674	0.9674	0.9091	0.9855	0.9615
Accuracy	0.9385	0.9615	0.9615	0.9923	0.9923

Based on these results, the primer AUPF1/AUPR1 had a false positive rate of 13.16% and false negative rate of 3.26%, resulting in a true positive rate of 86.84% and true negative rate of 96.74%. Conversely, the primer AUPF3/AUPR3 exhibited a false positive rate of 5.26% and false negative rate of 3.26%, resulting in a true positive rate of 94.74% and true negative rate of 96.74%. Overall, AUPF1/AUPR1 and AUPF3/AUPR3 had accuracy rates of 93.85% and 96.74%, respectively. Although the results of both primer pairs were largely consistent, soil samples displayed non-specific bands, despite the clear presence of target bands in the positive samples (Table 2).

3.2.2. Accuracy of species-specific primers

Of the 130 soil samples, 23 exhibited a positive band for A. asiaticus, 68 for A. odoratus, and 25 for A. sirindhorniae (Figs. 10, 11, 12, 13). Among these, 38 samples had absent Astraeus, 69 contained only one species of Astraeus, 21 had two species of Astraeus, and only two samples showed the presence of all three Astraeus species (Table 2; Supplementary Table S2). The primer pair AAF4/AAR4, displaying a positive band of 690 bp in 23 samples, correctly identified 20 samples as true positives and misidentified three samples as false positives (Supplementary Table S3). Of the 107 samples with no bands, 105 were correctly identified as true negatives and two samples were falsely identified as negatives. Consequently, this primer pair yielded a false positive rate of 2.78% and a false negative rate of 9.09%, resulting in a true positive rate, true negative rate, and accuracy of 90.91%, 97.22%, and 96.15%, respectively (Table 2). The primer AOF4/AOR4, which showed a positive band of 490 bp in 68 samples, produced true positive results for all 68 samples. Of the 62 samples that did not reveal any bands, 61 were true negative results and only one was a false negative result (Supplementary Table S3), resulting in a false positive rate of 0% and false negative rate of 1.45%. The true positive rate, true negative rate, and accuracy of this primer pair were 100%, 98.55%, and 99.23%, respectively (Table 2). The primer ASF2/ASR4, revealing a positive band of 533 bp in 25 samples, produced true positive results for all 25 samples. Among the 105 samples with no bands, 104 were correctly identified as negative, while only one false negative occurred, resulting in false positive rate, true positive rate, true negative rate, and accuracy of 0%, 3.85%, 100%, 96.15%, and 99.23%, respectively (Table 2).

Fig. 10. - PCR detection of Astraeus spp. in the soil DNA using species-specific primers for Astraeus asiaticus (A), A. odoratus (B), and A. sirindhorniae (C). Soil samples are named according to the host, Shorea obtusa (SO), Dipterocarpus obtusifolius (DO), and Hopea odorata (HO). The expected positive bands for each species were 693 bp, 490 bp and 533 bp, respectively.

Fig. 11. - PCR detection of Astraeus spp. in the soil DNA using species-specific primers for Astraeus asiaticus (A), A. odoratus (B), and A. sirindhorniae (C). Soil samples are named according to the host, Pentacme siamensis (PES), and Dipterocarpus gracilis (DG). The expected positive bands for each species were 693 bp, 490 bp and 533 bp, respectively.

Fig. 12. - PCR detection of Astraeus spp. in the soil DNA using species-specific primers for Astraeus asiaticus (A), A. odoratus (B), and A. sirindhorniae (C). Soil samples are named according to the host, Anthoshorea roxburghii (AR), Hopea odorata (HO), and Pinus kesiya (PK). The expected positive bands for each species were 693 bp, 490 bp and 533 bp, respectively.

Fig. 13. - PCR detection of Astraeus spp. in the soil DNA using species-specific primers for Astraeus asiaticus (A), A. odoratus (B), and A. sirindhorniae (C). Soil samples are named according to the host, Pinus latteri (PL), Dipterocarpus obtusifolius (DO), D. tuberculatus (DT), and D. turbinatus (DTB). The expected positive bands for each species were 693 bp, 490 bp and 533 bp, respectively.

Moreover, we conducted sequencing on several positive samples to validate the reliability of identification using our primers. Our findings revealed that the species identified through sequencing aligned with that using species-specific primers. In particular, all selected samples that had positive results (SO21, PES37, and DT01) for A. asiaticus showed the sequencing results corresponding to A. asiaticus sequences from GenBank (Supplementary Table S4). Similarly, the sequences for all positive results for A. odoratus and A. sirindhorniae corresponded to A. odoratus and A. sirindhorniae from GenBank (Supplementary Table S4), respectively.

3.3. Distribution of Astraeus spp.

Of the 130 soil samples collected from various locations, forest types, and host species, all three Astraeus species were identified from six regions of Thailand (i.e., the Northern, North-eastern, Eastern, South-western, Central, and Peninsular regions). Most host tree species were associated with Astraeus, with only four exceptions: Anisoptera scaphula (Roxb.) Kurz, Dipterocarpus baudii Korth., D. costatus C.F. Gaertn., and Parashorea stellata Kurz (Supplementary Table S4). Astreaus spp. were identified in six of 24 soil samples (25.00%) from evergreen forests, whereas they were found in 86 of 106 soil samples (81.13%) from deciduous forests (Supplementary Table S4), suggesting that the occurrence of Astraeus spp. varies with the forest type.

4. Discussion

4.1. Sensitivity

4.1.1. Universal primers for Astraeus spp.

The two sets of universal primers (AUPF1/AUPR1 and AUPF3/AUPR3) designed for Astraeus spp. exhibit equally high sensitivity, successfully amplifying DNA from all three Astraeus species even at very low concentrations (500 fg/µL). Nevertheless, when testing on soil DNA, several non-specific bands were observed, which were typically lighter and larger in size than the target amplicons (290 bp and 200 bp). The presence of these non-specific bands could be attributable to the non-specific binding of primers in multi-species targeted DNA. Nevertheless, both primer pairs remained robust in detecting Astraeus spp., as they yielded consistent results in the majority of samples (121 of 130, 93.08%). Given that the bands were thicker with the AUPF3/AUPR3 primers, they were easier to identify compared to the bands obtained with AUPF1/AUPR1 primers. This phenomenon could be attributable to the greater amplification efficiency with smaller product sizes (Shagin et al., 1999). Furthermore, the primer pair AUPF3/AUPR3 exhibited higher rate of true positive (94.74%) compared to the AUPF1/AUPR1 primer pair (86.84%). Both primer pairs had a similar level of true negative rate 96.74% (Table 2), whereas the accuracy of AUPF3/AUPR3 (96.15%) was slightly higher than that of AUPF1/AUPR1 (93.85%).

The differences in band intensity among samples may stem from differences in the DNA quantity across various soil samples. In our sensitivity test with mushroom DNA, lower DNA concentrations resulted in lighter bands. However, band intensity might also be influenced by the Astraeus species, as A. asiaticus exhibits a lower sensitivity compared to the other two species (Fig. 1). Sequences obtained from certain positive samples confirmed that these two pairs of universal primers can bind to at least three Astraeus species in Thailand. Moreover, they have potential for detection of other Astraeus species such as A. koreanus (V.J. Staněk) Kreisel, A. ryoocheoninii Ryoo and A. sapidus (Massee) P.-A. Moreau in Asia because the primers perfectly match the DNA sequences of these Astraeus species (Supplementary Figs. S1-S4), making them effective for detecting Astraeus species in soil. In certain cases (such as PL21 and PES43) where species-specific primers failed to identify Astraeus, the universal primers proved effective. The sequences obtained from the PCR product using these primers confirmed the Astraeus species, highlighting the robustness of our universal primers in detecting Astraeus from soil DNA using a simple PCR technique. Some of these sequences were slightly different sizes from expected (e.g. 292 bp instead of 290 bp; or 220 bp instead of 200 bp), which may due to differences in ITS sequences of each Astreaus species.

4.1.2. Species-specific primers for Astraeus spp.

The species-specific primers (AAF4/AAR4, AOF4/AOR4, and ASF2/ASR4) developed in this study amplified DNA only from their respective targeted species. No cross-amplification occurred between species, even when the template DNA contained DNA from more than one species (Fig. 3). The primers for A. asiaticus (AAF4/AAR4) were less sensitive compared to those for the other two species, A. odoratus and A. sirindhorniae (AOF4/AOR4 and ASF2/ASR4), as they required template DNA > 50 pg/µL, whereas the other two primer pairs could detect Astraeus using a 100-fold lower DNA level (i.e., 500 fg/µL). Although we found that the primer AOF4 was not specific to only A. odoratus (could bind to A. hygrometricus and A. ryocheoninii) and contained one base insertion (because some A. odoratus sequences have this insertion) (Supplementary Fig. S5), this experiment has proven that it did not affect the result when using together with AOR4 because AOR4 was species-specific. When testing soil DNA, all three species-specific primers exhibited the levels of true positive rate exceeding 97% (97% for AAF4/AAR4 and 100% for AOF4/AOR4 and ASF2/ASR4). The slightly true positive rate, true negative rate, and accuracy of the primer for A. asiaticus compared to the other two species may be attributable to its larger PCR product size (690 bp) compared to the other two pairs (490 and 533 bp). Furthermore, certain intricate factors may be associated with the A. asiaticus ITS sequences, as indicated by its lower sensitivity compared to the other two species even in tests employing the two pairs of universal primers (Fig. 1).

4.2. Distribution of Astraeus spp.

Astraeus is an ECM mushroom group that is distributed across temperate and tropical forest ecosystems (Phosri et al., 2004). In Asia, the genus primarily forms ECM associations in various woody plant species within the families Dipterocarpaceae, Fagaceae, and Pinaceae (Mortimer et al., 2012; Phosri et al., 2004, 2007, 2014). Previously, a few dipterocarps species, e.g., Dipterocarpus alatus Roxb. ex G. Don, D. tuberculatus Roxb., and Anthoshorea roxburghii (G. Don) P.S. Ashton & J. Heck., were confirmed to have ECM associations with Thai Astraeus species (Kaewgrajang et al., 2013, 2019; Suwannasai et al., 2020).

This study demonstrated the prevalence of three Astraeus species associated with four host species of Dipterocarpaceae, including one species of Anthoshorea (Anthoshorea roxburghii), one species of Pentacme (Pentacme siamensis (Miq.) Kurz), one species of Shorea (Shorea obtusa Wall. ex Blume), and one species of Hopea (Hopea odorata Roxb.), primarily distributed in deciduous forests. However, no Astraeus species were detected in soil samples collected from the four dipterocarp species, namely Anisoptera scaphula, Dipterocarpus baudii, D. costatus, and P. stellata. In accordance with the floristic regions of Thailand, most species naturally thrive in the evergreen forest types, i.e., tropical evergreen rain forests and dry evergreen forests (Pooma et al., 2017). Consequently, this study demonstrated that it is unlikely to identify Astraeus spp. in evergreen forests compared to deciduous forests (Supplementary Table S4). To deepen our understanding, further research should explore the ecological niche of Astraeus spp. Astraeus sirindhorniae, previously reported solely in deciduous dipterocarp forests located in the North and North-eastern regions (Phosri et al., 2014), was also identified in the evergreen forest type in the Southern region, which has never been reported before. The molecular biological method of specific primer identification was confirmed to have a high efficiency and accuracy. This method is commonly employed for fungal identification across diverse fungal materials, such as fruiting body, hyphae, or soil (Adeniyi et al., 2018; Horisawa et al., 2009; Kim & Han, 2009; Lee et al., 2020; Shen et al., 2020). Furthermore, our study highlights the reliability of the primers in identifying both known and potentially novel Astraeus species in the future, particularly immature fruit bodies partially located beneath the soil, and they could even be applied for exploring species distribution.

5. Conclusion

In this study, three well-designed species-specific primers, namely AAF4/AAR4, AOF4/AOR4, and ASF2/ASR4, were developed for DNA-based identification from A. asiaticus, A. odoratus, and A. sirindhorniae, respectively. Additionally, two universal primers (AUPF1/AUPR1 and AUPF3/AUPR3) were designed to identify the presence of Thai Astraeus species in soil. This method proved to be effective, time- and cost-efficient, and highly sensitive, offering potential application in further studies on species distribution as well as for the conservation and habitat management of Astraeus species.

Supplementary Materials

Supplementary online materials are available at https://doi.org/10.69199/data.mycosci.27146823, https://doi.org/10.69199/data.mycosci.27146871, https://doi.org/10.69199/data.mycosci.27146889, https://doi.org/10.69199/data.mycosci.27146982, https://doi.org/10.69199/data.mycosci.27147390, https://doi.org/10.69199/data.mycosci.27147399, https://doi.org/10.69199/data.mycosci.27147414, https://doi.org/10.69199/data.mycosci.27147432, https://doi.org/10.69199/data.mycosci.27147438, https://doi.org/10.69199/data.mycosci.27147453, https://doi.org/10.69199/data.mycosci.27147462, https://doi.org/10.69199/data.mycosci.27147486, https://doi.org/10.69199/data.mycosci.27147495, https://doi.org/10.69199/data.mycosci.27147507, https://doi.org/10.69199/data.mycosci.27247383

Acknowledgments

This work was financially supported primarily by the Kasetsart University Research and Development Institute (grant number FF(KU)5.66) and partially funded by the National Research Council of Thailand through the Knowledge Hub for Integrated Economic Trees: Plantation Establishment, Management, Utilization and Industry. In this study, some samples were provided by Department of National Parks, Wildlife and Plant Conservation, Thailand under the grant number FF:179988.

References

• Adeniyi, M., Titilawo, Y., Oluduro, A., Odeyemi, O., Nakin, M., & Okoh, A. I. (2018). Molecular identification of some wild Nigerian mushrooms using internal transcribed spacer: polymerase chain reaction. AMB Express, 8. https://doi.org/10.1186/s13568-018-0661-9
• Altman, D. G., & Bland, J. M. (1994). Diagnostic tests. 1: sensitivity and specificity. BMJ, 308, 1552. https://doi.org/10.1136/bmj.308.6943.1552
• Camacho, C., Coulouris, G., Avagyan, V., Ma, N., Papadopoulos, J., Bealer, K., & Madden, T. L. (2009). BLAST+: architecture and applications. BMC Bioinformatics, 10, 421. https://doi.org/10.1186/1471-2105-10-421
• Doyle, J. J., & Doyle, J. L. (1990). Isolation of plant DNA from fresh tissue. Focus, 12(1), 13-15.
• Fangfuk, W., Okada, K., Petchang, R., To-anum, C., Fukuda, M., & Yamada, A. (2010). In vitro mycorrhization of edible Astraeus mushrooms and their morphological characterization. Mycoscience, 51(3), 234-241. https://doi.org/10.1007/s10267-009-0031-1
• Hebert, P. D. N., Cywinska, A., Ball, S. L., & DeWaard, J. R. (2003). Biological identifications through DNA barcodes. Proceedings. Biological Sciences, 270, 313-321. https://doi.org/10.1098/rspb.2002.2218
• Horisawa, S., Sakuma, Y., & Doi, S. (2009). Qualitative and quantitative PCR methods using species-specific primer for detection and identification of wood rot fungi. Journal of Wood Science, 55(2), 133-138. https://doi.org/10.1007/s10086-008-1011-3
• IPNI. (2023). International Plant Names Index. The Royal Botanic Gardens, Kew, Harvard University Herbaria & Libraries and Australian National Herbarium. Retrieved 9 Nov, 2023, from http://www.ipni.org.
• Kaewgrajang, T., Sakolrak, B., & Sangwanit, U. (2019). Growth response of Dipterocarpus tuberculatus and Shorea roxburghii seedlings to Astraeus odoratus. Environment and Natural Resources Journal, 17(3), 80-88. https://doi.org/10.32526/ennrj.17.3.2019.25
• Kaewgrajang, T., Sangwanit, U., Iwase, K., Kodama, M., & Yamato, M. (2013). Effects of ectomycorrhizal fungus Astraeus odoratus on Dipterocarpus alatus seedlings. Journal of Tropical Forest Science, 25(2), 200-205.
• Katoh, K., & Standley, D. M. (2013). MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Molecular Biology and Evolution, 30(4). https://doi.org/10.1093/molbev/mst010
• Kim, J.-H., & Han, Y.-H. (2009). Development of specific primer for Tricholoma matsutake. Mycobiology, 37(4), 317. https://doi.org/10.4489/myco.2009.37.4.317
• Kirse, A., Bourlat, S. J., Langen, K., & Fonseca, V. G. (2021). Unearthing the potential of soil eDNA metabarcoding-Towards best practice advice for invertebrate biodiversity assessment. Frontiers in Ecology and Evolution, 9(May), 1-13. https://doi.org/10.3389/fevo.2021.630560
• Lebonah, D. E., Dileep, A., Chandrasekhar, K., Sreevani, S., Sreedevi, B., & Pramoda Kumari, J. (2014). DNA barcoding on bacteria: A review. Advances in Biology, 2014(2), 1-9. https://doi.org/10.1155/2014/541787
• Lee, S. H., Jung, H. J., Hong, S. B., Choi, J. I., & Ryu, J. S. (2020). Molecular markers for detecting a wide range of Trichoderma spp. that might potentially cause green mold in Pleurotus eryngii. Mycobiology, 48(4), 1-8. https://doi.org/10.1080/12298093.2020.1785754
• Łuczaj, Ł., Lamxay, V., Tongchan, K., Xayphakatsa, K., Phimmakong, K., Radavanh, S., Kanyasone, V., Pietras, M., & Karbarz, M. (2021). Wild food plants and fungi sold in the markets of Luang Prabang, Lao PDR. Journal of Ethnobiology and Ethnomedicine, 17(1), 1-27. https://doi.org/10.1186/s13002-020-00423-y
• Metz, C. E. (1978). Basic principles of ROC analysis. Seminars in Nuclear Medicine, 8(4), 283-298. https://doi.org/10.1016/s0001-2998(78)80014-2
• Mortimer, P. E., Karunarathna, S. C., Li, Q., Gui, H., Yang, X., Yang, X., He, J., Ye, L., Guo, J., Li, H., Sysouphanthong, P., Zhou, D., Xu, J., & Hyde, K. D. (2012). Prized edible Asian mushrooms: Ecology, conservation and sustainability. Fungal Diversity, 56(1), 31-47. https://doi.org/10.1007/s13225-012-0196-3
• Nilsson, R. H., Larsson, K. H., Taylor, A. F. S., Bengtsson-Palme, J., Jeppesen, T. S., Schigel, D., Kennedy, P., Picard, K., Glöckner, F. O., Tedersoo, L., Saar, I., Kõljalg, U., & Abarenkov, K. (2019). The UNITE database for molecular identification of fungi: Handling dark taxa and parallel taxonomic classifications. Nucleic Acids Research, 47(D1), D259-D264. https://doi.org/10.1093/nar/gky1022
• Pavithra, M., Greeshma, A. A., Karun, N. C., & Sridhar, K. R. (2015). Observations on the Astraeus spp. of Southwestern India. Mycosphere, 6(4), 421-432. https://doi.org/10.5943/mycosphere/6/4/4
• Pawlowski, J., Audic, S., Adl, S., Bass, D., Belbahri, L., Berney, C., Bowser, S. S., Cepicka, I., Decelle, J., Dunthorn, M., Fiore-Donno, A. M., Gile, G. H., Holzmann, M., Jahn, R., Jirků, M., Keeling, P. J., Kostka, M., Kudryavtsev, A., Lara, E., … de Vargas, C. (2012). CBOL protist working group: Barcoding eukaryotic richness beyond the animal, plant, and fungal kingdoms. PLoS Biology, 10(11), e1001419. https://doi.org/10.1371/journal.pbio.1001419
• Petersen, R. H. & Hughes K. W. (1999). Species and speciation in mushrooms: Development of a species concept poses difficulties. BioScience, 49(6), 440-452. https://doi.org/10.2307/1313552
• Phengklai, C. (1972). Pinaceae. In: T. Smitinand & K. Larsen (Eds.), Flora of Thailand. Vol.2(2) (pp. 193-194). The TISTR Press.
• Phosri, C., Martín, M. P., Sihanonth, P., Whalley, A. J. S., & Watling, R. (2007). Molecular study of the genus Astraeus. Mycological Research, 111(3), 275-286. https://doi.org/10.1016/j.mycres.2007.01.004
• Phosri, C., Watling, R., Martín, M. P., & Whalley, A. J. S. (2004). The genus Astraeus in Thailand. Mycotaxon, 89(2), 453-463.
• Phosri, C., Watling, R., Suwannasai, N., Wilson, A., & Martín, M. P. (2014). A new representative of star-shaped fungi: Astraeus sirindhorniae sp. nov. from Thailand. PLoS ONE 9, e71160. https://doi.org/10.1371/journal.pone.0071160
• Pooma, R., Poopath, M., & Newman, M. F. (2017). Dipterocarpaceae. In: T. Santisuk & H. Balslev (Eds.), Flora of Thailand. Vol. 13(4) (pp. 557-685). Prachachon Co. Ltd.
• POWO. (2023). Plants of the World Online. Facilitated by the Royal Botanic Gardens, Kew. Retrieved 9 Nov, 2023, from http://www.plantsoftheworldonline.org/.
• Rosa, L. H., da Silva, T. H., Ogaki, M. B., Pinto, O. H. B., Stech, M., Convey, P., Carvalho-Silva, M., Rosa, C. A., & Câmara, P. E. A. S. (2020). DNA metabarcoding uncovers fungal diversity in soils of protected and non-protected areas on deception Island, Antarctica. Scientific Reports, 10(1), 1-9. https://doi.org/10.1038/s41598-020-78934-7
• Sanmee, R., Dell, B., Lumyong, P., Izumori, K., & Lumyong, S. (2003). Nutritive value of popular wild edible mushrooms from northern Thailand. Food Chemistry, 82(4), 527-532. https://doi.org/10.1016/S0308-8146(02)00595-2
• Shagin, D. A., Lukyanov, K. A., Vagner, L. L., & Matz, M. V. (1999). Regulation of average length of complex PCR product. Nucleic Acids Research, 27(18), e23-i-e23-iii. https://doi.org/10.1093/nar/27.18.e23-i
• Shen, Q., Li, C., Xie, M., Li, W., Qian, Z., & Zhang, J. (2020). A novel PCR-based approach for rapid identification of Morchella sextelata using species-specific primers. Current Microbiology, 77(2), 232-237. https://doi.org/10.1007/s00284-019-01819-0
• Skelton, J., Cauvin, A., & Hunter, M. E. (2022). Environmental DNA metabarcoding read numbers and their variability predict species abundance, but weakly in non-dominant species. Environmental DNA, April, 1-13. https://doi.org/10.1002/edn3.355
• Suwannasai, N., Dokmai, P., Yamada, A., Watling, R. O. Y., & Phosri, C. (2020). First ectomycorrhizal syntheses between Astraeus sirindhorniae and Dipterocarpus alatus (Dipterocarpaceae), pure culture characteristics, and molecular detection. Biodiversitas, 21(1), 231-238. https://doi.org/10.13057/biodiv/d210130
• White, T. J., Bruns, T., Lee, S., & Taylor, J. (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: M. A. Innis, D. H. Gelfand, J. J. Sninsky, & T. J. White (Eds.), PCR protocols: A guide to methods and applications (pp. 315-322). Academic Press.
• Wijayawardene, N. N., Hyde, K. D., Al-Ani, L. K. T., Tedersoo, L., Haelewaters, D., Rajeshkumar, K. C., Zhao, R. L., Aptroot, A., Leontyev, D. V., Saxena, R. K., Tokarev, Y. S., Dai, D. Q., Letcher, P. M., Stephenson, S. L., Ertz, D., Lumbsch, H. T., Kukwa, M., Issi, I. V., Madrid, H., … Thines, M. (2020). Outline of Fungi and fungus-like taxa. Mycosphere, 11(1), 1060-1456. https://doi.org/10.5943/mycosphere/11/1/8
• Wilson, A. W., Binder, M., & Hibbett, D. S. (2011). Effects of gasteroid fruiting body morphology on diversification rates in three independent clades of fungi estimated using binary state speciation and extinction analysis. Evolution, 65(5), 1305-1322. https://doi.org/10.1111/j.1558-5646.2010.01214.x
• Xu, J. (2016). Fungal DNA barcoding. Genome, 59(11), 913-932. https://doi.org/10.1139/gen-2016-0046