2016 年 39 巻 6 号 p. 984-992
This study investigated the effects of compounds isolated from 70% ethanol (EtOH) extraction of Smilax china L. (SCE), a plant belonging to the family Smilacaceae on nicotine-induced endothelial dysfunction (ED) in human umbilical vein endothelial cells. We isolated 10 compounds from ethyl acetate (EtOAc) fraction of 70% EtOH extract of SCE and investigated their inhibitory effect on nicotine-induced ED in endothelial cells. Kaempferol, kaempferol 7-O-α-L-rhamnopyranoside, puerarin and ferulic acid showed strong inhibition of nicotine-induced vascular cell adhesion molecule (VCAM-1) expression while kaempferol, kaempferin, and caffeic acid attenuated intercellular adhesion molecule (ICAM-1) expression. Lepidoside, caffeic acid and methylsuccinic acid caused the highest up-regulated expression of endothelial nitric oxide synthase at the protein level with caffeic acid and ferulic acid showing strong inhibitory effects on inducible nitric oxide synthase (iNOS) expression. In addition, ferulic acid and kaempferol showed inhibition against interleukin-8 (IL-8) and interleukin-1β (IL-1β) expression while ferulic acid and caffeic acid showed comparatively higher inhibition of ED associated tumor necrosis factor-α (TNF-α) expression. These results show the potential of the aforementioned compounds to reverse the toxic effects of nicotine on the endothelium.
Normal vascular endothelium possesses numerous important physiological properties. Endothelial disfunction (ED) could result in vascular diseases such as atherosclerosis and hypertension. To maintain vascular homeostasis, the endothelium produces components of the extracellular matrix such as collagen and a variety of regulatory chemical mediators, including nitric oxide (NO), adhesion molecules (vascular cell adhesion molecule (VCAM), LAM, intercellular adhesion molecule (ICAM)), and cytokines, among them tumor necrosis factor-α (TNF-α).1) Under normal physiological conditions, there is a balanced release of components of the extracellular matrix. ED is the change of these properties, either in the basal state or after stimulation, which is inappropriate with regard to the preservation of organ function. ED is characterized by the increased expression of selectins, VCAM-1, and ICAM-1 which promotes the adherence of monocytes and enhances vasoconstriction.2,3)
Studies have shown that adhesion molecule expression is induced by proinflammatory cytokines such as interleukin-1β (IL-1β), interleukin-8 (IL-8), and TNF-α, by the acute-phase protein, C-reactive protein (CRP), which is produced by the liver in response to IL-6, by protease-activated receptor signaling, by ox-low density lipoprotein (LDL) uptake via ox-LDL receptor-1 (LOX-1), and by CD40/CD40 ligand (CD40L and CD154) interactions.2,4,5) This implies that ED is closely associated with a shift of the endothelium towards a proinflammatory state.
NO is an important endothelium-derived substance which plays a pivotal role in the regulation of vascular tone and vasomotor function.4) ED is associated with diminished expression or availability of endothelial nitric oxide synthase (eNOS) and/or an imbalance in the relative contribution of endothelium-derived relaxing and contracting factors and has been proposed as a major mechanism of ED and a contributor to atherosclerosis.6,7)
Nicotine, a major constituent of tobacco, has been shown to attract inflammatory cells onto the endothelium and induce endothelium dysfunction, an early marker of atherosclerosis.8) The actions of nicotine have been extensively investigated in animals and in a variety of cell systems.9–12) Studies have shown that nicotine has toxic effects on the endothelium and that the nitric oxide synthase-dependent responses of peripheral arterioles are impaired during both acute and chronic exposure to nicotine.13,14) Nicotine acts by up-regulating TNF-α, which plays an important role in the corruption of vascular homeostasis in certain pathologies.15) Chronic nicotine exposure through cigarette smoking induces ED by down-regulating the expression of eNOS, increasing the generation of reactive oxygen species (ROS) and up-regulating asymmetric dimethyl arginine, an endogenous inhibitor of eNOS.16,17)
This study explored the effect of the constituent compounds of Smilax china L. (SCE) on nicotine-induced ED. SCE belongs to the family of plants called Smilacaceae and is widely distributed in tropical and temperate zones throughout the world, and especially in tropical regions of East Asia, and South and North America.18) SCE has long been used as a remedy to various illnesses including diuretic, rheumatic arthritic, gout, tumor, and inflammatory diseases and is also used as food in Korea and other parts of China.19) Stilbenes, flavonoids and steroidal saponins have been reported as the main active components of SCE.20,21) Figure 1A represents chemical structures of the components of SCE. Kaempferol (1), kaempferin (2), kaempferol 7-O-α-L-rhamnopyranoside (3), kaempferitrin (4), lepidoside (5), vitexin (6), puerarin (7), ferulic acid (8), caffeic acid (9), methylsuccinic anhydride (10).

Kaempferol (1), kaempferin (2), kaempferol 7-O-α-L-rhamnopyranoside (3), kaempferitrin (4), lepidoside (5), vitexin (6), puerarin (7), ferulic acid (8), caffeic acid (9), methylsuccinic anhydride (10).
The fresh leaves of SCE (31.5 kg) were collected at the Cho-lye mountain in Daegu, South Korea. Heung Mook Shin of the College of Korean Medicine, Dongguk University, South Korea verified the identity of the material. The plant materials have subsequently been deposited in the Korean Medical College of Dongguk University (Specimen number: A-2012-V-78). The fresh leaves were dried in the shade. The dry leaves of SCE (10.4 kg) were extracted with 70% ethanol at room temperature. The 70% ethanol extract was concentrated under reduced pressure and yielded black syrup (2.5 kg). The concentrated 70% ethanol extract was suspended in water (6.0 L) and partitioned successively with n-hexane (4×3 L, 628.6 g), CH2Cl2 (4×2 L, 72.0 g), EtOAc (3×3 L, 104.0 g), n-BuOH (3×3 L, 341.1 g) and H2O-soluble fractions (1367.1 g), respectively.
The EtOAc fraction (104.0 g) was chromatographed over a silica gel column (15×35 cm) and eluted with CH2Cl2–MeOH–H2O (100 : 0 : 0.1 to 0 : 100 : 0.1) gradient. Twelve fractions (SM-Et-1 to SM-Et-12) were collected and grouped according to their similar TLC patterns. The fraction SM-Et-3 (2.6 g) was applied to a silica gel column chromatography using CH2Cl2–MeOH–H2O (5 : 1 : 0.1 to 0 : 100 : 0.1) gradient, afforded 30 subfractions (SM-Et-3-1 to SM-Et-3-30). Subfraction SM-Et-3-26 (1.6 g) was chromatographed over MCI gel CHP20 column with MeOH–H2O as a stepwise gradient (1 : 1 to 1 : 0) to obtain 6 subfractions (SM-Et-3-26-1 to SM-Et-3-26-6). Subfraction SM-Et-3-26-3 (30.0 mg) was chromatographed on RP-C18 column (HPLC) using MeOH–H2O (80 : 20) to yield compound 7 (19.6 mg). Fraction SM-Et-4 (8.9 g) was chromatographed on a MCI gel CHP20 column with MeOH–H2O as a stepwise gradient (1 : 1 to 1 : 0) to obtain 10 subfractions (SM-Et-4-1 to SM-Et-4-10). Fraction SM-Et-4-1 (3.5 g) was chromatographed on silica gel column using n-hexane–acetone (4 : 1 to 0 : 1) gradient to yield compound 10 (3.2 g). Subfraction SM-Et-4-9 (312.7 mg) was chromatographed on a silica gel column using n-hexane–acetone (4 : 1 to 0 : 1) gradient to obtain 10 subfractions (SM-Et-4-9-1 to SM-Et-4-9-10). The fraction SM-Et-4-9-3 (115.3 mg) was chromatographed on Sephadex LH20 column using MeOH–H2O (1 : 1) to yield compound 9 (20.2 mg). Fraction SM-Et-6 (1.1 g) was chromatographed on a RP-C18 column using the MeOH–H2O mixture as a solvent system and eluted with a stepwise gradient (3 : 7 to 1 : 0) to obtain sixteen subfractions (SM-Et-6-1 to SM-Et-6-16). The subfraction SM-Et-6-11 (73.0 mg) was separated with RP-C18 column using acetonitrile: H2O (1 : 3) to yield compounds 6 (16.8 mg) and 8 (40.1 mg), respectively. Fraction SM-Et-7 (12.0 g) was subjected to RP-C18 column chromatography to produce 15 subfractions (SM-Et-7-1 to SM-Et-7-15). Subfraction SM-Et-7-11 (518.0 mg) was purified by silica gel column using CH2Cl2–MeOH–H2O (95 : 5 : 1) to afford compound 2 (109.9 mg). Also, the subfraction SM-Et-7-14 (269.7 mg) was purified by silica gel column using CH2Cl2–MeOH–H2O isocratic system as 90 : 10 : 1 to yield compound 1 (180.0 mg). The fraction SM-Et-11 (9.4 g) was isolated on HP-20 column with MeOH–H2O (1 : 0 to 0 : 1) gradient to yield 7 subfractions (SM-Et-11-1 to SM-Et-11-7). The subfraction SM-Et-11-4 (4.0 g) was chromatographed on a RP-C18 column using MeOH–H2O mixture as a solvent system and eluted with a stepwise gradient (3 : 7 to 9 : 11) to afford compounds 3 (65.0 mg), 4 (600.0 mg), and 5 (300.8 mg), respectively.
Analytical ConditionsThe HPLC system was a Waters 2695 separations module (Waters, Milford, MA, U.S.A.) with Waters 996 photodiode array detector. Separation was performed on Kinetex C18 column (250 mm ×4.6 mm, 5 µm, Torrance, CA, U.S.A.). After the optimization of conditions, mobile phase composed of deionized water containing 0.1% trifluoroacetic acid (A) and acetonitrile containing 0.1% trifluoroacetic acid was used with one-step gradient elution condition (0–60 min, 75–30%). The column temperature was maintained at 25°C. The flow rate was 1.0 mL/min and the injection volume was 10 µL. All samples were detected at wavelength 210 nm.
Preparation of Standard SolutionsAccurately weighed standard compounds were dissolved in dimethyl sulfoxide (DMSO) to produce stock concentrations of 100 mM. The stock solutions containing a standard compound were diluted to make 10 µM of working compounds.
Cell CultureHuman umbilical vein endothelial cells (HUVECs) were obtained from ATT C, U.S.A. HUVECs were cultured in Dulbecco’s modified Eagle’s medium (DMEM) (Gibco Inc., NY, U.S.A.) supplemented with 10% heat-inactivated fetal bovine serum (Gibco Inc.), penicillin (100 U/mL) and streptomycin (100 µg/mL) in a 5% CO2 incubator at 37°C.
Cell Viability AssayCell viability was determined using the 2,3-bis-(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide (XTT) cell viability kit (Roche Diagnostics, IN, U.S.A.). HUVECs (1×104 cells/well) were incubated in a 96-well plate with 10, 50, and 100 µM of Smilax china compound (SCC) for 24 h; 50 µL of XTT solution was added to each well, followed by incubation for 4 h. Absorbance was measured at 450 nm using a microplate reader (Molecular Devices, Sunnyvale, CA, U.S.A.). Cell viability was calculated as a percentage of untreated control.
NO MeasurementHUVECs were pre-incubated with 10 µM of each compound for 1 h followed by induction of ED using 10−6 M nicotine for 6 h. The supernatants of the cells were harvested for quantification of NO production. Relative levels of NO in supernatants were measured using an NO detection kit (iNtRON Biotechnology, Korea) according to the manufacturer’s instructions.
Total RNA Extraction and RT-PCRTotal RNA was extracted with TRIzol Reagent (Molecular Research Centre, OH, U.S.A.). Briefly, 2 µg total RNA was reverse-transcribed into cDNA using a first strand cDNA synthesis kit (Fermentas, Burlington, ON, Canada). The cDNA was used as a template for PCR amplification; 28 cycles of PCR was carried out using a DNA engine gradient cycler (MJ Research, Inc, MA, U.S.A.). This was followed by denaturation for 30 s at 95°C, annealing at 55–60°C for 1 min and extension at 72°C for 30 s. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal control. PCR primers used are shown in Table 1.
| Primer | Forward (5′→3′) | Reverse (5′→3′) |
|---|---|---|
| VCAM-1 | GCCTGGGAAGATGGTCGTG | GTGATCGGCTTCCCAGCC |
| ICAM-1 | CCAGGACCTGGCAATGCC | CACCCTCCACCTGGCAGCG |
| TNF-α | TGGAACTGGCAGAAGAGGC | TTTGAGATCCATGCCGTTGG |
| IL-8 | GAAAACTGGGTGCAGAGGGT | TCGGATATTCTCTTGGCCCT |
| IL-1β | CCGTGGACCTTCCAGGATG | GATCCACACTCTCCAGCTG |
| GAPDH | CCATGGAGAAGGCTGGG | CAAAGTTGTCATGGATGAC |
Cells were pre-incubated with 10 µM of each compound for 1 h, followed by stimulation with 10−6 M nicotine for 6 h. The cells were then collected on ice, washed three times with ice-cold phosphate buffered saline (PBS), and treated with a homogenizing buffer (Roche Diagnostics) containing protease inhibitor cocktail. After brief sonication, cell lysates were centrifuged at 12000 rpm for 10 min and supernatants were collected. Amounts of proteins present were determined using Bradford protein assay reagent (Bio-Rad Laboratories, Hercules, CA, U.S.A.); 20 µg/mL of protein was separated on 7.5–10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gel and then transferred to a polyvinylidene difluoride (PVDF) membrane, which was probed with specific primary antibodies of VCAM-1 (1 : 2500 dilution), ICAM-1 (1 : 5000 dilution), TNF-α (1 : 5000), eNOS (1 : 5000), iNOS (1 : 500) and β-actin (1 : 10000) overnight at 4°C with gentle shaking, followed by incubation with secondary antibodies for 1 h. β-Actin was used as an internal control (all antibodies were purchased from Santa Cruz Biotechnology, Inc., Dallas, TX, U.S.A). Blots were developed using enhanced chemiluminescence (Amersham Biosciences, Buckinghamshire, U.K.) and quantified using a Gel-pro analyzer (Media Cybernetics Inc., MD, U.S.A.).
Statistical AnalysisAll experiments were performed three times. One way ANOVA was performed to determine significant differences between the treatment groups and untreated control. Differences were considered significant at p<0.05 or p<0.01.
The isolated compounds (1–10) were each accurately weighed (1.0 mg) and then dissolved in 1 mL of methanol to produce stock standard solutions of 1000 µg/mL. The calibration curves were generated after diluting the stock solution with methanol. A reference solution of the ten isolated compounds at concentrations of 1.05–50.0 µg/mL was analyzed by HPLC/photo diode array (PDA). The regression equations were calculated in the form of y=ax+b, where y and x correspond to peak area and compound concentration, respectively. Each coefficient of correlation (r2) was >0.999, as determined by least square analysis, suggesting good linearity between the peak areas and the compound concentrations. The LOD and LOQ were evaluated at signal-to-noise (S/N) ratios of 3 and 10, respectively. The sample (14 mg/mL) from EtOAc fraction was accurately weighed individually to determine the contents of each compound. The solution was filtered through a 0.45 µm membrane filter and the filtrate was used as the test solution. Ten isolated compounds (1–10) were simultaneously determined by HPLC method (Fig. 1A). As shown in Fig. 1B, each compound from EtOAc fraction was well resolved with good resolution and without any interference. Among the isolates, the compound 4 showed the highest content (1.41%) and the second abundant component was compound 3 (1.22%). In addition, the contents of compounds 5, 8, and 10 were more than 0.1%, the contents value as 0.11, 0.39, and 0.68%, respectively (Table 2). The relative amount of each compound in 70% EtOH extract was calculated from each content in EtOAc fraction of 70% EtOH extract, based on the amounts of extraction and fractionation procedures. Figure 1B represents HPLC chromatograms of a standard mixture (A) and an EtOAc fraction of SCE (B). Kaempferol (1), kaempferin (2), kaempferol 7-O-α-L-rhamnopyranoside (3), kaempferitrin (4), lepidoside (5), vitexin (6), puerarin (7), ferulic acid (8), caffeic acid (9), methylsuccinic anhydride (10).

Kaempferol (1), kaempferin (2), kaempferol 7-O-α-L-rhamnopyranoside (3), kaempferitrin (4), lepidoside (5), vitexin (6), puerarin (7), ferulic acid (8), caffeic acid (9), methylsuccinic anhydride (10).
| Compounds | Regression equation | Correlation coefficient (r2) | Linear range (µg/mL) | LOD (µg/mL) | LOQ (µg/mL) | % (w/w) | |
|---|---|---|---|---|---|---|---|
| EtOAc fraction | 70% EtOH extract | ||||||
| Kaempferol (1) | y=14663.81x−3110.23 | 0.9993 | 1.05–50 | 0.071 | 0.237 | 0.07 | 0.003 |
| Kaempferin (2) | y=1210.67x−246.07 | 0.9997 | 1.05–50 | 0.084 | 0.280 | 0.08 | 0.003 |
| Kaempferol 7-O-α-L-rhamnopyranoside (3) | y=592.99x−88.04 | 0.9999 | 1.05–50 | 0.074 | 0.247 | 1.22 | 0.050 |
| Kaempferitrin (4) | y=526.27x−189.97 | 0.9993 | 1.05–50 | 0.068 | 0.227 | 1.41 | 0.058 |
| Lepidoside (5) | y=274.13x−39.20 | 0.9999 | 1.05–50 | 0.084 | 0.280 | 0.11 | 0.005 |
| Vitexin (6) | y=566.85x−136.06 | 0.9996 | 1.05–50 | 0.076 | 0.253 | 0.01 | 0.001 |
| Puerarin (7) | y=783.11x−173.43 | 0.9997 | 1.05–50 | 0.065 | 0.217 | 0.01 | 0.000 |
| Ferulic acid (8) | y=106.12x−4.63 | 0.9999 | 1.05–50 | 0.102 | 0.340 | 0.39 | 0.016 |
| Caffeic acid (9) | y=254.13x−30.43 | 0.9995 | 1.05–50 | 0.113 | 0.377 | 0.05 | 0.002 |
| Methylsuccinic anhydride (10) | y=300.41x−100.42 | 0.9998 | 1.05–50 | 0.215 | 0.717 | 0.68 | 0.028 |
LOD: Limit of detection; LOQ: Limit of quantification.
Compounds had no effect on cell viability at all concentrations and thus 10 µM was chosen as the working concentration compounds (Fig. 2).

Endothelial cells were pre-incubated with 10, 50, and 100 µM of SCC for 24 h. Cell viability was determined using the XTT assay. Changes in survival are represented as percentage of controls. Data represent the mean±S.D. Key: Kaempferol (1), kaempferin (2), kaempferol 7-O-α-L-rhamnopyranoside (3), kaempferitrin (4), lepidoside (5), vitexin (6), puerarin (7), ferulic acid (8), caffeic acid (9), methylsuccinic anhydride (10).
Kaempferol (1), kaempferol 7-O-α-L-rhamnopyranoside (3) and ferulic acid (8) significantly inhibited nicotine-induced expression of VCAM-1 at both the mRNA and protein levels. (Figs. 3A, B).

Endothelial cells pre-incubated with SCC were stimulated with nicotine for 6 h. Relative mRNA (A) and protein levels (B) of VCAM-1 were determined using PCR and Western blotting, respectively; 100 ng/mL indomethacin was used as a positive control. Data represent the mean±S.D. from three independent experiments. * p<0.05 when compared with control. Key: Kaempferol (1), kaempferin (2), kaempferol 7-O-α-L-rhamnopyranoside (3), kaempferitrin (4), lepidoside (5), vitexin (6), puerarin (7), ferulic acid (8), caffeic acid (9), methylsuccinic anhydride (10).
Puerarin (7), ferulic acid (8) caffeic acid (9), and methylsuccinic anhydride (10) inhibited mRNA expression of ICAM-1 while kaempferol (1) and kaempferin (2) and caffeic acid (9) attenuated ICAM-1 protein expression. Results are shown in Fig. 4.

Endothelial cells pre-incubated with compounds were stimulated with nicotine for 6 h. Relative mRNA (A) and protein levels (B) of ICAM-1 were determined using PCR and Western blotting, respectively; 100 ng/mL indomethacin was used as a positive control. Data represent the mean±S.D. from three independent experiments. * p<0.05 when compared with control. Key: Kaempferol (1), kaempferin (2), kaempferol 7-O-α-L-rhamnopyranoside (3), kaempferitrin (4), lepidoside (5), vitexin (6), puerarin (7), ferulic acid (8), caffeic acid (9), methylsuccinic anhydride (10).
Figure 5 shows the effects of SCC on nicotine-impaired eNOS expression. Lepidoside (5), caffeic acid (9) and methyl succinic anhydride (10) showed the highest up-regulation of eNOS. Kaempferol (1), kaempferol 7-O-α-L-rhamnopyranoside (3), kaempferitrin (4) and ferulic acid (8) also showed appreciable increase in eNOS above basal levels at the protein level.

Cells were pre-incubated with SCC for 1 h, followed by further stimulation with nicotine for 6 h. 10−5 M achetylcholine was used as a positive control. Data represent the mean±S.D. from three independent experiments. * p<0.05 when compared with control. Key: Kaempferol (1), kaempferin (2), kaempferol 7-O-α-L-rhamnopyranoside (3), kaempferitrin (4), lepidoside (5), vitexin (6), puerarin (7), ferulic acid (8), caffeic acid (9), methylsuccinic anhydride (10).
Inflammation is closely associated with ED. We therefore studied the effect of SCC IL-8, IL-1β, and TNF-α, and iNOS (Fig. 6). Results showed that only ferulic acid (8) inhibited nicotine induced expression of IL-8, IL-1β, TNF-α, iNOS and NO while kaempferol (1) and kaempferin (2) inhibited the expression of IL-8 and IL-1β, respectively. Kaempferol (1), kaempferol 7-O-α-L-rhamnopyranoside (3), and caffeic acid inhibited TNF-α expression at both the mRNA and protein levels, respectively, while puerarin (7) inhibited TNF-α expression at the protein level only. Kaempferol, kaempferitrin, puerarin ferulic acid caffeic acid, and methylsuccinic anhydride inhibited nicotine-induced iNOS expression whilst ferulic acid, caffeic acid and methyl succinic anhydride reduced NO to basal level.

Endothelial cells pre-incubated with compounds were stimulated with nicotine for 6 h. Relative mRNA IL-8 (A), IL-1β (B), TNF-α (C) and protein levels of TNF-α (D) and iNOS (E) were determined using PCR and Western blotting, respectively. Supernatant was collected and NO (F) was measured using a commercial NO kit; 100 ng/mL indomethacin was used as a positive control. Data represent the mean±S.D. from three independent experiments. * p<0.05 when compared with control. Key: Kaempferol (1), kaempferin (2), kaempferol 7-O-α-L-rhamnopyranoside (3), kaempferitrin (4), lepidoside (5), vitexin (6), puerarin (7), ferulic acid (8), caffeic acid (9), methylsuccinic anhydride (10).
Endothelium dysfunction is a shift of the endothelium vasculature towards a proinflammatory state. Adhesion molecules, VCAM-1 and ICAM-1 are expressed in response to endothelial damage. These adhesion molecules promote leukocyte recruitment along the endothelial surface, firm adhesion, activation and extravasion into tissue.3) Although ICAM-1 and VCAM-1 are structurally similar, VCAM-1 has a unique pattern of regulation - VCAM-1 is not expressed under baseline conditions but is rapidly induced by proatherosclerotic conditions in rabbits, mice, and humans.22) The endothelium, which serves as a nidus for atheroma formation, shows increased expression of cell adhesion molecules upon stimulation with nicotine. In consonance with a study by Ueno et al.,23) stimulation of endothelial cells by nicotine resulted in the expression of VCAM-1 and ICAM-1 with peak expression occurring 6 h after stimulation.
As widely reported, ED is closely associated with inflammation. In fact, ED is characterized by the shift of endothelium vasculature towards a proinflammatory state, accompanied by the elevation of TNF-α, IL-1β, and IL-8 expression.2,4,5) Platelet-endothelium interactions play a central role in hemostatic and inflammatory mechanisms within the vessel wall, and activated platelets induce the secretion of IL-1β from cultured endothelial cells.24) In addition, there is sufficient evidence in scientific literature supporting the involvement of IL-8 in the establishment and preservation of the inflammatory microenvironment of the insulted vascular wall.25) As also reported, and in congruence with our study, NO was transiently up-regulated upon nicotine stimulation.26) The altered interleukins, TNF-α and iNOS showed the shift of the endothelium towards a pro-inflammatory state.
NO generated by eNOS in endothelial cells plays an important role in vasorelaxation, inhibition of platelet aggregation, endothelial cell survival, and angiogenesis, resulting in protection of the vasculature against various pathological conditions.27,28) Thus, eNOS plays an important role in regulating vascular tone and integrity via eNOS-dependent nitric oxide production. In fact, impaired NO production contributes to progression of vascular disorders.29,30) Nicotine impairs nitric oxide production in the endothelium. In this study, we investigated the effect of SCE and SCC on nicotine-induced VCAM-1, ICAM-1, eNOS, TNF-α, IL-1β, and IL-8, iNOS, NO expression.
Kaempferol, kaempferol 7-O-α-L-rhamnopyranoside, and ferulic acid inhibited VCAM-1 expression at both the mRNA and protein levels (Figs. 3A, B). The ability of kaempferol to attenuate ED is well established. Xiao et al. previously reported its protective effect against endothelial damage.31) This study corroborates that finding and for the first time we demonstrate the inhibitory effect of kaempferol-7-O-α-L-rhamnopyroside and ferulic acid against nicotine-induced VCAM-1 expression.
Puerarin, ferulic acid, caffeic acid and methylsuccinic anhydride inhibited the expression of ICAM-1 at the mRNA level (Fig. 4A) while kaempferol and kaempferin and methyl succinic anhydride showed strong inhibition of ICAM-1 protein expression. Adhesion molecules are clinically significant in the progression of coronary atherosclerosis. Atherosclerosis and its clinical sequelae remain the leading cause of morbidity and mortality in both men and women of all racial groups in the United States and most westernized societies.32) The significant inhibitory effects of the afore-mentioned compounds mean they could be future candidates for the treatment of ED and its complications.
Kaempferol, kaempferol 7-O-α-L-rhamnopyranoside, kaempferitrin, lepidoside up-regulated eNOS expression. So did ferulic acid, caffeic acid and methyl succinic anhydride. Lepidoside, caffeic acid and methyl succinic anhydride showed strongest activity (Fig. 5). Previous reports have implicated kaempferol as a vasorelaxant which acts by improving nitric oxide production and decreasing asymmetric dimethylarginine level.31) and here we demonstrate the ability of other compounds to increase eNOS expression.
In addition, ferulic acid strongly inhibited the expression of TNF-α at both the mRNA (Fig. 6C) and protein levels (Fig. 6D). Kaempferol, kaempferitrin and lepidoside inhibited nicotine-induced iNOS. So did ferulic acid, caffeic and methyl succinic anhydride which showed very strong inhibition of iNOS, a well-known marker of inflammation. The ability of these compounds to mitigate its expression shows their significant anti-inflammatory activity. We also investigated the effects of SCC on total NO produced by the endothelial cells and observed a correlation between NO produced and iNOS. These results imply that although nicotine diminishes the availability of eNOS and increase the expression of iNOS, the net effect is towards an inflammatory state.
In conclusion, our results suggest that some of the compounds isolated from 70% EtOH extract of SCE could be future therapeutic candidates for the treatment of ED and its attendant complications.
Dongguk University Research Fund, 2015, supported this study.
The authors declare no conflict of interest.
The online version of this article contains supplementary materials.