SELEX-Based Screening of Exosome-Tropic RNA

Abstract

Cell-derived nanosized vesicles or exosomes are expected to become delivery carriers for functional RNAs, such as small interfering RNA (siRNA). A method to efficiently load functional RNAs into exosomes is required for the development of exosome-based delivery carriers of functional RNAs. However, there is no method to find exosome-tropic exogenous RNA sequences. In this study, we used a systematic evolution of ligands by exponential enrichment (SELEX) method to screen exosome-tropic RNAs that can be used to load functional RNAs into exosomes by conjugation. Pooled single stranded 80-base RNAs, each of which contains a randomized 40-base sequence, were transfected into B16-BL6 murine melanoma cells and exosomes were collected from the cells. RNAs extracted from the exosomes were subjected to next round of SELEX. Cloning and sequencing of RNAs in SELEX-screened RNA pools showed that 29 of 56 clones had a typical RNA sequence. The sequence found by SELEX was enriched in exosomes after transfection to B16-BL6 cells. The results show that the SELEX-based method can be used for screening of exosome-tropic RNAs.

Exosomes are small membrane vesicles with a diameter of 30–120 nm and are secreted from many types of cells. Since exosomes have been shown to be vehicles capable of intercellular delivery of various biological molecules including RNAs and proteins,¹⁾ they are postulated as new drug delivery carriers. Exosomes have several advantages such as high delivery efficiency, high biocompatibility, and protection of cargo from degradation. In particular, exosomes have been mentioned as delivery carriers for functional RNAs such as small interfering RNA (siRNA), which can be highly potent if they are efficiently delivered to target cells. Some studies have reported successful delivery of the functional RNAs by exosomes.^2,3) However, there are several challenges in the development of exosome-based RNA delivery systems.⁴⁾ One of the major challenges is the efficient loading of functional RNAs into exosomes.

RNA can be loaded into exosomes using two methods. One is the exogenous loading method, in which classical cell transfection methods such as electroporation are used to load RNA into pre-isolated exosomes. However, it was recently reported that electroporation induced the aggregation of RNA with iron detached from electrodes, and this aggregation overestimated the transfection efficiency.⁵⁾ In addition, it was also reported that electroporation denatured exosomes and formed aggregates.⁶⁾ The other is the endogenous loading method,⁷⁾ in which RNA or RNA-encoding vectors are transfected into cells and exosomes containing the RNA are collected after secretion from the transfected cells. As this endogenous loading method utilizes the natural sorting mechanism of cellular RNAs into exosomes, denaturation of exosomes is unlikely. However, this method is also hindered by the relatively poor loading efficiency of RNA into exosomes.

RNAs enriched in exosomes frequently contain specific sequences such as zipcode-like sequences with CUGCC and a miR-1289-binding site found in glioblastoma.⁸⁾ Although some other sequences and proteins which recognize those sequences have been reported,⁹⁾ the mechanism of RNA sorting into exosomes is still unclear.

It was reported that transfection of plasmid DNA encoding a green fluorescent protein (GFP) RNA ligated with a zipcode-like sequence to glioblastoma resulted in an increase in the amount of GFP RNA in exosomes. Although such sequences as zipcode-like sequences are expected to help in increasing the loading efficiency of RNAs in exosomes, the increase was approximately 2-fold. Therefore, methods for screening of new exosome-tropic exogenous RNAs are needed to find RNAs that have high exosome tropism.

In this study, we screened a pool of 80-base single strand RNAs containing a randomized 40-base sequence and primer binding sequences to identify new exosome-tropic RNA sequences. Furthermore, we did this using an aptamer selection method called systematic evolution of ligands by exponential enrichment (SELEX).¹⁰⁾ B16-BL6 murine melanoma cells were selected as model exosome-producing cells, as they secrete a large number of exosomes and plenty of information regarding the property and characteristics of the exosomes derived from the cells is available.^11–15)

MATERIALS AND METHODS

Cell Culture

The B16-BL6 murine melanoma cell line was obtained from the Cancer Chemotherapy Center of the Japanese Foundation for Cancer Research. B16-BL6 cells were cultured in Dulbecco’s modified Eagle’s minimum essential medium (Nissui Pharmaceutical, Tokyo, Japan) supplemented with 10% fetal bovine serum (FBS) and penicillin/streptomycin/L-glutamine at 37°C and 5% CO₂.

RNA Preparation

The RNA pool with 40-mer random sequence was generated in vitro through transcription of a DNA template strand of the sequence containing the T7 promoter (underlined): 5′-TAA TAC GAC TCA CTA TAG GGG GGA AGA TCT CGA CCA GA-N40-TGT GCG TCT ACA TGG ATC CTCA-3′, where N40 represents the 40 random nucleotides. In vitro transcription was performed using a ScriptMAX Thermo T7 Transcription Kit (Toyobo, Osaka, Japan) and synthesized RNAs were purified by gel extraction after polyacrylamide gel electrophoresis. For a comparison of exosome tropism, RNA-A, K, O and S, which represents RNAs found by the SELEX, and a scrambled sequence of RNA-A (Scr-A, 5′-GGG AAG AUC UCG ACC AGA GAU AUG UGU GGG UUC GGA CCG AUU CUU UCU UGC CCG CUA UUG UGC GUC UAC AUG GAU CCU CA-3′) were prepared by the same procedure described above.

Transfection

One day before transfection, B16-BL6 cells were seeded on 6-well plates at a density of 5×10⁵ cells/well. Cells were transfected with RNA using Lipofectamine 2000 (Thermo Fisher Scientific, Waltham, MA, U.S.A.) according to the manufacturer’s instructions. In brief, 1 µg of RNA was mixed with 3 µL of Lipofectamine 2000 and dissolved in OPTI-MEM I (Thermo Fisher Scientific) at a final concentration of 2 µg of RNA/mL. The resulting complex was added to the cells and incubated for 4 h. Then, the remaining complex was removed by replacing the medium, after which cells were incubated with FBS-derived exosome-free medium for an additional 24 h.

Purification of Exosomes

To remove exosomes from FBS, the culture media supplemented with FBS were centrifuged at 100000×g for 2 h using a P50AT2 rotor (Hitachi Koki, Tokyo, Japan; k factor=70). The supernatant was collected and used as the FBS-derived exosome-free culture medium for the collection of the cell-derived exosomes. The culture supernatants of B16-BL6 cells were collected after 24 h of incubation, and the exosomes in the supernatants were purified through ultracentrifugation as described previously.¹²⁾ In brief, the supernatants were sequentially centrifuged at 300×g for 10 min, 2000×g for 20 min, and 10000×g for 30 min followed by filtration through a 0.2 µm syringe filter. Then, ultracentrifugation at 100000×g for 1 h was performed using a P70AT2 rotor (Hitachi Koki, Tokyo, Japan; k factor=36) to pellet exosomes. After removal of the supernatant, exosomes were re-suspended in phosphate buffered saline (PBS), and the suspension was ultracentrifuged twice at 100000×g for washing using a P70AT2 rotor. Then, exosome pellets were re-suspended in PBS and stored at −80°C until use. Characteristics of isolated exosomes were analyzed as reported previously.¹⁵⁾

RNA Extraction and RT-PCR

RNA was extracted from cells and exosomes using Sepasol-RNA I Super G (Nacalai Tesque, Kyoto, Japan) followed by cDNA synthesis by Rever Tra Ace qPCR RT kt. A DNA pool was prepared through PCR using the cDNA as a template. PCR was performed using PrimeSTAR Max DNA Polymerase (TaKaRa Bio, Shiga, Japan). For quantitative analysis of RNA, a real-time PCR was performed with total cDNA using KAPA SYBR FAST ABI Prism 2X qPCR Master Mix (Kapa Biosystems, Boston, MA, U.S.A.). Amplified products were detected online via intercalation of a fluorescent dye using a StepOnePlus Real-time PCR System (Applied Biosystems, CA, U.S.A.) instrument. The amounts of RNA in exosomes were analyzed by the 2^−ΔΔCT method.¹⁶⁾ As the internal standard, 18S ribosomal RNA (rRNA) was used for exosomes as it was found in exosomes.¹⁾ β-Actin mRNA was used as an internal standard for cells.

SELEX Screening

Pooled RNAs were transfected into B16-BL6 cells. One day after the transfection, exosomes were collected from the supernatant and RNA was extracted from the exosomes followed by cDNA synthesis. A DNA pool was prepared through PCR using the cDNA as a template. This represented one round of SELEX. The round was repeated 12 times.

Melting Curve Analysis

cDNA from each SELEX round was amplified using KAPA SYBR FAST ABI Prism 2X qPCR Master Mix. For melting curve analysis, after annealing from 95 to 65°C, the overall sample temperature was increased gradually from 60 and 95°C at a step gradient of 0.3°C/2 s in a StepOnePlus Real-time PCR System. Changes in fluorescence intensity were continuously monitored and melting peaks were calculated with the instrument software.

TA Cloning and Sequencing Analysis

To determine the sequences of DNA in the round 8 and 12 DNA pools, DNA was ligated into a plasmid vector using a Mighty TA-cloning Reagent Set for PrimeSTAR (TaKaRa Bio). This ligated DNA was used for transformation of DH5α and spread on a color selection plate. Plasmid DNA was extracted by GenElute™ Plasmid Miniprep Kit (Sigma-Aldrich, Tokyo, Japan), and the sequences of the inserted DNA were determined using BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) with a 3130xl Genetic Analyzer (Applied Biosystems).

Statistical Analysis

Differences were statistically evaluated using the Dunnett’s test or Student’s t-test. p-Value of <0.05 was considered to be statistically significant.

RESULTS

Increase in SELEX Rounds Reduced the Sequence Diversity of Pooled RNA

Figure 1 shows a schematic representation of the procedure of SELEX-based screening and identification of exosome-tropic RNAs. The sequence diversity of a DNA pool can be estimated from the melting curve of its double-stranded PCR product. It has been reported that the melting temperature of a diverse DNA pool is lower than that of a less diverse DNA pool because of large numbers of imperfectly matched heteroduplexes.¹⁷⁾ Figure 2 shows the melting curves of the DNA pools from 0, 4, 8, or 12 rounds of SELEX. As the number of SELEX rounds increased, the peak positions of the melting curves shifted to the high temperature side, which suggests the decrease in diversity in the sequences of the DNA pool and successful screening using this SELEX procedure.

Fig. 1. Schematic Outline of the SELEX Procedure against Exosomes

Fig. 2. Melting Profiles of DNA Pool from 0, 4, 8, and 12 SELEX Rounds

The assay is based on heat denaturation of PCR products of DNA pool from (a) 0, (b) 4, (c) 8, and (d) 12 SELEX rounds in the presence of an intercalating dye. At the melting temperature of the PCR product, DNA strands separate and fluorescence intensity decreases. This figure shows negative first order derivatives of melting curves with respect to temperature.

RNA with an Identical Sequence Was Found in the RNA Pools of Round 8 and 12

As melting temperatures measurement indicated that sequence diversity of RNA pools of round 8 and 12 was small enough to determine exosome-tropic RNA sequences, sequence of RNAs in these pools were analyzed (Table 1). An RNA, named RNA-A, was the most frequently detected sequence (29 of 56 clones). Several sequences such as RNA-B, -C, and -D have high sequence similarity to RNA-A. On the other hand, the sequences in the RNA pool of round 0 were different from those of the pool of round 8 or 12 (data not shown), which suggests the decrease in sequence diversity and selection of specific sequences by SELEX.

Table 1. The RNA Sequences Found from Round 8 and 12 RNA Pools

ID	Sequence	Number of colonies
A	GUUUCGGUGCGGCAUUCCCCUGGAUCUGUGAUUUCUGAUA	29
B	GUUUCGGUGCUGCAUUCCCCUGGAUCUGUGAUUUCUGAUA	3
C	GUUCCGGUGCGGCAUUCCCCUGGAUCUGUGAUUUCUGAUA	1
D	GUUUCGGUGCGGCACUCCCCUGGAUCUGUGAUUUCUGAUA	1
E	UUUUCGGUGCGGCAUUCCCCUGGAUCUGUGAUUUCUGAUA	1
F	GUUUCGGUGCGGCAUUCCCCUGGACCUGUGAUUUCUGAGA	1
G	GUUUCGGUGCGGCAUUUCCCUGGAUCUGUGAUUUCUGAUA	1
H	GUUUCGGUGCGGUAUUCCCCUGGAUCUGUGAUUUCUGAUA	1
I	GCUUCGGUGCUGCAUUCCCUUGGAUCUGUGAUUUCUGAUA	1
J	GUUUCGGUUCGCCAUUCUCCUGGAUCUGUGAUUUCUGAUA	1
K	GUUUCGAUGUCGCUUUCCUCUGGAUGUGUGAUUUGUGAUA	1
L	UAUCCUCGCCUGGAUCCAGCUCUGUUAGUUUUUCCAAGUA	1
M	GGUUAGAGCUCUCUGAGGACUUCGUGUUUGUUCUGUUCGA	1
N	GCACUUUUGAUUUGUUGCGGUUGAUCUGGUUUGGUCUGUU	1
O	CUGAUAUUUGCAGCGUUUCAUCCUCCUCUGUCUUCAUCUG	1
P	UAGUUUCUGUAAAGUUGUACCCUCUUGUUGUGAUCCAAGC	1
Q	AGUUUUCUUUUGCCCGUGGGGUGACGUGAGUUCCGGUUUC	1
R	GUUCUGCUGACGGAAUAGAUGAAUGCUCCCCGGGUCCGUC	1
S	GUUGAUUUGUUCAUCGAGUUUCCUUUCUGGGGUUGUAUGA	1
T	CUUGACUUUUCGGUGCGCGGUUCCUUCCAGGGUCUGACUA	1
U	AGUUAACCUUAGUUCUCAUUAGUCUUGUGGUAGUUUUGGU	1
V	CCAGUCUUGCCUUCCGUCGUUUCGGAUCUCCGUUUGAAAC	1
W	CUGCUCUGAUUGUUUUCUUGCCCUCCUUUGGGGAUACAGG	1
X	GUACUGUUUUUCUGUGGUUUCUGCCUCCCUUUGGGUCAUC	1
Y	UUUGGAUAUUUGGCUGUGACUACUCUGGGUCCGUUUAUAC	1
Z	UUGUUCAGAUUCGGAGAUAAUUUUCCCUACUGGGGCCUGU	1

RNA sequences found in 56 clones of round 8 and 12 RNA pools were shown. Only the sequences of the initially randomized 40-nucleotide part of the collected RNAs are presented. Underlining indicates the different bases from RNA-A sequence in the RNA-B to RNA-J.

RNA-A Had the Highest Tropism to Exosomes

Four RNAs without four uracils in a row (UUUU) i.e., RNA-A, -K, -O, and -S, were selected for examination of their tropism to exosomes because UUUU is a transcription termination signal for pol III promoters such as the U6 promoter. To examine exosome tropism, each RNA and the first RNA pool (round 0) were transfected into B16-BL6 cells. There was no significant difference in the cellular RNA amounts among the RNAs examined (Fig. 3a). Figure 3b shows the amount of RNA recovered in the exosome. The amount of RNA-A recovered in the exosome fraction was significantly higher than the other sequences. To further confirm the exosome tropism of RNA-A in B16-BL6 cells, the amount of RNA-A in exosomes after transfection to the cells was compared to that of the scrambled sequence of RNA-A (Scr-A). As shown in Fig. 4, RNA-A was significantly enriched in the exosomes but not in the cells.

Fig. 3. Quantification of RNA Amount in Exosomes and Cells after Transfection of Each RNA

After transfection of each RNA into B16-BL6 cells, the RNA amount in (a) cells and (b) exosomes were quantified. Round 0 was used as a control. The results are expressed as the mean±S.D. (n=3). Differences were statistically evaluated using the Dunnett’s test.

Fig. 4. Quantification of RNA Amount in Exosomes and Cells after Transfection of RNA-A and the Scrambled Sequence

After transfection of each RNA into B16-BL6 cells, the RNA amount in (a) cells and (b) exosomes were quantified. The results are expressed as the mean±S.D. (n=5). Differences were statistically evaluated using the Student’s t-test.

DISCUSSION

In the present study, the SELEX method was applied to screen exosome-tropic RNAs. Regarding RNAs that are enriched in microvesicles (MVs), which include exosomes, Bolukbasi et al. analyzed 3′ UTR sequences of mRNAs found in exosomes using a multiple alignment program.⁸⁾ They found that mRNA enriched in MVs have a 25-nucleotide sequence containing CUGCC and a miR-1289-binding site. Different from this precedent study, the current SELEX-based screening of exosome-tropic RNA has the following advantages: 1) using cells of interest for screening, RNA with exosome tropism in the specific cells can be obtained with high probability, 2) exosome-tropic RNAs can be obtained by random screening irrespective of the mechanism of RNA migration into exosomes, and 3) using the SELEX method, it is possible to identify the RNAs with high exosome tropism that are not found in endogenous RNAs. The limitation of the SELEX-based method used in this study is that it is difficult to screen short RNAs like microRNA. This is because 40-base-long primer binding sequences are required for PCR. The modified SELEX-methods reported may be applicable for screening shorter RNAs.¹⁸⁾ Another concern is a risk of biases in the screening process.^19,20) Although we have successfully obtained the exosome-tropic RNA in the study, the obtained sequence might be affected by the biases related to RT-PCR and in vitro transcription. Better results may be obtained by eliminating these biases. However, as these processes are essential to amplify small amount of RNA extracted from exosomes, it is difficult to eliminate these biases.

After 12 rounds of SELEX screening, several RNA candidates were identified. It is reasonable that RNA-A, the most frequently isolated RNA in the RNA pools from round 8 and 12, had the highest exosome tropism among RNAs identified from the DNA pool of round 8 and 12. This is because RNA sequences that have high tropism to exosomes were preferentially enriched in the exosome fractions as each SELEX round was progressed. These results indicate that SELEX screening is useful for identifying RNA sequences that show exosome tropism in the type of cells used for screening.

No obvious similarities were found in the RNA sequences between those identified in this study and those reported in previous papers.⁸⁾ In addition to primary sequence, we could not find any similarity in the secondary structures evaluated by CentroidFold software²¹⁾ between the sequences identified in the current study and those reported in previous papers. The mechanisms of RNA sorting to exosomes were not clear enough, although some studies revealed that the binding of RNA to exosome-tropic proteins is important.^22,23) It is possible that RNA-A also binds to exosome-tropic proteins. As RNA-A was not enriched in the exosomes from RAW264.7 cells after transfection (data not shown), the proteins associated with the transport of RNA-A to exosomes, if present, may not be uniformly expressed in all cell types. It is not clear whether RNA-A has higher exosome tropism than the reported sequences. It is desirable to compare the exosome tropism of RNA-A with that of other reported sequences in future studies.

In conclusion, we newly identified an exosome-tropic RNA, RNA-A, which has a tropism for exosomes after addition to B16-BL6 cells. Moreover, we demonstrated that SELEX is useful for screening of exosome-tropic RNAs. These results provide useful information for the development of exosome-based RNA delivery systems.

Acknowledgments

This work was supported by Grant-in-Aid for Challenging Exploratory Research (the Japan Society for the Promotion of Science (JSPS) KAKENHI Grant Number 26670266) from JSPS.

Conflict of Interest

The authors declare no conflict of interest.

REFERENCES

• 1) Valadi H, Ekström K, Bossios A, Sjöstrand M, Lee JJ, Lötvall JO. Exosome-mediated transfer of mRNAs and microRNAs is a novel mechanism of genetic exchange between cells. Nat. Cell Biol., 9, 654–659 (2007).
• 2) Alvarez-Erviti L, Seow Y, Yin H, Betts C, Lakhal S, Wood MJ. Delivery of siRNA to the mouse brain by systemic injection of targeted exosomes. Nat. Biotechnol., 29, 341–345 (2011).
• 3) Shtam TA, Kovalev RA, Varfolomeeva EY, Makarov EM, Kil YV, Filatov MV. Exosomes are natural carriers of exogenous siRNA to human cells in vitro. Cell Commun. Signal., 11, 88 (2013).
• 4) van der Meel R, Fens MH, Vader P, van Solinge WW, Eniola-Adefeso O, Schiffelers RM. Extracellular vesicles as drug delivery systems: Lessons from the liposome field. J. Control. Release, 195, 72–85 (2014).
• 5) Kooijmans SA, Stremersch S, Braeckmans K, de Smedt SC, Hendrix A, Wood MJ, Schiffelers RM, Raemdonck K, Vader P. Electroporation-induced siRNA precipitation obscures the efficiency of siRNA loading into extracellular vesicles. J. Control. Release, 172, 229–238 (2013).
• 6) Hood JL, Scott MJ, Wickline SA. Maximizing exosome colloidal stability following electroporation. Anal. Biochem., 448, 41–49 (2014).
• 7) Kosaka N, Iguchi H, Yoshioka Y, Hagiwara K, Takeshita F, Ochiya T. Competitive interactions of cancer cells and normal cells via secretory microRNAs. J. Biol. Chem., 287, 1397–1405 (2012).
• 8) Bolukbasi MF, Mizrak A, Ozdener GB, Madlener S, Ströbel T, Erkan EP, Fan JB, Breakefield XO, Saydam O. miR-1289 and “Zipcode”-like Sequence Enrich mRNAs in Microvesicles. Mol. Ther. Nucleic Acids., 1, e10 (2012).
• 9) Kossinova OA, Gopanenko AV, Tamkovich SN, Krasheninina OA, Tupikin AE, Kiseleva E, Yanshina DD, Malygin AA, Ven’yaminova AG, Kabilov MR, Karpova GG. Cytosolic YB-1 and NSUN2 are the only proteins recognizing specific motifs present in mRNAs enriched in exosomes. Biochim. Biophys. Acta, 1865, 664–673 (2017).
• 10) Stoltenburg R, Reinemann C, Strehlitz B. SELEX-a (r)evolutionary method to generate high-affinity nucleic acid ligands. Biomol. Eng., 24, 381–403 (2007).
• 11) Peinado H, Alečković M, Lavotshkin S, Matei I, Costa-Silva B, Moreno-Bueno G, Hergueta-Redondo M, Williams C, García-Santos G, Ghajar C, Nitadori-Hoshino A, Hoffman C, Badal K, Garcia BA, Callahan MK, Yuan J, Martins VR, Skog J, Kaplan RN, Brady MS, Wolchok JD, Chapman PB, Kang Y, Bromberg J, Lyden D. Melanoma exosomes educate bone marrow progenitor cells toward a pro-metastatic phenotype through MET. Nat. Med., 18, 883–891 (2012).
• 12) Takahashi Y, Nishikawa M, Shinotsuka H, Matsui Y, Ohara S, Imai T, Takakura Y. Visualization and in vivo tracking of the exosomes of murine melanoma B16-BL6 cells in mice after intravenous injection. J. Biotechnol., 165, 77–84 (2013).
• 13) Imai T, Takahashi Y, Nishikawa M, Kato K, Morishita M, Yamashita T, Matsumoto A, Charoenviriyakul C, Takakura Y. Macrophage-dependent clearance of systemically administered B16BL6-derived exosomes from the blood circulation in mice. J Extracell Vesicles., 4, 26238 (2015).
• 14) Morishita M, Takahashi Y, Nishikawa M, Sano K, Kato K, Yamashita T, Imai T, Saji H, Takakura Y. Quantitative analysis of tissue distribution of the B16BL6-derived exosomes using a streptavidin-lactadherin fusion protein and iodine-125-labeled biotin derivative after intravenous injection in mice. J. Pharm. Sci., 104, 705–713 (2015).
• 15) Yamashita T, Takahashi Y, Nishikawa M, Takakura Y. Effect of exosome isolation methods on physicochemical properties of exosomes and clearance of exosomes from the blood circulation. Eur. J. Pharm. Biopharm., 98, 1–8 (2016).
• 16) Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) Method. Methods, 25, 402–408 (2001).
• 17) Schütze T, Arndt PF, Menger M, Wochner A, Vingron M, Erdmann VA, Lehrach H, Kaps C, Glökler J. A calibrated diversity assay for nucleic acid libraries using DiStRO—a Diversity Standard of Random Oligonucleotides. Nucleic Acids Res., 38, e23 (2010).
• 18) Darmostuk M, Rimpelova S, Gbelcova H, Ruml T. Current approaches in SELEX: An update to aptamer selection technology. Biotechnol. Adv., 33, 1141–1161 (2015).
• 19) Meyers LA, Lee JF, Cowperthwaite M, Ellington AD. The robustness of naturally and artificially selected nucleic acid secondary structures. J. Mol. Evol., 58, 681–691 (2004).
• 20) Thiel WH, Bair T, Wyatt Thiel K, Dassie JP, Rockey WM, Howell CA, Liu XY, Dupuy AJ, Huang L, Owczarzy R, Behlke MA, McNamara JO II, Giangrande PH. Nucleotide bias observed with a short SELEX RNA aptamer library. Nucleic Acid Ther., 21, 253–263 (2011).
• 21) Sato K, Hamada M, Asai K, Mituyama T. CENTROIDFOLD: a web server for RNA secondary structure prediction. Nucleic Acids Res., 37 (Web Server), W277–280 (2009).
• 22) Guduric-Fuchs J, O’Connor A, Camp B, O’Neill CL, Medina RJ, Simpson DA. Selective extracellular vesicle-mediated export of an overlapping set of microRNAs from multiple cell types. BMC Genomics, 13, 357 (2012).
• 23) Villarroya-Beltri C, Gutiérrez-Vázquez C, Sánchez-Cabo F, Pérez-Hernández D, Vázquez J, Martin-Cofreces N, Martinez-Herrera DJ, Pascual-Montano A, Mittelbrunn M, Sánchez-Madrid F. Sumoylated hnRNPA2B1 controls the sorting of miRNAs into exosomes through binding to specific motifs. Nat. Commun., 4, 2980 (2013).