Role of Supplementary Selenium on the Induction of Insulin Resistance and Oxidative Stress in NSY Mice Fed a High Fat Diet

Abstract

The role of supplementary selenium on the induction of insulin resistance and oxidative stress in a diabetic mouse model was investigated in NSY mice on a high fat diet (HFD) and administered seleno-L-methionine (SeMet)-containing water for 12 weeks. Significant increases in oral glucose tolerance-tested (OGTT), insulin tolerance-tested, and non-fasting blood glucose levels were observed in mice on a HFD, as well as the significant increases in OGTT and non-fasting plasma insulin levels. Mice on a HFD had decreased plasma adiponectin levels and increased free fatty acid (FFA) levels. Supplementary SeMet significantly augmented OGTT blood glucose levels in mice on a HFD and plasma FFA levels in mice on a normal diet. The mRNA levels of six selenoproteins were measured, and glutathione peroxidase (GPx) 1 and selenoprotein P (SelP) were selected as candidates that may be associated with insulin resistance or oxidative stress in the liver. Hepatic GPx1 expression was elevated in mice on a HFD and SeMet supplementation, and SelP expression increased in mice on a HFD. Histopathological observations in hepatic tissues showed hypertrophy of parenchymal cells and significant expression of 4-hydroxy-2-nonenal in mice on a HFD, indicating lipid accumulation and oxidative stress induction. Hepatic protein tyrosine phosphatase activity also increased by a HFD. These results suggest that hepatic lipid accumulation in NSY mice on a HFD promoted oxidative stress and hepatic SelP expression, and supplementary SeMet induced hepatic GPx1 expression.

Type 2 diabetes mellitus is a metabolic disease associated with genetic and lifestyle factors¹⁾ caused by the decline in insulin potency in organs, such as liver, muscle, and adipose tissue, and/or reduced insulin secretion from pancreatic β-cells.²⁾ This disease leads to diabetic peripheral neuropathy, nephropathy, and retinopathy by raising the level of blood glucose, and eventually gangrene, renal failure, and blindness.³⁾ These pathologies are linked on an individual level to obesity and overweight,⁴⁾ on a physiological level to insulin resistance,⁵⁾ and on a cellular level to oxidative stress.⁶⁾ Insulin-resistant diabetes is a state of declined glucose uptake in target tissue cells, which do not properly respond to insulin and do not have a functioning insulin transduction system.⁷⁾ Intracellular production of reactive oxygen species (ROS) and redox activation of protein tyrosine phosphatase (PTP) 1B are involved in the decline of insulin signal transduction phosphorylation^8–10) and dysfunction in pancreatic β-cells.^11,12)

Selenium (Se) is an essential trace element and functions as a key component of critical enzymes for redox homeostasis and protection from oxidative stress, which include the glutathione peroxidase (GPx) family and selenoprotein P (SelP).^13,14) GPx1 is located in the cytosol to remove hydrogen peroxide (H₂O₂), which is generated by intracellular oxidative stress or produced from superoxide anions by superoxide dismutase.¹⁵⁾ GPx1 has higher affinity to H₂O₂ than catalase, a well-known antioxidant enzyme.¹⁶⁾ Therefore, Se supplementation has been tested as a potential treatment against the onset of diabetes.^17,18) However, recent epidemiological and clinical studies demonstrated that morbidity of type 2 diabetes increased in high serum Se populations and in a high dietary Se supplement group.^17,19) Se may be related to glucose and lipid metabolism via expression of selenoproteins, such as SelP or iodothyronine deiodinase (Dio).^20,21) These results suggest that investigation of supplementary Se and selenoproteins to protect against the onset of diabetes and the role of Se in insulin resistance is important to develop strategies for the prevention or amelioration of diabetes in response to different Se states in patients.

In this study, we analyzed the expression of selenoproteins that might be associated with the induction of insulin resistance or oxidative stress in NSY mice, which are an animal model of human type 2 diabetes characterized by lower insulin secretion due to aging.^22,23) NSY mice were fed a high fat diet (HFD) and administered seleno-L-methionine (SeMet) for 12 weeks. Liver and serum Se levels, glucose tolerance, plasma biomarkers, histopathological observations, and hepatic PTP activity in mice on a HFD with or without supplementation of SeMet were compared with those of mice on a normal diet (ND).

MATERIALS AND METHODS

Animals

Permission for the animal experiments performed in this study was obtained from the Animal Experiment Room Administration Committee of Setsunan University, and the experiments were conducted according to the Animal Experiment Guidelines of the Faculty of Pharmaceutical Sciences, Setsunan University. Specific pathogen-free male NSY mice (4 weeks old, about 14 g) were purchased from Hoshino Laboratory Animals, Inc. (Ibaraki, Japan). The animals were maintained in a specific pathogen-free room at 23±1°C and 47–67% humidity, under a 12 h light/dark cycle (lights on at 7:00 a.m.), and had ad libitum access to γ-ray-irradiated ND (CRF-1, Oriental Yeast Co., Tokyo, Japan) and tap water. The mice were acclimated for 1 week prior to use.

HFD and SeMet Administration

NSY mice (8 mice/group) were switched from a ND to a HFD (60% kcal from fat) (HFD-60, Oriental Yeast Co., Tokyo, Japan) and tap water containing 2 mg Se/L SeMet (Sigma-Aldrich Japan K.K., Tokyo, Japan) at 5 weeks old. These mice were kept for 12 weeks while measuring body weight every two days and non-fasting blood glucose level every week. The oral glucose tolerance test (OGTT) was performed by administering glucose at a dose of 2 g/kg body weight to 16 h-fasted mice 10 weeks after switching to a HFD and SeMet water. Blood samples were collected from the tail vein at 0, 15, 30, 60, 90, and 120 min after glucose loading. Blood glucose levels were measured using Glutestmint (SANWA KAGAKU KENKYUSYO Co., Ltd., Nagoya, Japan). After 11 weeks, an intraperitoneal insulin tolerance test (ITT) was performed by administering insulin (Humulin-R, Eli Lilly Japan K.K., Hyogo, Japan) at 0.75 U/kg body weight to 4 h-fasted mice. Blood samples were collected from the tail vein at 0, 30, 60, 90, 120 min after insulin injection and blood glucose levels were measured as in the OGTT method. Twelve weeks after switching to a HFD and SeMet water, blood samples were collected from the inferior vena cava and centrifuged at 700×g for 20 min at 4°C. The fractionated plasma samples were stored at −80°C until use. The liver was perfused with phosphate buffered saline through the portal vein under isoflurane anesthesia, and the liver, skeletal muscle (the whole of the thigh), and pancreas were removed immediately for RNA extraction or stored at −80°C. After wet digestion of the liver and pancreas with a mixed acid solution of nitric acid–perchloric acid (2 : 1, v/v), Se content was determined by fluorometric method using 2,3-diaminonaphthalene.²⁴⁾ Plasma adiponectin and insulin was measured by enzyme-linked immunosorbent assay (adiponectin; R&D Systems, Inc., MN, U.S.A., insulin; Shibayagi Co., Ltd., Gunma, Japan) and free fatty acid measured by NEFA C-test Wako (Wako Pure Chemical Industries, Ltd., Osaka, Japan) according to the manufacturer’s instructions.

Real-Time Quantitative PCR (RT-qPCR)

RT-qPCR was performed to determine mRNA expression of selenoproteins. RNA was extracted from tissue using Sepasol^®-RNA I Super G (Nacalai Tesque, Kyoto, Japan), followed by cDNA synthesis using High-Capacity cDNA Reverse Transcription Kits (Life Technologies Japan Ltd., Tokyo, Japan). The LightCycler 480 System II (Roche Diagnostics GmbH, Mannheim, Germany) was used for realtime qPCR analysis. Gene-specific primer sequences are listed in Table 1. Cycling conditions were used as suggested in the SYBR Green Kit instructions, and results were analyzed using Relative Quantification Software (Roche Diagnostics GmbH). The results were expressed as mean standard deviation (S.D.) for relative expression levels compared with Rps18.

Table 1. Specific Primers for Selenoproteins and Rps18

Gene	Forward (5′→3′)	Reverse (5′→3′)
GPx1	CCGGGACTACACCGAGATGAA	CACCAGGTCGGACGTACTTGAG
GPx4	GCACGAATTCTCAGCCAAGGA	AGGCCAGGATTCGTAAACCACA
SelP1	CCTTGGTTTGCCTTACTCCTTCC	TTTGTTGTGGTGTTTGTGGTGG
Dio1	CCCCTGGTGTTGAACTTTG	CTGTGGCGTGAGCTTCTTC
Dio2	CTTCCTCCTAGATGCCTACAAAC	GGCATAATTGTTACCTGATTCAGG
Dio3	CTACGTCATCCAGAGTGGCA	CTGTTCATCATAGCGCTCCA
Rps18	TTCTGGCCAACGGTCTAGACAAC	CCAGTGGTCTTGGTGTGCTGA

Western Blot Analysis

For analysis of GPx1 and SelP expression, 1 : 10 (w/v) liver homogenates were prepared in CelLytic™ MT Cell Lysis Reagent (Sigma-Aldrich Japan K.K., Tokyo, Japan) with 1 mM dithiothreitol (DTT), 10 µg/mL leupeptin, 10 µg/mL antipain, 100 µg/mL benzamidine hydrochloride, and 20 µg/mL aprotinin. After centrifugation (12000×g for 15 min at 4°C), the protein content of the soluble fraction was determined by Bradford method using bovine serum albumin as a standard. A total of 40 µg of protein was separated on 15% (GPx1) or 10% (SelP) sodium dodecyl sulfate-polyacrylamide gels, and then transferred to polyvinylidene difluoride membranes for Western blot analysis. Membranes were blocked with 3% nonfat dry milk 0.1% Tris-buffered saline with 0.1% Tween 20 solution for 30 min and incubated with rabbit anti-SelP (ab109514, Abcam plc, Cambridge, U.K.) or GPx1 (ab108427, Abcam plc, Cambridge, U.K.) antibodies (1 : 1000) overnight at 4°C, followed by incubation with secondary antibody (1 : 5000) (#7074, Cell Signaling Technology, Inc., MA, U.S.A.) conjugated with horseradish peroxidase. Antibody labeling was detected with ECL Prime Western blotting Detection Reagent (GE Healthcare Japan, Tokyo, Japan) according to the manufacturer’s instructions, and the images were captured using a ChemiDoc MP Imaging System (Bio-Rad Laboratories, Inc., CA, U.S.A.).

Histopathological Observations

Mice liver was fixed with 4% paraformaldehyde and embedded in a paraffin block. Four µm slices were stained with hematoxylin–eosin (H&E) and immunohistochemically detected 4-hydroxy-2-nonenal (4HNE). Sections were incubated overnight at 4°C with rabbit anti-4HNE antibody (1 : 400) (bs-6313R, Bioss Antibodies Inc., Woburn, MA, U.S.A.). Slides were subsequently treated for 30 min at 24°C with secondary antibody (Histfine simple stein mouse MAX-PO (R), NICHIREI BIOSCIENCES INC., Tokyo, Japan) and incubated in diaminobenzidine (DAB) solution. DAB intensity was measured on 3 different areas of 4 randomly selected slides per group using ImageJ,²⁵⁾ and an average of these values was calculated.

Assay of PTP Activity

Liver PTP activity was determined by the method described by Mueller et al.²⁶⁾ The p-nitrophenol absorbance was measured by microplate reader (SH-1000 Lab, CORONA ELECTRIC Co., Ltd., Ibaraki, Japan). The native and DTT-reduced PTP activities were measured without and with the addition of DTT, respectively. These activities were shown as the percentage of ND control group, and the glutathionylated PTP activity was calculated from the difference in the native PTP activity and the DTT-reduced PTP activity.

Statistical Analysis

Values in the figures are expressed as the mean±S.D. Statistical analysis was carried out by a two-way ANOVA as well as a one-way ANOVA followed by a Tukey’s test with Origin 9 (LightStone Corp., Tokyo, Japan). The p level was set at 0.05 or 0.01.

RESULTS

Levels of Blood Glucose, Plasma Biomarkers, and Tissue Se

To investigate the effect of supplementary SeMet on hyperglycemia and insulin resistance, NSY mice were given a HFD and 2 mg Se/L SeMet water for 12 weeks. OGTT after 10 weeks and ITT after 11 weeks resulted in a significant increase of blood glucose and plasma insulin levels in the mice on a HFD (Fig. 1). Although supplementary SeMet significantly augmented blood glucose level after 30 min for the OGTT in the HFD group (Fig. 1A), there was no significant difference in plasma insulin levels between the SeMet and control groups. After 12 weeks, the HFD group had a significant increase in the levels of non-fasting blood glucose, insulin, and FFA and a significant decrease in the adiponectin level compared with the ND group (Table 2). Supplementary SeMet significantly augmented plasma FFA levels in the ND group and suppressed non-fasting plasma insulin levels in the HFD group.

Fig. 1. OGTT Blood Glucose and Insulin Levels (A) and ITT Blood Glucose Levels (B) in NSY Mice on a ND and HFD

OGTT and ITT were performed 10 and 11 weeks after switching to a HFD and SeMet water. ITT blood glucose level is shown as the percentage of the initial glucose level. ND and tap water (○), ND and 2 mg Se/L water (●), HFD and tap water (△), HFD and 2 mg Se/L (▲). Values are the mean±S.D. (n=8). ** p<0.01 vs. ND control group, ^†† p<0.01 vs. ND SeMet treatment group, ^## p<0.01 vs. HFD control group at the same time points. N.D.; not-detected (detection limit: 0.156 ng/mL).

Table 2. Body Weight, Blood Glucose Levels, Plasma Biomarkers, and Tissue Selenium of NSY Mice on a HFD and Administered SeMet for 12 Weeks

	ND group		HFD group
	Control	SeMet treatment	Control	SeMet treatment
Body weight (g)	41.7 (4.32)	41.3 (2.68)	58.7 (2.61)**	59.6 (3.72)††
Blood glucose (mg/dL)	172 (16.7)	191 (22.2)	277 (69.0)**	280 (87.1)†
Plasma biomarkers
Insulin (ng/mL)	1.36 (0.685)	1.44 (0.955)	126 (34.3)**	64.7 (35.4)††#
Adiponectin (µg/mL)	5.27 (1.136)	4.52 (0.557)	3.36 (0.182)**	3.19 (0.316)††
FFA (meq/L)	0.216 (0.0364)	0.415 (0.0895)**	0.408 (0.0781)**	0.343 (0.0887)
Tissue Se
Liver (ng/mg protein)	9.72 (1.99)	19.2 (3.52)**	8.92 (3.06)	15.1 (2.26)##
Plasma (ng/mL)	427 (40.2)	476 (40.5)	389 (27.6)	790 (96.2)††##

The data are shown as mean (S.D.) (n=8). Two-way ANOVA: interaction between HFD and SeMet; p<0.05 in the plasma insulin level; p<0.01 in the plasma FFA and Se level. Tukey’s test: ** p<0.01 vs. ND control group. ^† p<0.05; ^†† p<0.01 vs. ND SeMet treatment group. ^# p<0.05; ^## p<0.01 vs. HFD control group.

Although body weight increased on a HFD, there was no significant difference in body weight between SeMet and control groups. The liver Se level was significantly elevated by SeMet. There was a significant interaction by a two-way ANOVA between SeMet supplementation and HFD ingestion in the plasma Se level.

Selenoprotein Expression in Target Tissues and on Insulin Secretion

To analyze selenoprotein expression that may be associated with the induction of insulin resistance or oxidative stress, we measured mRNA levels of six selenoproteins in the liver, muscle, and pancreas. There were significant differences in mRNA levels, for GPx1 in the liver and pancreas, for GPx4 in the liver, muscle, and pancreas, for SelP1 in the liver and pancreas, and for Dio1 in the liver of mice on a HFD or SeMet-supplemented groups (Table 3). There was a significant interaction by a two-way ANOVA between SeMet supplementation and HFD ingestion in the hepatic GPx1 mRNA level. Of these selenoproteins, GPx4 and Dio1 mRNA expression levels were negligible. From these results, we focused on hepatic expressions of GPx1 and SelP that were higher than those of the other selenoproteins and may be associated with intracellular redox status.

Table 3. Selenoprotein mRNA Expression in Insulin Target and Secretion Organs

Relative mRNA levels (/rps18)	ND group		HFD group
	Control	SeMet treatment	Control	SeMet treatment
GPx1
Liver	0.967 (0.476)	8.31 (0.436)**	2.45 (0.645)*	12.2 (1.63)††##
Muscle	0.562 (0.101)	0.548 (0.0916)	0.606 (0.0876)	0.531 (0.0953)
Pancreas	0.517 (0.111)	0.628 (0.205)	0.219 (0.0715)*	0.663 (0.335)##
GPx4
Liver	0.0398 (0.00720)	0.100 (0.0153)**	0.0978 (0.0198)**	0.149 (0.044)††##
Muscle	0.0196 (0.00141)	0.0210 (0.00294)	0.0297 (0.00512)**	0.0204 (0.00308)##
Pancreas	0.00202 (0.000660)	0.00887 (0.00159)**	0.00262 (0.00117)	0.0129 (0.00317)††##
SelP1
Liver	21.2 (9.01)	26.8 (2.80)	48.6 (17.0)**	40.9 (7.78)†
Muscle	1.354 (0.336)	1.32 (0.141)	1.65 (0.632)	1.35 (0.404)
Pancreas	2.24 (0.893)	2.86 (0.279)	4.76 (1.53)*	8.68 (3.14)††##
Dio1
Liver	0.000623 (0.000196)	0.00320 (0.00131)	0.0174 (0.0106)	0.176 (0.0617)††##
Muscle	N.D.	N.D.	N.D.	N.D.
Pancreas	N.D.	N.D.	N.D.	N.D.
Dio2
Liver	N.D.	N.D.	N.D.	N.D.
Muscle	N.D.	N.D.	N.D.	N.D.
Pancreas	N.D.	N.D.	N.D.	N.D.
Dio3
Liver	N.D.	N.D.	N.D.	N.D.
Muscle	N.D.	N.D.	N.D.	N.D.
Pancreas	N.D.	N.D.	N.D.	N.D.

The data are shown as mean (S.D.) (n=8). Two-way ANOVA: interaction between HFD and SeMet; p<0.05 in the pancreatic GPx1, GPx4 and SelP1 mRNA expressions; p<0.01 in the hepatic GPx1, Dio1 and muscle GPx4 mRNA expressions. Tukey’s test: * p<0.05; ** p<0.01 vs. ND control group. ^† p<0.05; ^†† p<0.01 vs. ND SeMet treatment group. ^## p<0.01 vs. HFD control group. N.D., not-detected.

Hepatic GPx1 protein expression was significantly elevated by SeMet supplementation in the HFD group (Fig. 2A). Hepatic SelP protein expression significantly increased on a HFD, but did not significantly change by SeMet supplementation (Fig. 2B).

Fig. 2. The Effect of a HFD and SeMet Supplementation on GPx1 (A) and SelP (B) Protein Expression in the Liver

Protein expression values are normalized to β-actin. Values are the mean±S.D. (n=8, * p<0.05, ** p<0.01).

Hepatic Histopathology and PTP Activity

Mice on a HFD had increased liver weight, hypertrophy of parenchymal cells in hepatic tissues by H&E staining, and hepatic steatosis (Fig. 3). However, there was no significant difference in liver weight between the SeMet supplementation and control groups. Hepatic generation of 4HNE, which is an oxidative stress marker, was determined using immunohistochemical staining with DAB. 4HNE strongly stained the whole cell, particularly the plasma membrane and a portion of the nucleus, in hypertrophied hepatocytes of HFD groups compared with ND groups (Fig. 4A). However, there was no significant difference in the relative amount of 4HNE between SeMet supplementation and control groups (Fig. 4B).

Fig. 3. Histological Observation Using H&E Staining (×400) (A) and Weight (B) of Liver in ND and HFD NSY Mice

Liver weight was measured after removal from mice. Values are the mean±S.D. (n=8, ** p<0.01).

Fig. 4. Immunohistochemistry Staining (×400) (A) of Liver Using 4HNE Antibody in ND and HFD NSY Mice

DAB intensity was calculated using ImageJ and shown as the percentage of ND control group (B). The inside of square represents the expanded (×4–6) images of a stained cell. Values are the mean±S.D. (n=4, * p<0.05).

Hepatic PTP activity, which is an indicator for a negative regulation of insulin, was determined. PTP activity under native and DTT-reduced conditions was significantly increased by a HFD (Figs. 5A, B). PTP glutathionylation slightly decreased by SeMet supplementation and significant decreased by a HFD (Fig. 5C). These results suggest that hepatic lipid accumulation in mice on a HFD promotes oxidative stress and insulin resistance.

Fig. 5. PTP Activity under Native (A) and DTT Reducing Conditions (B) and the Calculated Ratio of PTP Glutathionylation (C) in the Liver of NSY Mice on a ND and HFD

The glutathionylated PTP activity was calculated from the difference in the native PTP activity and the DTT-reduced PTP activity. Values are the mean±S.D. (n=8, * p<0.05, ** p<0.01).

DISCUSSION

Type 2 diabetes is characterized by hyperglycemia and linked to obesity, insulin resistance, and cellular oxidative stress.^4–6) In this study, we examined selenoprotein expression in NSY mice, a human type 2 diabetic model, fed a HFD and administered 2 mg Se/L drinking water for 12 weeks. Because selenoproteins might be associated with insulin resistance and oxidative stress, we hypothesized that administration SeMet might promote insulin resistance in NSY mice on a HFD. Supplementary SeMet concentration was calculated from dietary intake and Se content in a ND, and adjusted to the upper limit of the physiological range,²⁷⁾ but below toxic levels. There was no detrimental effect on coat appearance, general grooming, or the other characteristics of Se-supplemented mice. Glucose tolerance was observed by OGTT after 10 weeks and ITT after 11 weeks on the HFD, and supplementary SeMet significantly augmented OGTT blood glucose levels (Fig. 1). Therefore, ingestion of Se is likely to promote the onset of hyperglycemia. This phenomenon was evidenced by a significant increase in non-fasting blood glucose after 8 weeks in mice on a SeMet-supplemented HFD and after 9 weeks on a non-supplemented HFD (data not shown). A HFD in NSY mice led to the induction of insulin resistance by increasing non-fasted blood glucose, plasma insulin, and FFA, and by decreasing adiponectin levels (Table 2). These results suggest that SeMet deteriorates insulin resistance of HFD-ingested NSY mice. However, it has been reported that glucose tolerance improves by exposing or perfusion of selenocompounds on the rat adipocyte and liver.^28,29) Se supplementation for Se deficient type 2 diabetic mouse model is also reported to ameliorate insulin resistance.³⁰⁾ These reports are inconsistent with our results, but the effect of supplementary Se on glucose tolerance or insulin resistance may be dependent on the dosage and the bioavailability of selenocompounds described previously.^27,31) The high Se dosage is reported to exacerbate insulin resistance of diabetic mouse models.^32,33) Although supplementary SeMet significantly decreased plasma insulin levels in HFD groups, it had no effect for OGTT blood glucose level in HFD induced-insulin resistance. This suggests that SeMet has an insulin-mimetic action as described previously,³¹⁾ but its action may not be as significant as the suppression of blood glucose occurs.

As shown in Table 3 and Fig. 2, hepatic mRNA levels of GPx1 and SelP were remarkably increased by a HFD or supplementary SeMet. Thus, GPx1 and SelP might be associated with the induction of insulin resistance or oxidative stress in diabetic mouse models. Elevated GPx1 and SelP protein expression was observed in SeMet-supplemented and non-supplemented HFD groups, respectively. Overexpression of GPx1 leads to the dephosphorylation of the insulin receptor,³⁴⁾ and SelP dosage in rodents inhibits insulin signaling.²⁰⁾ There is also an inverse correlation between serum levels of SelP and adiponectin in type 2 diabetic patients.³⁵⁾ These results suggest that GPx1 and SelP are involved in the reduction in insulin signal transduction phosphorylation in target tissues.

Mice on a HFD had increased plasma FFA levels, increased body weight, steatosis in hepatic tissues by H&E staining, and hypertrophy of parenchymal cells. 4HNE, which is well-known lipid peroxidation marker,³⁶⁾ was generated in hypertrophied hepatocytes in mice on a HFD. These results suggest that induction of hepatic steatosis may cause lipid peroxidation with the production of intracellular ROS.

The activities of PTPs, such as PTP1B, phosphatase and tensin homolog (PTEN), and Src homology 2 domain-containing tyrosine phosphatase, have been reported to be regulated by redox status in insulin target cells.^37–39) The depletion of hepatic PTEN suppresses hyperglycemia.⁴⁰⁾ Overexpression of PTP1B also inhibits tyrosine phosphorylation of the insulin receptor and insulin receptor substrate (IRS)-1.⁴¹⁾ Elevation of native and DTT-reduced PTP activity in the liver of mice on a HFD (Fig. 5) may indicate that hepatic steatosis causes insulin resistance through dephosphorylation of insulin signaling. PTP1B and PTEN activities are also inactivated by S-glutathionylation.^42,43) The glutathionylated PTP activity was significantly reduced by a HFD and was slightly reduced by supplementary SeMet in mice on a ND. This suggests that the induction of lipid peroxidation in hepatocytes causes PTP activity.

In conclusion, hepatic lipid accumulation from a HFD in NSY mice promoted oxidative stress, hepatic SelP expression, and insulin resistance, and supplementary SeMet enhanced hepatic GPx1 expression. However, the relevance of different selenoproteins for intracellular ROS production and the induction of insulin resistance was unclear. Further studies are needed to reveal these detailed mechanisms for the onset of insulin resistance including the signal transduction through protein kinases, their phosphorylation, and redox status transition by GPx1 and SelP.

Acknowledgments

The authors thank Mr. Yusuke Kataoka and Mr. Yuya Horikiri at Setsunan University for technical assistance. This research was supported in part by Grants-in-Aid for Scientific Research (KAKENHI 16K08357) from the Japan Society for the Promotion of Science.

Conflict of Interest

The authors declare no conflict of interest.

REFERENCES

• 1) Zimmet P, Alberti KG, Shaw J. Global and societal implications of the diabetes epidemic. Nature, 414, 782–787 (2001).
• 2) World Health Organization. Definition, diagnosis and classification of diabetes mellitus and its complications. Part 1: diagnosis and classification of diabetes mellitus. Report Number: WHO/NCD/NCS/99.2 (1999).
• 3) Brownlee M. Biochemistry and molecular cell biology of diabetic complications. Nature, 414, 813–820 (2001).
• 4) Franz MJ, Boucher JL, Rutten-Ramos S, VanWormer JJ. Lifestyle weight-loss intervention outcomes in overweight and obese adults with type 2 diabetes: a systematic review and meta-analysis of randomized clinical trials. J. Acad. Nutr. Diet, 115, 1447–1463 (2015).
• 5) Reaven GM. Banting lecture 1988. Role of insulin resistance in human disease. Diabetes, 37, 1595–1607 (1988).
• 6) Furukawa S, Fujita T, Shimabukuro M, Iwaki M, Yamada Y, Nakajima Y, Nakayama O, Makishima M, Matsuda M, Shimomura I. Increased oxidative stress in obesity and its impact on metabolic syndrome. J. Clin. Invest., 114, 1752–1761 (2004).
• 7) Ye J. Mechanisms of insulin resistance in obesity. Front. Med., 7, 14–24 (2013).
• 8) D’Apolito M, Du X, Zong H, Catucci A, Maiuri L, Trivisano T, Pettoello-Mantovani M, Campanozzi A, Raia V, Pessin JE, Brownlee M, Giardino I. Urea-induced ROS generation causes insulin resistance in mice with chronic renal failure. J. Clin. Invest., 120, 203–213 (2010).
• 9) Nakamura S, Takamura T, Matsuzawa-Nagata N, Takayama H, Misu H, Noda H, Nabemoto S, Kurita S, Ota T, Ando H, Miyamoto K, Kaneko S. Palmitate induces insulin resistance in H4IIEC3 hepatocytes through reactive oxygen species produced by mitochondria. J. Biol. Chem., 284, 14809–14818 (2009).
• 10) Goldstein BJ, Bittner-Kowalczyk A, White MF, Harbeck M. Tyrosine dephosphorylation and deactivation of insulin receptor substrate-1 by protein–tyrosine phosphatase 1B. Possible facilitation by the formation of a ternary complex with the Grb2 adaptor protein. J. Biol. Chem., 275, 4283–4289 (2000).
• 11) Krippeit-Drews P, Kramer C, Welker S, Lang F, Ammon HP, Drews G. Interference of H₂O₂ with stimulus-secretion coupling in mouse pancreatic beta-cells. J. Physiol., 514, 471–481 (1999).
• 12) Lu B, Wu H, Gu P, Du H, Shao J, Wang J, Zou D. Improved glucose-stimulated insulin secretion by intra-islet inhibition of protein–tyrosine phosphatase 1B expression in rats fed a high-fat diet. J. Endocrinol. Invest., 35, 63–70 (2012).
• 13) Patrick L. Selenium biochemistry and cancer: a review of the literature. Altern. Med. Rev., 9, 239–258 (2004).
• 14) Saito Y, Hayashi T, Tanaka A, Watanabe Y, Suzuki M, Saito E, Takahashi K. Selenoprotein P in human plasma as an extracellular phospholipid hydroperoxide glutathione peroxidase. Isolation and enzymatic characterization of human selenoprotein. P. J. Biol. Chem., 274, 2866–2871 (1999).
• 15) Li S, Yan T, Yang JQ, Oberley TD, Oberley LW. The role of cellular glutathione peroxidase redox regulation in the suppression of tumor cell growth by manganese superoxide dismutase. Cancer Res., 60, 3927–3939 (2000).
• 16) Matés JM, Sánchez-Jiménez F. Antioxidant enzymes and their implications in pathophysiologic processes. Front. Biosci., 4, D339–D345 (1999).
• 17) Stranges S, Marshall JR, Natarajan R, Donahue RP, Trevisan M, Combs GF, Cappuccio FP, Ceriello A, Reid ME. Effects of long-term selenium supplementation on the incidence of type 2 diabetes: a randomized trial. Ann. Intern. Med., 147, 217–223 (2007).
• 18) Rayman MP, Blundell-Pound G, Pastor-Barriuso R, Guallar E, Steinbrenner H, Stranges S. A randomized trial of selenium supplementation and risk of type-2 diabetes, as assessed by plasma adiponectin. PLOS ONE, 7, e45269 (2012).
• 19) Laclaustra M, Navas-Acien A, Stranges S, Ordovas JM, Guallar E. Serum selenium concentrations and diabetes in U.S. adults: National Health and Nutrition Examination Survey (NHANES) 2003–2004. Environ. Health Perspect., 117, 1409–1413 (2009).
• 20) Misu H, Takamura T, Takayama H, Hayashi H, Matsuzawa-Nagata N, Kurita S, Ishikura K, Ando H, Takeshita Y, Ota T, Sakurai M, Yamashita T, Mizukoshi E, Yamashita T, Honda M, Miyamoto K, Kubota T, Kubota N, Kadowaki T, Kim HJ, Lee IK, Minokoshi Y, Saito Y, Takahashi K, Yamada Y, Takakura N, Kaneko S. A liver-derived secretory protein, selenoprotein P, causes insulin resistance. Cell Metab., 12, 483–495 (2010).
• 21) Castillo M, Hall JA, Correa-Medina M, Ueta C, Kang HW, Cohen DE, Bianco AC. Disruption of thyroid hormone activation in type 2 deiodinase knockout mice causes obesity with glucose intolerance and liver steatosis only at thermoneutrality. Diabetes, 60, 1082–1089 (2011).
• 22) Ueda H, Ikegami H, Yamato E, Fu J, Fukuda M, Shen G, Kawaguchi Y, Takekawa K, Fujioka Y, Fujisawa T, Nakagawa Y, Hamada Y, Shibata M, Ogihara T. The NSY mouse: a new animal model of spontaneous NIDDM with moderate obesity. Diabetologia, 38, 503–508 (1995).
• 23) Ueda H, Ikegami H, Kawaguchi Y, Fujisawa T, Nojima K, Babaya N, Yamada K, Shibata M, Yamato E, Ogihara T. Age-dependent changes in phenotypes and candidate gene analysis in a polygenic animal model of Type II diabetes mellitus; NSY mouse. Diabetologia, 43, 932–938 (2000).
• 24) Watkinson JH. Fluorometric determination of selenium in biological material with 2,3-diaminonaphthalene. Anal. Chem., 38, 92–97 (1966).
• 25) Rasband WS, Image J. U. S. National Institutes of Health, Bethesda, Maryland, USA, http://imagej.nih.gov/ij/, 1997–2016.
• 26) Mueller AS, Bosse AC, Most E, Klomann SD, Schneider S, Pallauf J. Regulation of the insulin antagonistic protein tyrosine phosphatase 1B by dietary Se studied in growing rats. J. Nutr. Biochem., 20, 235–247 (2009).
• 27) Shimizu R, Ueno H, Okuno T, Sakazaki F, Nakamuro K. Effect of sodium selenite supplementation on glucose intolerance and pancreatic oxidative stress in type 2 diabetic mice under different selenium status. J. Health Sci., 55, 271–280 (2009).
• 28) Ezaki O. The insulin-like effects of selenite in rat adipocytes. J. Biol. Chem., 265, 1124–1128 (1990).
• 29) Roden M, Prskavec M, Fürnsinn C, Elmadfa I, König J, Schneider B, Wagner O, Waldhäusl W. Metabolic effect of sodium selenite: insulin-like inhibition of glucagon-stimulated glycogenolysis in the isolated perfused rat liver. Hepatology, 22, 169–174 (1995).
• 30) Mueller AS, Pallauf J. Compendium of the antidiabetic effects of supranutritional selenate doses. In vivo and in vitro investigations with type II diabetic db/db mice. J. Nutr. Biochem., 17, 548–560 (2006).
• 31) Ueno H, Shimizu R, Okuno T, Ogino H, Arakawa T, Sakazaki F, Nakamuro K. Effects of administering sodium selenite, methylseleninic acid, and seleno-L-methionine on glucose tolerance in a streptozotocin/nicotinamide-induced diabetic mouse model. Biol. Pharm. Bull., 37, 1569–1574 (2014).
• 32) Labunskyy VM, Lee BC, Handy DE, Loscalzo J, Hatfield DL, Gladyshev VN. Both maximal expression of selenoproteins and selenoprotein deficiency can promote development of type 2 diabetes-like phenotype in mice. Antioxid. Redox Signal., 14, 2327–2336 (2011).
• 33) Zhou J, Xu G, Bai Z, Li K, Yan J, Li F, Ma S, Xu H, Huang K. Selenite exacerbates hepatic insulin resistance in mouse model of type 2 diabetes through oxidative stress-mediated JNK pathway. Toxicol. Appl. Pharmacol., 289, 409–418 (2015).
• 34) McClung JP, Roneker CA, Mu W, Lisk DJ, Langlais P, Liu F, Lei XG. Development of insulin resistance and obesity in mice overexpressing cellular glutathione peroxidase. Proc. Natl. Acad. Sci. U.S.A., 101, 8852–8857 (2004).
• 35) Misu H, Ishikura K, Kurita S, Takeshita Y, Ota T, Saito Y, Takahashi K, Kaneko S, Takamura T. Inverse correlation between serum levels of selenoprotein P and adiponectin in patients with type 2 diabetes. PLOS ONE, 7, e34952 (2012).
• 36) Juric-Sekhar G, Zarkovic K, Waeg G, Cipak A, Zarkovic N. Distribution of 4-hydroxynonenal–protein conjugates as a marker of lipid peroxidation and parameter of malignancy in astrocytic and ependymal tumors of the brain. Tumori, 95, 762–768 (2009).
• 37) Barrett WC, DeGnore JP, Keng YF, Zhang ZY, Yim MB, Chock PB. Roles of superoxide radical anion in signal transduction mediated by reversible regulation of protein–tyrosine phosphatase 1B. J. Biol. Chem., 274, 34543–34546 (1999).
• 38) da Costa RM, Neves KB, Mestriner FL, Louzada-Junior P, Bruder-Nascimento T, Tostes RC. TNF-α induces vascular insulin resistance via positive modulation of PTEN and decreased Akt/eNOS/NO signaling in high fat diet-fed mice. Cardiovasc. Diabetol., 15, 119 (2016).
• 39) Meng TC, Fukada T, Tonks NK. Reversible oxidation and inactivation of protein tyrosine phosphatases in vivo. Mol. Cell, 9, 387–399 (2002).
• 40) Stiles B, Wang Y, Stahl A, Bassilian S, Lee WP, Kim YJ, Sherwin R, Devaskar S, Lesche R, Magnuson MA, Wu H. Liver-specific deletion of negative regulator PTEN results in fatty liver and insulin hypersensitivity. Proc. Natl. Acad. Sci. U.S.A., 101, 2082–2087 (2004).
• 41) Egawa K, Maegawa H, Shimizu S, Morino K, Nishio Y, Bryer-Ash M, Cheung AT, Kolls JK, Kikkawa R, Kashiwagi A. Protein–tyrosine phosphatase-1B negatively regulates insulin signaling in l6 myocytes and Fao hepatoma cells. J. Biol. Chem., 276, 10207–10211 (2001).
• 42) Barrett WC, DeGnore JP, König S, Fales HM, Keng YF, Zhang ZY, Yim MB, Chock PB. Regulation of PTP1B via glutathionylation of the active site cysteine 215. Biochemistry, 38, 6699–6705 (1999).
• 43) Cruz CM, Rinna A, Forman HJ, Ventura AL, Persechini PM, Ojcius DM. ATP activates a reactive oxygen species-dependent oxidative stress response and secretion of proinflammatory cytokines in macrophages. J. Biol. Chem., 282, 2871–2879 (2007).