Hydroxycarboxylic Acid Receptor Ligands Modulate Proinflammatory Cytokine Expression in Human Macrophages and Adipocytes without Affecting Adipose Differentiation

Abstract

Members of the hydroxycarboxylic acid receptor (HCA1–3) family are mainly expressed in adipocytes and immune cells. HCA2 ligand, niacin, has been used for decades as lipid-modifying drug. Recent studies suggest that HCA ligands can be involved in the modulation of inflammatory processes. In this study, we evaluated the effects of HCA1–3 ligands on adipose differentiation and cytokine expression in human adipocytes and macrophages. Simpson–Golabi–Behmel syndrome (SGBS) preadipocytes were induced to differentiate into adipocytes for 8 d in the presence or absence of HCA ligands and evaluated for lipid accumulation and adipogenic gene expression. The inhibitory effects of the ligands on the expression and production of cytokines were measured in lipopolysaccharide (LPS)-stimulated adipocytes and THP-1 macrophage cells. Preadipocytes treated with HCA ligands showed no changes in the capacity to differentiate into adipocytes and no significant alteration in peroxisome proliferator activated receptor γ (PPARγ) or its target gene expression. HCA2–3 ligands significantly downregulated LPS-induced expression of interleukin (IL)-6 (53–64%), tumor necrosis factor-α (TNF-α) (55–69%) and IL-8 (51–59%) in adipocytes and macrophages. IL-1β inhibition (58–68%) by HCA2–3 ligands was observed only in adipocytes. Furthermore, LPS increased the expression of HCA2–3 in adipocytes and macrophages and this expression was decreased by treatment with their ligands. These results suggest that HCA ligands modulated LPS-mediated pro-inflammatory gene expression in both macrophages and adipocytes without affecting adipogenesis. Therefore, targeting HCA2 and HCA3 would be beneficial in treating inflammation conditions associated with atherosclerosis and obesity.

Adipose tissue is a storage depot for excess calories and also secretes hormones, cytokines and chemokines that influence energy homeostasis and metabolism. Adipose tissue cell types include adipocytes, macrophages, lymphocytes, preadipocytes, and endothelial cells. Numerous studies demonstrate that the interaction between adipocytes and macrophages in fat tissue is important for the pathogenesis of metabolic syndrome.^1,2)

Hydroxycarboxylic acid receptors (HCA), formerly known as nicotinic acid receptors, are G-protein coupled receptors in a family with three subtypes: HCA1 (GPR81), HCA2 (GPR109A), and HCA3 (GPR109B).³⁾ Antidislypidemic agent niacin was the first ligand described for HCA2 and HCA3 subtypes. Endogenous ligands that are intermediates of metabolic processes have been reported for these receptors such as lactate (an HCA1 ligand), 3-hydroxybutyrate (an HCA2 ligand) and 3-hydroxyoctanoate (an HCA3 ligand).^4–6)

HCA subtypes are predominantly expressed in adipocytes in white and brown adipose tissue, where they decrease triglyceride lipolysis and the release of free fatty acids by coupling to Gi-type G proteins.^7–9) HCA2 and HCA3 are also expressed to a lesser extent in retinal pigment and intestinal epithelium, keratinocytes and immune cells, specifically monocytes, macrophages and neutrophils.^10–12) Expression of all three HCA subtypes increases during preadipocyte differentiation. Several studies reported that expression of HCA is modulated by various pathophysiological conditions including cancer, obesity, psoriasis, atherosclerosis.^13–17) Expression of the HCA1 in adipose tissue is reduced in a mouse model of obesity and in response to inflammatory stimuli such as lipopolysaccharide (LPS) and zymosan. In contrast, in adipose tissue, the HCA2 is reduced in chronic obesity, but increased in both adipocytes and macrophages after acute LPS treatment.^14,15) It has been demonstrated that HCA subtypes are overexpressed in different types of cancer cells, such as squamous cell skin cancers,¹⁶⁾ colon, pancreatic and breast cancer cells, modulating cancer cell metabolism, proliferation and survival.^18,19)

The HCA2 ligand niacin suppresses the expression of inflammatory molecules in several cell types. In macrophages, niacin reduces proinflammatory function by inhibiting proinflammatory cytokine production, chemotaxis, and low density lipoprotein uptake.^20–22) However, whether HCA1 and HCA3 are involved in mediation of anti-inflammatory responses in adipose tissue and macrophages is unclear. In this study, we investigated whether the agonists of the three HCA subtypes modulated human preadipocyte diferentiation and inflammatory cytokine gene expression in LPS-stimulated human adipocytes and macrophages.

MATERIALS AND METHODS

Cell Culture and Differentiation Induction

The human THP-1 monocyte cell line was obtained from ATC C (American Type Culture Collection). THP-1 cells were maintained in RPMI-1640 medium containing 10% fetal bovine serum and antibiotics, and incubated in 5% CO₂ at 37°C. THP-1 monocytes were stimulated to differentiate into macrophages with phorbol 12-myristate 13-acetate (PMA; 8 ng/mL) for 24 h. Medium was exchanged for PMA-free medium for 48 h before cells were used for experiments.

A human preadipocyte Simpson–Golabi–Behmel syndrome (SGBS) cell line was a generous gift from Professor Dr. M. Wabitch (University of Ulm, Germany). SGBS cells were grown to confluence in Dulbecco’s modified Eagle’s medium-nutrient mixture F12 (DMEM/F12) supplemented with biotin (0.008 g/L), pantothenate (0.004 g/L) and 10% fetal calf serum and grown in 5% CO₂ at 37°C.

Differentiation of SGBS preadipocytes into mature adipocytes was done by using adipogenic modulators as described.²³⁾ SGBS cells were used at day 0, 4 or 8 after differentiation induction.

Cell Treatment

For studying the effects of HCA ligands on adipogenesis, SGBS cells were treated throughout the differentiation process with 50 µM niacin (NA) to stimulate the HCA2,⁹⁾ 50 µM 1-isopropyl-1H-benzotriazole-5-carboxylic acid (IPBT) to stimulate the HCA3,²⁴⁾ or 100 µM dihydroxybenzoic acid (DHBA) to stimulate the HCA1.²⁵⁾ For studying the effects of HCA ligands on differentiated THP-1 and SGBS cells, cells were pretreated with ligands for 1 h before the addition of 1 µg/mL LPS for 4 h. Optimal concentrations of HCA ligands were established from preliminary dose response experiments for NA (1 to 100 µM), IPBT (1 to 100 µM) and DHBA (50 to 200 µM).

Oil Red O Staining

Adipogenesis was monitored by measuring lipid accumulation through tryglyceride staining with Oil Red O dye (Sigma, U.S.A.). Cells were washed twice with phosphate buffered saline (PBS) and fixed with 4% paraformaldehyde for 10 min at 37°C. Cells were rinsed with PBS and incubated with freshly diluted Oil Red O dye for 30 min at 37°C. Cells were washed again before visualization under a light microscope. For quantitative analysis, cells were destained with 100% isopropanol for 10 min. Eluted Oil Red O dye was transferred into a 96-well plate and absorbance read at 490 nm with Victor3 microplate reader (PerkinElmer, Inc., U.S.A.).

RT-Quantitative (q)PCR

Total RNA was isolated from cultured cells using TRIzol reagent (Sigma), according to the manufacturer’s protocol. First-strand cDNA was synthesized from 1 µg RNA using oligo(dT) primers with Revert Aid H Minus kits (Thermo Fisher Scientific, U.S.A.). RT-qPCR was performed using Absolute Blue SYBR green Master Mix reagent (Thermo Fisher Scientific) with a ViiA7 real-time PCR detection system (Applied Biosystems, U.S.A.). Primer sequences are described in Table 1. mRNA levels were quantified in duplicate, normalized to levels of reference gene RPS29 using the 2^−ΔΔCt method and presented as relative expression compared with values at day 0 or untreated cells.

Table 1. Sequences for RT-qPCR Primers Used in This Study

Gene name	Forward sequence	Reverse sequence
HCAR1	GCCTGCCTTTTCGGACAGACTA	ACCACCGTAAGGAACACGATGC
HCAR2	TGATGCTCTTCATGTTGGCT	GCTGAAGCTGCTGCACAA
HCAR3	CTGTTTCCACCTCAAGTCCTGG	CAGTCTGAACGCCGCACATAGT
PPARG	AGCCTGCGAAAGCCTTTTGGTG	GGCTTCACATTCAGCAAACCTGG
CD36	CAGGTCAACCTATTGGTCAAGCC	GCCTTCTCATCACCAATGGTCC
GLUT4	CCATCCTGATGACTGTGGCTCT	GCCACGATGAACCAAGGAATGG
HSL	AGCCTTCTGGAACATCACCGAG	TCGGCAGTCAGTGGCATCTCAA
IL6	AGACAGCCACTCACCTCTTCAG	TTCTGCCAGTGCCTCTTTGCTG
IL8	GAGAGTGATTGAGAGTGGACCAC	CACAACCCTCTGCACCCAGTTT
IL1B	CCACAGACCTTCCAGGAGAATG	GTGCAGTTCAGTGATCGTACAGG
TNFA	CCCAGGGACCTCTCTCTAATCA	AGCTGCCCCTCAGCTTGAG
RPS29	CAAGATGGGTCACCAGCAG	GTATTTGCGGATCAGACCGT

Measurement of Proinflammatory Cytokines Production

SGBS or THP-1 cells were pretreated with the respective HCA agonist for 1 h and then the cells were stimulated with LPS (1 µg/mL) for 18 h. The supernatants were collected and the levels of interleukin (IL)-6, tumor necrosis factor-α (TNF-α) and IL-1β were determined with Milliplex MAP kits (Merk, Millipore, U.S.A.) as following the manufacturer’s protocol.

Nuclear Factor-KappaB (NF-κB) Dependent Luciferase Reporter Assays

THP-1 macrophages were seeded in 96-well culture plates at a density of 1×10⁴ cells per well and cultured for 24 h. The cells were then transfected with pNF-κB-Luc plasmid (PathDetect cis-reporting system, Stratagene) using TurboFect (Thermo Fisher Scientific). For each transfection 0.2 µg of plasmid and 0.4 µL of TurboFect were mixed in 20 µL cell medium and incubated for 15 min before addition to the cells. After incubation for 24 h in serum-free medium, cells were pretreated with 50 µM niacin, 50 µM IPBT or 1 µM NF-κB inhibitor ME10092²⁶⁾ for 1 h, followed by LPS stimulation for 5 h. Luciferase activity was determined using a Bright-Glo luciferase assay kit (Promega, U.S.A.) following the manufacturer’s instructions. Cell lysate aliquots of 25 µL were used to determine the protein content using Pierce BCA protein assay kit (Thermo Fisher Scientific). The luminescence relative light units were normalized to the protein content of each sample. Data were collected from at least three independent experiments, each performed in triplicate.

Statistical Analysis

Results are expressed as mean±standard deviation (S.D.) of the indicated number of experiments. Student’s t-test was used to assess the statistical significance of differences. Significant differences were assumed for p<0.05.

RESULTS

Effects of HCA Ligands on Human SGBS Cell Adipogenesis

To examine whether HCA ligands modulated adipogenesis, SGBS preadipocytes were differentiated in the absence or presence of 50 µM niacin, 50 µM IPBT or 100 µM DHBA for 8 d. At 8 d of differentiation, SGBS preadipocytes differentiated into adipocytes and accumulated triglyceride droplets (Fig. 1A). When HCA ligands were added to preadipocytes during differentiation, adipocyte morphological changes were similar to untreated adipocytes. We assessed lipid accumulation as absorbance of Oil Red O extracted from stained cells. The results showed that triglyceride production during preadipocyte differentiation increased in differentiated cells compared to undifferentiated cells. However, none of the HCA ligands modulated the accumulation of intracellular triglycerides in differentiated cells (Fig. 1B).

Fig. 1. Effect of HCA Ligands on Adipogenesis and Receptor Expression in Human SGBS Cells

SGBS preadipocytes were differentiated in the absence or presence of 50 µM niacin (NA), 50 µM IPBT or 100 µM DHBA for 8 d. (A) Microphotography of human SGBS at different days of differentiation (400× magnification) with Oil Red O stained lipids shown in red. (B) Lipid accumulation in SGBS cells at day 0, 4 and 8 of differentiation with and without the presence of HCA ligands. Lipid accumulation was assessed by extracting the Oil Red O from stained cells and measuring the absorbance at 490 nm. (C) Expression of HCA genes in SGBS during differentiation. Expression of HCA genes in HCA ligand-treated cells was assessed at day 8 of differentiation. The data are expressed relative to value from day 0 cells, which was defined as 1. All data are represented as a mean±S.D. of at least three independent experiments. p>0.05 for all ligand treatments compared to control cells at day 8. (Color figure can be accessed in the online version.)

In SGBS cells, differentiation caused a marked upregulation in the expression of the genes for all three HCA compared to preadipocytes, in which only low expression was observed (Fig. 1C). HCA gene expression did not significantly (p>0.05) change in the presence of niacin, IPBT or DHBA during differentiation (Fig. 1C).

Effects of HCA Ligands on Expression of Adipogenic Transcription Factors

We investigated the expression of adipogenic genes during preadipocyte differentiation in cells treated and not treated with HCA ligands. Expression levels of the master transcription factor-peroxisome proliferator activated receptor γ (PPARγ) and its target genes cluster of differentiation (CD36), glucose transporter type 4 (Glut4) and hormone-sensitive lipase (HSL) were increased starting from day 4 when compared to levels in undifferentiated cells (Figs. 2A–D). The expression of these genes was not significantly altered by the presence of niacin, IPBT or DHBA in the differentiation medium (Figs. 2A–D).

Fig. 2. Effect of HCA Ligands on Adipogenic Factor Gene Expression in SGBS during Differentiation

SGBS preadipocytes were differentiated in the absence or presence of 50 µM niacin (NA), 100 µM DHBA or 50 µM IPBT for 8 d. Expression of adipogenic factor genes in HCA ligand-treated cells was assessed at day 8 of differentiation. Relative gene expression of PPARG (A), CD36 (B), GLUT4 (C) and HSL (D) was analysed by RT-qPCR and expressed relative to value from day 0 cells, which was defined as 1. All data are represented as a mean±S.D. of three independent experiments. p>0.05 for all ligand treatments compared to control cells at day 8.

LPS Modulation of HCA Expression in Adipocytes and Macrophages

To simulate the adipose tissue inflammation seen in obesity, SGBS adipocytes and THP-1 macrophages were challenged for 4 h with the proinflammatory molecule LPS in the presence or absence of niacin, DHBA, or IPBT. Expression from HCA genes was analyzed. Stimulation of adipocytes and macrophages with 1 µg/mL LPS led to a marked increase in the expression of the genes for HCA2 and HCA3 compared to unstimulated cells. In contrast, expression of the gene for the HCA1 was slightly decreased by LPS, although this effect was not statistically significant compared to unstimulated cells (p>0.05) (Fig. 3). Niacin and IPBT significantly reduced LPS upregulation of the expression of the HCA2 and HCA3 genes (p<0.05).

Fig. 3. Effect of LPS and HCA Ligands on HCA Gene Expression in Adipocytes and Macrophages

THP-1 and SGBS cells were pretreated for 1 h with HCA ligands and then activated by LPS for 4 h. HCA gene expression was analysed by RT-qPCR and expressed relative to value from untreated cells, which was defined as 1. * p<0.05 compared with LPS treatment. Results are average±S.D. of at least three independent experiments.

Inhibition of Cytokine Gene Expression and Production in Adipocytes and Macrophages by HCA Ligands

To determine whether HCA ligands inhibited cytokine expression in inflamed adipocytes and macrophages, cells were pretreated with DHBA, niacin or IPBT for 1 h before addition of LPS for 4 h. In the absence of LPS, expression of the genes for IL-6, TNF-α, IL-1β, and IL-8 was very low in macrophages and adipocytes. However, cytokine expression increased relative to unstimulated cells after stimulation with LPS (Figs. 4A–C). The incubation of cells with niacin, DHBA, or IPBT did not change the basal expression of the investigated cytokines. Niacin showed significant downregulation of LPS-induced IL-6 (61±13 and 59±6%), TNF-α (69±8 and 55±4%) and IL-8 (58±6 and 53±8%) gene expression levels in adipocytes and macrophages, respectively. Furthermore, treatment with IPBT significantly reduced LPS-induced IL-6 (53±8 and 64±4%), TNF-α (63±9 and 59±7%) and IL-8 (51±7 and 59±6%) expression levels in adipocytes and macrophages, respectively (Figs. 4A–C). However, significant inhibition of IL-1β expression by niacin (68±7%) and IPBT (58±5%) was observed only in adipocytes (Fig. 4C). In contrast, the HCA1 ligand DHBA did not alter expression of any of the cytokines in either adipocytes or macrophages (Figs. 4A–C). The inhibitory effects of the ligands on cytokine production were similar to those on cytokine gene expression in adipocytes (Fig. 4D) and macrophages (data not shown).

Fig. 4. Modulation of LPS Induced Cytokine Gene Expression and Production by HCA Ligands

IL-6, IL-8, IL-1β and TNF-α gene expression levels in THP-1 (A, C) and SGBS (B, C) cells were analysed by RT-qPCR and expressed relative to value from LPS-treated cells defined as 100%. The concentration of IL-6, IL-1β and TNF-α in the medium of LPS-treated SGBS cells (D). All data are represented as a mean±S.D. of three independent experiments. * p<0.05 for NA, IPBT and ME10092 treatments compared to LPS-treated cells.

Possible Mechanism of HCA Ligand Inhibition of Cytokine Gene Expression

NF-κB transcription factor stimulates the expression of multiple genes involved in the immune response. Pretreatment of THP-1 macrophages for 1 h with the NF-κB inhibitor ME10092 (1 µM) attenuated LPS-stimulated expression of the TNF-α and IL-6 genes, similar to the effect observed with the HCA ligands (Fig. 4A). LPS-induced upregulation of NF-κB transcriptional activity in macrophages was significantly inhibited by both niacin and IPBT (Fig. 5).

Fig. 5. Effect of LPS and HCA Ligands on NF-κB-Dependent Luciferase Reporter Activity

NF-κB-Dependent transcriptional activity was measured by NF-κB-dependent promoter luciferase reporter gene assay. Fold change in luciferase activity in comparison to untreated cells is shown. Results are average±S.D. of at least three independent experiments. * p<0.05 compared with LPS treatment.

DISCUSSION

In this study, we investigated the expression of HCA subtypes and the effects of their agonists on adipogenesis and inflammation. We used the SGBS adipocyte cell line, which was established from human subcutaneous fat and is a useful model system for adipogenesis, fat cell function, and adipose tissue inflammation.^23,27) We demonstrated that all three HCA were expressed in SGBS preadipocytes at low levels that were markedly upregulated during adipogenesis. The expression levels of the HCA2 and HCA3 were similar, and much higher than the expression of the HCA1. In contrast to our findings in human adipocytes, HCA1 and HCA2 showed similar expression levels in mouse 3T3-L1 adipocytes.²⁸⁾

Adipogenesis is regulated by transcription factors such as CCAAT-enhancer-binding proteins (C/EBPs) and PPARγ, which are master regulators of adipogenesis. Both C/EBPβ and C/EBPδ are expressed in early adipogenesis and enhance the subsequent expression of C/EBPα and PPARγ which induce the expression of genes involved in lipogenesis and lipolysis.²⁹⁾ In our study, niacin (an HCA2 ligand), IPBT (an HCA3 ligand), and DHBA (an HCA1 ligand) did not affect human preadipocyte differentiation as assessed by adipogenic gene expression, adipocyte morphology and triglyceride accumulation. In contrast to our findings in human adipocytes, Fujimori and Amano³⁰⁾ reported that, in mouse 3T3-L1 adipocytes, the HCA2 ligand niacin decreased C/EBPβ expression in early adipogenesis and promoted adipogenesis by suppressing the production of the anti- adipogenic prostaglandin F_2α via repression of C/EBPβ-activated cyclooxygenase-2 expression.

Obesity is associated with chronic, low-grade inflammation of adipose tissue, and characterized by macrophage infiltration and increased production of proinflammatory cytokines and chemokines such as TNF-α, monocyte chemoattractant protein-1, IL-1β and IL-6.¹⁾ In this study, we found that treatment with LPS significantly increased expression of HCA2 and HCA3, but slightly decreased expression of the HCA1 in adipocytes and macrophages. To date, no studies have demonstrated an effect of obesity or inflammation on HCA3 expression. Other studies also showed that exposure of murine 3T3-L1 adipocytes to inflammatory (TNF-α, IL-1), bacterial (LPS), fungal (zymosan) stimuli increases HCA2 expression, which led to the decreased accumulation of lipids in the cell.^14,20,31) In contrast, high fat diet-induced obesity decreases HCA2 and HCA1 gene expression in mouse adipose tissue.²⁰⁾

Since the level of HCA2 and HCA3 increased with LPS treatment, we hypothesized that agonists of these receptors would modulate LPS-induced proinflammatory cytokine production. Indeed, both niacin, a ligand of the HCA2, and IPBT, a ligand of the HCA3, significantly suppressed LPS-induced expression of the proinflammatory cytokines IL-6, TNF-α, and IL-8 in human adipocytes and macrophages. These cytokines are critical for numerous inflammatory diseases including diabetes, atherosclerosis and cancer. In contrast, DHBA, a ligand of the HCA1, did not affect the LPS inflammatory response in either adipocytes or macrophages. Consistent with our observations, niacin is reported to suppress LPS-induced expression of TNF-α, IL-6, and IL-12p40 in mouse macrophages.^14,22)

Given that NF-κB is a master transcription factor involved in the regulation of numerous inflammatory genes,³²⁾ we examined whether HCA-mediated signalling modulated NF-κB activation. We found that LPS-induced NF-κB transcriptional activity in human macrophages was significantly inhibited by niacin or IPBT suggesting that HCA ligands modulate proinflammatory cytokine expression at least partly through the NF-κB pathway. Previous studies have shown that niacin suppressed LPS-induced NF-κB activation and IL-6 and TNF-α expression in lung tissue and cultured human monocytes through prevention of phosphorylation/ degradation of inhibitor κB alpha (IκBα) and phosphorylation/ nuclear translocation of NF-κB.^21,22,33) In the present study, the anti-inflammatory effects and expression level of the receptors were shared by HCA2 and HCA3 but not HCA1. Interestingly, HCA2 and HCA3 genes arose through gene duplication events, and their proteins share 96% amino acid sequence similarity, while HCA1 shares only 55% homology.

In summary, our results provide evidence that HCA2 and HCA3 ligands modulated LPS-mediated pro-inflammatory gene expression in both human macrophages and adipocytes without affecting adipogenesis. Therefore, targeting HCA2 and HCA3 would be beneficial in treating inflammation conditions associated with atherosclerosis and obesity-related adipose tissue inflammation.

Acknowledgments

This work was supported by the Latvian Council of Science Grant 09.1280.01, Latvian State Research Program (4VPP-2010-2/2.1) and European Research and Development Foundation (ERDF) project 2010/0310/2DP/2.1.1.1.0/10/APIA/VIAA/069.

Conflict of Interest

The authors declare no conflict of interest.

REFERENCES

• 1) Eder K, Baffy N, Falus A, Fulop AK. The major inflammatory mediator interleukin-6 and obesity. Inflamm. Res., 58, 727–736 (2009).
• 2) Galic S, Oakhill JS, Steinberg GR. Adipose tissue as an endocrine organ. Mol. Cell. Endocrinol., 316, 129–139 (2010).
• 3) Wise A, Foord SM, Fraser NJ, Barnes AA, Elshourbagy N, Eilert M, Ignar DM, Murdock PR, Steplewski K, Green A, Brown AJ, Dowell SJ, Szekeres PG, Hassall DG, Marshall FH, Wilson S, Pike N. Molecular identification of high and low affinity receptors for nicotinic acid. J. Biol. Chem., 278, 9869–9874 (2003).
• 4) Ahmed K, Tunaru S, Langhans CD, Hanson J, Michalski CW, Kölker S, Jones PM, Okun JG, Offermanns S. Deorphanization of GPR109B as a receptor for the beta-oxidation intermediate 3-OH-octanoic acid and its role in the regulation of lipolysis. J. Biol. Chem., 284, 21928–21933 (2009).
• 5) Cai TQ, Ren N, Jin L, Cheng K, Kash S, Chen R, Wright SD, Taggart AK, Waters MG. Role of GPR81 in lactate-mediated reduction of adipose lipolysis. Biochem. Biophys. Res. Commun., 377, 987–991 (2008).
• 6) Taggart AK, Kero J, Gan X, Cai TQ, Cheng K, Ippolito M, Ren N, Kaplan R, Wu K, Wu TJ, Jin L, Liaw C, Chen R, Richman J, Connolly D, Offermanns S, Wright SD, Waters MG. (D)-β-Hydroxybutyrate inhibits adipocyte lipolysis via the nicotinic acid receptor PUMA-G. J. Biol. Chem., 280, 26649–26652 (2005).
• 7) Ahmed K. Biological roles and therapeutic potential of hydroxy-carboxylic acid receptors. Front. Endocrinol., 2, 51 (2011).
• 8) Soga T, Kamohara M, Takasaki J, Matsumoto S, Saito T, Ohishi T, Hiyama H, Matsuo A, Matsushime H, Furuichi K. Molecular identification of nicotinic acid receptor. Biochem. Biophys. Res. Commun., 303, 364–369 (2003).
• 9) Tunaru S, Kero J, Schaub A, Wufka C, Blaukat A, Pfeffer K, Offermanns S. PUMA-G and HM74 are receptors for nicotinic acid and mediate its anti-lipolytic effect. Nat. Med., 9, 352–355 (2003).
• 10) Gambhir D, Ananth S, Veeranan-Karmegam R, Elangovan S, Hester S, Jennings E, Offermanns S, Nussbaum JJ, Smith SB, Thangaraju M, Ganapathy V, Martin PM. GPR109A as an anti-inflammatory receptor in retinal pigment epithelial cells and its relevance to diabetic retinopathy. Invest. Ophthalmol. Vis. Sci., 53, 2208–2217 (2012).
• 11) Kostylina G, Simon D, Fey MF, Yousefi S, Simon HU. Neutrophil apoptosis mediated by nicotinic acid receptors (GPR109A). Cell Death Differ., 15, 134–142 (2008).
• 12) Thangaraju M, Cresci GA, Liu K, Ananth S, Gnanaprakasam JP, Browning DD, Mellinger JD, Smith SB, Digby GJ, Lambert NA, Prasad PD, Ganapathy V. GPR109A is a G-protein-coupled receptor for the bacterial fermentation product butyrate and functions as a tumor suppressor in colon. Cancer Res., 69, 2826–2832 (2009).
• 13) Miller CL, Dulay JR. The high-affinity niacin receptor HM74A is decreased in the anterior cingulate cortex of individuals with schizophrenia. Brain Res. Bull., 77, 33–41 (2008).
• 14) Wanders D, Graff EC, Judd RL. Effects of high fat diet on GPR109A and GPR81 gene expression. Biochem. Biophys. Res. Commun., 425, 278–283 (2012).
• 15) Feingold KR, Moser A, Shigenaga JK, Grunfeld C. Inflammation inhibits GPR81 expression in adipose tissue. Inflamm. Res., 60, 991–995 (2011).
• 16) Bermudez Y, Benavente CA, Meyer RG, Coyle WR, Jacobson MK, Jacobson EL. Nicotinic acid receptor abnormalities in human skin cancer: implications for a role in epidermal differentiation. PLoS ONE, 6, e20487 (2011).
• 17) Chai JT, Digby JE, Ruparelia N, Jefferson A, Handa A, Choudhury RP. Nicotinic acid receptor GPR109A is down-regulated in human macrophage-derived foam cells. PLOS ONE, 8, e62934 (2013).
• 18) Roland CL, Arumugam T, Deng D, Liu SH, Philip B, Gomez S, Burns WR, Ramachandran V, Wang H, Cruz-Monserrate Z, Logsdon CD. Cell surface lactate receptor GPR81 is crucial for cancer cell survival. Cancer Res., 74, 5301–5310 (2014).
• 19) Stäubert C, Broom OJ, Nordström A. Hydroxycarboxylic acid receptors are essential for breast cancer cells to control their lipid/ fatty acid metabolism. Oncotarget, 6, 19706–19720 (2015).
• 20) Digby JE, Martinez F, Jefferson A, Ruparelia N, Chai J, Wamil M, Greaves DR, Choudhury RP. Anti-inflammatory effects of nicotinic acid in human monocytes are mediated by GPR109A dependent mechanisms. Arterioscler. Thromb. Vasc. Biol., 32, 669–676 (2012).
• 21) Kwon WY, Suh GJ, Kim KS, Kwak YH. Niacin attenuates lung inflammation and improves survival during sepsis by downregulating the nuclear factor-kappaB pathway. Crit. Care Med., 39, 328–334 (2011).
• 22) Zhou E, Li Y, Yao M, Wei Z, Fu Y, Yang Z. Niacin attenuates the production of pro-inflammatory cytokines in LPS-induced mouse alveolar macrophages by HCA2 dependent mechanisms. Int. Immunopharmacol., 23, 121–126 (2014).
• 23) Fischer-Posovszky P, Newell FS, Wabitsch M, Tornqvist HE. Human SGBS cells—A unique tool for studies of human fat cell biology. Obes Facts, 1, 184–189 (2008).
• 24) Semple G, Skinner PJ, Cherrier MC, Webb PJ, Sage CR, Tamura SY, Chen R, Richman JG, Connolly DT. 1-Alkyl-benzotriazole-5-carboxylic acids are highly selective agonists of the human orphan G-protein-coupled receptor GPR109b. J. Med. Chem., 49, 1227–1230 (2006).
• 25) Dvorak CA, Liu C, Shelton J, Kuei C, Sutton SW, Lovenberg TW, Carruthers NI. Identification of hydroxybenzoic acids as selective lactate receptor (GPR81) agonists with antilipolytic effects. ACS Med. Chem. Lett., 3, 637–639 (2012).
• 26) Dambrova M, Zvejniece L, Skapare E, Vilskersts R, Svalbe B, Baumane L, Muceniece R, Liepinsh E. The anti-inflammatory and antinociceptive effects of NF-kappaB inhibitory guanidine derivative ME10092. Int. Immunopharmacol., 10, 455–460 (2010).
• 27) Keuper M, Dzyakanchuk A, Amrein KE, Wabitsch M, Fischer-Posovszky P. THP-1 macrophages and SGBS adipocytes—A new human in vitro model system of inflamed adipose tissue. Front. Endocrinol., 2, 1–8 (2011).
• 28) Jeninga EH, Bugge A, Nielsen R, Kersten S, Hamers N, Dani C, Wabitsch M, Berger R, Stunnenberg HG, Mandrup S, Kalkhoven E. Peroxisome proliferators-activated receptor gamma regulates expression of the anti-lipolytic G-protein-coupled receptor 81 (GPR81/GPR81). J. Biol. Chem., 284, 26385–26393 (2009).
• 29) Lowe CE, O’Rahilly S, Rochford JJ. Adipogenesis at a glance. J. Cell Sci., 124, 2681–2686 (2011).
• 30) Fujimori K, Amano F. Niacin promotes adipogenesis by reducing production of anti-adipogenic PGF2alpha through suppression of C/EBP beta-activated COX-2 expression. Prostaglandins Other Lipid Mediat., 94, 96–103 (2011).
• 31) Feingold KR, Moser A, Shigenaga JK, Grunfeld C. Inflammation stimulates niacin receptor (GPR109A/HCA2) expression in adipose tissue and macrophages. J. Lipid Res., 55, 2501–2508 (2014).
• 32) Takashiba S, Van Dyke TE, Amar S, Murayama Y, Soskolne AW, Shapira L. Differentiation of monocytes to macrophages primes cells for lipopolysaccharide stimulation via accumulation of cytoplasmic nuclear factor kappaB. Infect. Immun., 67, 5573–5578 (1999).
• 33) Zandi-Nejad K, Takakura A, Jurewicz M, Chandraker AK, Offermanns S, Mount D, Abdi R. The role of HCA2 (GPR109A) in regulating macrophage function. FASEB J., 27, 4366–4374 (2013).