Triiodothyronine Aggravates Global Cerebral Ischemia–Reperfusion Injury in Mice

Abstract

Thyroid hormones (THs) have been suggested to play an important role in both physiological and pathological events in the central nervous system. Hypothyroidism, which is characterized by low levels of serum THs, has been associated with aggravation of ischemic neuronal injuries in stroke patients. We hypothesized that administration of T₃, the main active form of THs, may attenuate the ischemic neuronal injuries. In mice, global cerebral ischemia (GCI), which is induced by transient occlusion of the bilateral common carotid artery, causes neuronal injuries by inducing neuronal death and activating inflammatory responses after reperfusion in the hippocampus. In this study, we examined the effect of T₃ administration on DNA fragmentation induced by neuronal death and the activation of inflammatory cells such as astrocytes and microglia in the hippocampus following GCI. The content of nucleosomes generated by DNA fragmentation in the hippocampus was increased by GCI and further increased by T₃ administration. The protein expression levels of glial fibrillary acidic protein (GFAP), an astrocytic marker, and Ionized calcium binding adaptor protein 1 (Iba1), a microglial marker, in the hippocampus were also increased by GCI and further increased by T₃ administration. The levels of T₃ in both the serum and hippocampus were elevated by T₃ administration. Our results indicate that T₃ administration aggravates GCI–reperfusion injury in mice. There may be an increased risk of aggravation of ischemic stroke by the excessive elevation of T₃ levels during the drug treatment of hypothyroidism.

INTRODUCTION

Thyroid hormones (THs), such as thyroxine (T₄) and triiodothyronine (T₃), play important roles in brain development, morphogenesis, and several functions of the central nervous system in mammals.¹⁾ It is generally accepted that T₃ is responsible for most physiological actions of THs, although T₄ is normally the main secretary product of the thyroid gland, and the extracellular pool of T₄ is much greater than that of T₃.²⁾ It is also considered that T₄ is the prohormone of T₃ because T₄ is converted into T₃ by deiodinase in peripheral tissues and brain.³⁾ In addition, levothyroxine, the levorotatory isomer of T₄, is the standard therapeutic agent for patients with hypothyroidism, characterized by low levels of serum THs.⁴⁾

Global cerebral ischemia (GCI) caused by clinical conditions such as cardiac arrest induces the cell death termed “delayed neuronal death,” one of the serious reperfusion pathologies following cerebral ischemia, which results in physical and mental disabilities.^5,6) It is also well known that GCI induced by bilateral common carotid artery (BCCA) occlusion in experimental studies using mice or rats causes delayed neuronal death in the hippocampus, even if the duration of cerebral ischemia is short.^7–9) Although many researchers have been vigorously studying the pathophysiology of reperfusion injuries following GCI,^10–12) the mechanisms of delayed neuronal death following GCI remain unclear. Consequently, to develop novel neuroprotective therapies and therapeutic agents, it is urgently necessary for us to elucidate the mechanisms.

Recent clinical evidence has shown that hypothyroidism aggravates ischemic injuries in stroke patients.^13,14) Consequently, it is possible that THs have neuroprotective effects against ischemic injuries. However, no study has definitely clarified the pharmacological effect of the administration of T₃, the active form of THs, on ischemic neuronal injuries in the brain. Therefore, our objective in this study was to investigate the effect of T₃ administration on neuronal injuries following GCI induced by BCCA occlusion in mice.

MATERIALS AND METHODS

Animals

The experimental protocol was approved by the Committee of Animal Care and Experiments of Teikyo University (19-004). All the procedures were carried out in strict compliance with the guidelines of the Committee of Animal Care and Experiments of Teikyo University. Male C57BL/6J mice were purchased from SLC Japan (Shizuoka, Japan). Eight- to nine-week-old mice were used in this study.

Induction of GCI

GCI was induced by BCCA occlusion with clips (Mizuho Co., Ltd., Tokyo, Japan) for 15 min under 1.5% isoflurane (FUJIFILM Wako Pure Chemical Corporation, Osaka, Japan) anesthesia in air using a face mask as described previously.¹⁵⁾ Rectal temperature was monitored using a digital thermometer (Brain Science·idea. Co., Ltd., Osaka, Japan) and maintained at 37 °C with a heating blanket. The control mice underwent a sham operation without BCCA occlusion under isoflurane anesthesia for 15 min. We confirmed that the rectal temperature of the mice treated with T₃ was maintained at around 37 °C during GCI.

Administration of Thyroid Hormone

Thirty minutes prior to BCCA occlusion, T₃ (Sigma, St. Louis, MO, U.S.A.) dissolved in saline with 1 mM NaOH was intraperitoneally injected at 5 and 50 µg/kg in a volume of 10 mL/kg.

Analysis of Delayed Neuronal Death in Hippocampus

The nucleosome content in the hippocampus after GCI was quantitatively assayed using a cell death detection enzyme-linked immunosorbent assay (ELISA) kit (Roche Diagnostics, Indianapolis, IN, U.S.A.).¹⁶⁾ The hippocampus was dissected 3 d after GCI and homogenized using a disposable homogenizer (Nippi, Tokyo, Japan) in the incubation buffer (10 µL/mg tissue) for the ELISA kit. The homogenate was centrifuged at 20000 × g for 10 min after incubation for 30 min at room temperature, and the supernatant diluted five folds were used for the assay.

Histological Analysis

Mice were perfused through the left cardiac ventricle with 10 mL of cold phosphate buffered saline (PBS), followed by 30 mL of cold 4% paraformaldehyde in 100 mM phosphate buffer (FUJIFILM Wako Pure Chemical Corporation). After perfusion, whole brains were immediately removed and kept in the same fixative overnight at 4 °C. The brain tissues were sequentially immersed into 10, 15, and 20% sucrose in PBS overnight at 4 °C and then embedded in OTC compound (Sakura Finetek USA Inc., CA, U.S.A.). The coronal sections with 12 µm-thickness were prepared from the brain tissue specimens and mounted on glass slides. Neuronal death in the hippocampus was determined by staining the tissue sections with hematoxylin-eosin (H&E).

Western Blot Analysis

The hippocampus was dissected 3 d after GCI. Protein samples for sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) were prepared by homogenizing the hippocampus in 50 mM Tris-HCl (pH 7.4) buffer containing 320 mM sucrose and 1 mM ethylenediaminetetraacetic acid (EDTA). The protein concentration of the samples was determined using a bicinchoninic acid (BCA) protein assay kit. Total protein at the same amount per lane (20 µg/lane) was separated by electrophoresis in NuPAGE Novex Bis-Tris Mini Gels using an XCell SureLock Mini-Cell (Invitrogen by Thermo Fisher Scientific). Separated proteins were transferred onto nitrocellulose membranes (iBlot Gel Transfer Stacks Nitrocellulose, Mini) using an iBlot Dry Blotting System (Invitrogen by Thermo Fisher Scientific). The membranes were blocked with protein-free blocking buffer (EzBlock Chemi, ATTO, Tokyo, Japan) for 1 h at room temperature. The membranes were washed three times with PBS containing 0.1% (v/v) Tween 20 (PBS-T) and then treated with a rabbit polyclonal anti-glial fibrillary acidic protein (GFAP) or anti-Ionized calcium binding adaptor protein 1 (Iba1) antibody (1 : 1000; Cell Signaling Technology, MA, U.S.A.) at 4 °C overnight. The membranes were washed three times with PBS-T and then treated with an anti-rabbit antibody (1 : 10000; Invitrogen by Thermo Fisher Scientific) and an anti-mouse β-actin antibody (1 : 20000; Santa Cruz Biotechnology Inc., CA, U.S.A.) conjugated with horseradish peroxidase for 1 h. After the membranes were washed three times with PBS-T, chemiluminescence generated by peroxidase activity on membranes was detected using ImmunoStar LD (FUJIFILM Wako Pure Chemical Corporation) and a C-DiGit Blot Scanner (LI-COR, NE, U.S.A.). The relative protein expression levels of the GFAP and Iba1 observed as bands on the membranes were quantified using Image Studio Digit (version 4.0) and normalized to β-actin levels for densitometric analysis.

Determination of Thyroid Hormone Levels in Serum and Hippocampus

The T₃ levels in serum and the hippocampus were determined using ELISA kits (CUSABIO, Houston, TX, U.S.A.).

Determination of Expression Level of Cytokine mRNA in Hippocampus

Total RNA was extracted from tissues using Isogen 2 (Nippon Gene Co., Ltd., Toyama, Japan) and dissolved in nuclease-free water. RNA concentration was determined by measuring UV absorption, and 400 ng of total RNA was reverse-transcribed using PrimeScript RT reagent kits (TaKaRa Bio, Shiga, Japan) to obtain first-stranded cDNA. A cDNA aliquot was subjected to a real-time PCR using SYBR Select Master Mix and a 7500 Fast Real-time PCR system (Thermo Fisher Scientific, MA, U.S.A.). Sequences of the forward and reverse primers used for the amplification of specific cDNA sequences are listed in Table 1. The amplified products were verified by checking the melting curves after the final cycle of each PCR. Gene expression was normalized to β-actin and quantified using the ΔΔCt method.

Table 1. Sequences of Primers Used for Real-Time PCR

Gene	Sequences (5′–3′)	Genebank Acc. No.
β-Actin	forward: CATCCGTAAAGACCTCTATGCCAAC	NM_007393.5
	reverse: ATGGAGCCACCGATCCACA
TGF-β1	forward: GTGTGGAGCAACATGTGGAACTCTA	NM_011577.2
	reverse: CGCTGAATCGAAAGCCCTGTA
TNF-α	forward: CAGGCGGTGCCTATGTCTCA	NM_013693.3
	reverse: GGCTACAGGCTTGTCACTCGAA
IL-1β	forward: TCCAGGATGAGGACATGAGCAC	NM_008361.4
	reverse: GAACGTCACACACCAGCAGGTTA
IL-6	forward: CCACTTCACAAGTCGGAGGCTTA	NM_031168.2
	reverse: TGCAAGTGCATCATCGTTGTTC

Statistical Analyses

Two-way ANOVA was carried out to determine the effects of T₃ on nucleosome content and protein and gene expression levels. The T₃-administered groups were compared by Bonferroni’s/Dunn post hoc test and the sham-operated and GCI mouse groups were compared by unpaired Student’s t-test. In the study on the time courses of T₃ levels in serum and the hippocampus, ANOVA and unpaired Student’s t-test were carried out to compare between vehicle- and T₃-administered groups.

RESULTS

Effect of T₃ on the Occurrence of Delayed Neuronal Death in Hippocampus Following GCI

To accurately clarify the effect of T₃ on the occurrence of delayed neuronal death in the hippocampus, quantitative assay of cell death is required. In this study, we first determined the content of nucleosomes in the hippocampus to quantify the DNA fragmented owing to cell death as described previously.¹⁶⁾

The nucleosome contents in the hippocampus 3 d after GCI induced by BCCA occlusion are shown in Fig. 1. The nucleosome contents in the hippocampus of sham-operated mice administered T₃ were not significantly different from those administered the vehicle. The nucleosome contents of GCI mice administered the vehicle were significantly higher than those of sham-operated mice. In GCI mice, the nucleosome contents in the hippocampus of the mice administered T₃ increased dose dependently after additional T₃ administration, and those of the mice administered T₃ at a dose of 50 µg/kg were significantly higher than those of the mice administered the vehicle. These results indicate that T₃ administration promotes DNA fragmentation in the hippocampus following GCI in mice. We also determined the delayed neuronal death in the hippocampus by histological assessment. As shown in Fig. 1B, GCI was shown to induce pyknotic nuclei in the hippocampus, which was further promoted by T₃ administration.

Fig. 1. Effect of T₃ on Delayed Neuronal Death in Hippocampus Following GCI

GCI was induced by BCCA occlusion for 15 min under 1.5% isoflurane anesthesia. T₃ or the vehicle was intraperitoneally injected 30 min prior to BCCA occlusion. Nucleosome contents in the hippocampus 3 d after reperfusion were determined as described in Materials and Methods (A). Control mice (Sham) were sham-operated without BCCA occlusion under isoflurane anesthesia. Data are expressed as the mean ± standard error (S.E.) of the number of mice indicated in parentheses below each column. ANOVA and then Bonferroni’s post hoc test were carried out to compare among T₃-administered groups (* p < 0.0167 vs. Vehicle) and unpaired Student’s t-test to compare between Sham and GCI mouse groups (^# p < 0.05 vs. Sham). Representative images of H&E staining in the hippocampal CA1 region (B). The black scale bar indicates 50 µm.

Effect of T₃ on Protein Expression Levels of GFAP and Iba1 in Hippocampus Following GCI

The accumulation and activation of glial cells such as astrocytes and microglia in the brain play important roles in the induction of neuroinflammation, which is associated with the development of neuronal injuries.¹⁷⁾

We next evaluated the protein expression levels of GFAP, an astrocytic marker, and Iba1, a microglial marker, by Western blot analysis to investigate the effect of T₃ on the inflammatory responses in the hippocampus following GCI induced by BCCA occlusion in mice. The protein expression levels of GFAP and Iba1 in the hippocampus 3 d after GCI are shown in Fig. 2. The protein expression levels of GFAP in the hippocampus of GCI mice administered the vehicle were higher than those of the sham-operated mice. The protein expression levels of GFAP in the hippocampus of GCI mice administered T₃ increased dose dependently after additional T₃ administration, and those of the mice administered T₃ at a dose of 50 µg/kg were significantly higher than those of the sham-operated mice (Fig. 2B). No Iba1 expression was observed in the hippocampus of sham-operated mice, but was observed in that of GCI mice. Similarly to GFAP expression, the protein expression levels of Iba1 in the hippocampus of GCI mice administered T₃ increased dose dependently after additional T₃ administration_. These results indicate that T₃ administration promotes inflammatory responses in the hippocampus following GCI in mice.

Fig. 2. Effect of T₃ on Neuroinflammation in Hippocampus Following GCI

GCI was induced by BCCA occlusion for 15 min under 1.5% isoflurane anesthesia. T₃ or the vehicle was intraperitoneally injected 30 min prior to BCCA occlusion. GFAP and Iba1 expression levels were determined by Western blot analysis (A). The relative expression levels of proteins bands were normalized to β-actin levels for densitometric analysis (B). Control mice (Sham) were sham-operated without BCCA occlusion under isoflurane anesthesia. Data are expressed as the mean ± S.E. of the number of mice indicated in parentheses below each column. ANOVA and then Bonferroni’s post hoc test were carried out to compare among groups (* p < 0.0083 vs. Sham).

T₃ Levels in Serum and Hippocampus of Mice Administered T₃

To investigate whether the levels of T₃ in serum and the hippocampus were increased by T₃ administration, we determined the T₃ levels in serum and the hippocampus of normal mice administered T₃. The time courses of T₃ levels in serum and the hippocampus after T₃ administration are shown in Fig. 3A. The levels of T₃ in serum of mice 30 min after T₃ administration, equivalent to the start time of ischemia, were significantly higher than those in vehicle-administered mice. The levels of T₃ in the hippocampus of mice 1 h and 45 min after T₃ administration, equivalent to 1 h after reperfusion, were significantly higher than those in vehicle-administered mice. The levels of T₃ in both the serum and hippocampus of mice 24 h and 45 min after T₃ administration were the same as those in vehicle-administered mice. We then determined the T₃ levels in serum and the hippocampus of GCI mice to investigate the effect of GCI on the levels of T₃ in serum and the hippocampus. The T₃ levels in serum and the hippocampus 1 h after reperfusion are shown in Fig. 3B. The levels of T₃ in the serum 1 h after reperfusion in mice administered T₃ at doses of 5 and 50 µg/kg were significantly higher than those in mice administered the vehicle, and those in mice administered T₃ at a dose of 50 µg/kg were significantly higher than those in mice administered T₃ at a dose of 5 µg/kg. The levels of T₃ in the hippocampus 1 h after reperfusion in mice administered T₃ at a dose of 50 µg/kg were significantly higher than those in mice administered the vehicle. These results indicate that the increases in serum and the hippocampal T₃ levels were induced by local T₃ administration in mice.

Fig. 3. Effect of GCI on T₃ Levels in Serum and Hippocampus after T₃ Administration

Time courses of T₃ levels in serum and the hippocampus of normal mice after T₃ administration (A). T₃ levels in serum and the hippocampus 30 min, 45 min, 1 h and 45 min, and 24 h and 45 min after T₃ administration were determined as described in Materials and Methods. T₃ levels in serum and the hippocampus of GCI mice after T₃ administration (B). GCI was induced by BCCA occlusion for 15 min under 1.5% isoflurane anesthesia. T₃ was intraperitoneally injected 30 min prior to BCCA occlusion. T₃ levels in serum and the hippocampus 1 h after reperfusion were determined as described in Materials and Methods. Data are expressed as the mean ± S.E. (n = 3). ANOVA and unpaired Student’s t-test were carried out to compare between vehicle- and T₃-administered groups (* p < 0.05 vs. Vehicle).

Effect of T₃ on the Expression Levels of Cytokine mRNA in Hippocampus

We further investigated the effect of T₃ on the gene induction of transforming growth factor (TGF)-β1, tumor necrosis factor (TNF)-α, interleukin (IL)-1β, and IL-6 in the hippocampus following GCI induced by BCCA occlusion in mice. The expression levels of cytokine mRNA in the hippocampus 3 d after GCI induced by BCCA occlusion are shown in Fig. 4. The expression levels of cytokine mRNA in the hippocampus of sham-operated mice administered T₃ were not significantly different from those administered the vehicle. The expression levels of TGF-β1 mRNA in the hippocampus of GCI mice were significantly higher than those of sham-operated mice. The expression levels of TGF-β1 mRNA in the hippocampus of the GCI mice administered T₃ at a dose of 50 µg/kg were significantly lower than those of the mice administered the vehicle and were reduced by the additional T₃ administration in a dose-dependent manner. The expression levels of TNF-α mRNA in the hippocampus of GCI mice were higher than those of sham-operated mice, but no significant differences were detected between the GCI mice and sham-operated mice administered T₃ at a dose of 50 µg/kg. The expression levels of TNF-α mRNA in the hippocampus of the GCI mice administered T₃ at doses of 5 and 50 µg/kg were significantly lower than those of the mice administered the vehicle and were reduced dose dependently after additional T₃ administration. These results indicate that additional T₃ administration inhibits the enhancement of the TGF-β1 and TNF-α mRNA expression in the hippocampus following GCI in mice.

Fig. 4. Effect of T₃ on the Expression Levels of mRNA of Cytokines in Hippocampus Following GCI

GCI was induced by BCCA occlusion for 15 min under 1.5% isoflurane anesthesia. T₃ or the vehicle was intraperitoneally injected 30 min prior to BCCA occlusion. The expression levels of TGF-β1 (A), TNF-α (B), IL-1β (C), and IL-6 (D) mRNA in the hippocampus 3 d after GCI were determined as described in Materials and Methods. Control mice (Sham) were sham-operated without BCCA occlusion under isoflurane anesthesia. Data are expressed as the mean ± S.E. of the number of mice indicated in parentheses below each column. ANOVA and then Bonferroni’s post hoc test were carried out to compare among T₃-administered groups (* p < 0.0167 vs. Vehicle) and unpaired Student’s t-test to compare between Sham and GCI mouse groups (^# p < 0.05 vs. Sham).

DISCUSSION

Brain T₃ has two sources: (1) the form directly derived from the thyroid glands via circulation and (2) metabolites converted from T₄ by deiodinases in the thyroid glands, other peripheral tissues, and the brain.³⁾ However, because T₃ was administered directly in this study, our results suggest that the levels of T₃ administered locally were increased in serum and the hippocampus. Therefore, this study clarified that T₃ administration aggravated neuronal injuries following GCI induced by BCCA occlusion in mice (Figs. 1, 2).

Previous data showed that T₃ but not T₄ induced apoptosis in primary chick muscle cells.¹⁸⁾ Therefore, we considered that T₃ administration aggravated delayed neuronal death following GCI through the promotion of apoptosis in vivo. It is also well known that cytochrome c is released from mitochondria in intrinsic pathways of apoptosis and subsequently activates caspases, which induce DNA fragmentation, and that Bcl-2, an anti-apoptotic protein, inhibits the mitochondrial cytochrome c release and Bax, an apoptotic protein, enhances.¹⁹⁾ The down-regulation of Bcl-2 and up-regulation of Bax were induced by transient rat middle cerebral artery (MCA) occlusion, which is a model of focal cerebral ischemia such as cerebral infarction.²⁰⁾ However, both GCI and T₃ administration had no significant effect on the expression levels of both Bcl-2 and Bax mRNAs in the hippocampus in our study (data not shown). This result is probably due to differences in the mechanism of neuronal death between the BCCA and MCA occlusion models because the transient MCA occlusion induced the neuronal death by 24 h after reperfusion, unlike the neuronal death delayed for several days after the transient BCCA occlusion. Further experimental studies should be performed to elucidate in detail the role of apoptosis in delayed neuronal death following the transient BCCA occlusion in mice.

THs are associated with the regulation of thermogenesis because they promote basal metabolism.²¹⁾ Previous experimental studies have demonstrated that hyperthermia during cerebral ischemia aggravates the neuronal injuries accompanied by the activation of astrocytes and microglia in the hippocampus.^22,23) Consequently, the aggravation of ischemic neuronal injuries in the hippocampus of mice administered T₃ may be interpreted as the promotion of basal metabolism by the T₃ administered. However, further experimental studies are necessary to define whether the promotion of basal metabolism by systemic T₃ or the increase in the hippocampal T₃ levels directly activates glial cells.

TGF-β is a potent anti-inflammatory cytokine family, which has a wide range of biological activities and its three isoforms, TGF-β1, TGF-β2, and TGF-β3, have been identified in mammals.²⁴⁾ It is known that TGF-β1 is mainly produced by glial cells and neuronal cells and plays a neuroprotective role in the ischemia-reperfusion injury in the brain.^25,26) This study revealed that T₃ administration inhibited the gene induction of TGF-β1 in the hippocampus following GCI (Fig. 4A). Therefore, the inhibition of TGF-β1 expression might be one of the reasons for aggravation of neuronal injuries by additional T₃ administration. On the other hands, TNF-α is a potent pro-inflammatory cytokine produced by inflammatory cells such as macrophages and lymphocytes. Soluble TNF-α (sTNF-α) and transmembrane TNF-α (tmTNF-α), two distinct forms of TNF-α, have been identified. tmTNF-α can be cleaved by TNF-α converting enzyme and released as sTNF-α, which plays an important role in inflammatory responses via TNF-α receptors.²⁷⁾ It is generally accepted that sTNF-α is a mediator of neurodegenerative diseases such as ischemic stroke and Alzheimer’s disease because acute and chronic inflammation elevate sTNF-α at the site of injury in brain,²⁸⁾ and the inhibition of the central induction of TNF-α could attenuate ischemic injuries by suppressing the activation of inflammatory responses in glial and endothelial cells and/or extrinsic pathways of apoptosis through their receptors on neurons.²⁹⁾ This study has also demonstrated that GCI induced the elevation of TNF-α mRNA expression in the hippocampus 3 d after reperfusion (Fig. 4B). Consequently, our observation also suggests that the increase in sTNF-α leads to the development of neuronal injuries in hippocampus following GCI. However, in this study, despite the fact that T₃ administration inhibited the gene induction of TNF-α, the ischemic neuronal injuries in the hippocampus were enhanced by T₃ administration (Figs. 1, 2, 4B). Furthermore, the expression levels of TNF-α mRNA in the hippocampus of GCI mice 1 d after reperfusion were significantly higher than those of sham-operated mice, and T₃ administration was shown to inhibit the gene induction of TNF-α in the same as 3 d after reperfusion (data not shown). This result suggests that the gene induction of TNF-α in the hippocampus was inhibited by T₃ administration throughout the period after reperfusion. Thus, we suppose that the changes in the expression levels of TNF-α mRNA do not account for the aggravation of neuronal injuries by T₃ administration when using our transient BCCA occlusion model. However, the determination of protein levels of sTNF-α in the hippocampus after reperfusion using immunochemical procedures would provide more reliable results for the exploration of the role of TNF-α in the aggravating effects of T₃ administration on neuronal injuries. In addition, T₃ administration tended to inhibit the enhancement of IL-1β and IL-6 mRNA expression in the hippocampus following GCI in mice (Figs. 4C, D). The roles of these pro-inflammatory cytokine genes might be also limited in the aggravating effects of T₃ administration. Further experimental studies should be performed to elucidate in detail the role of pro-inflammatory cytokines in the development of neuronal injuries following the transient BCCA occlusion in mice.

Hippocampus is a putative brain structure associated with learning and memory. In addition, the activation of microglia in the hippocampus is associated with neuronal injuries and hippocampus-dependent memory deficits.^30,31) Recently, Chaalal et al. have demonstrated that hypothyroidism caused deficits of hippocampus-dependent spatial memory in rats, which were normalized by T₃ supplementation,³²⁾ suggesting that T₃ plays an important role in the glial function in the hippocampus. However, in their study, they did not evaluate neuronal injuries in the hippocampus. There are several lines of evidence showing that GCI in rodent models leads to delayed neuronal death in the hippocampus and deficits of learning and memory.^33,34) However, the mechanisms of delayed neuronal death following GCI remain unclear. The elucidation of the mechanism by which T₃ affects delayed neuronal death following GCI may lead to the development of novel neuroprotective agents for cognitive impairments such as Alzheimer’s disease.

In conclusion, we here demonstrated that the administration of T₃ aggravated reperfusion injuries in the hippocampus following GCI induced by BCCA occlusion in mice. Several clinical studies have shown that hyperthyroidism, which is characterized by high levels of THs in serum, also aggravates ischemic injuries^35,36) although it has not been determined whether the aggravation of ischemic injuries is caused by the increase in T₃ and/or T₄ levels. That is, the aggravation of ischemic neuronal injuries by hyperthyroidism might be strongly affected by the increase in T₃ levels. Therefore, patients with hypothyroidism receiving hormonal drug treatment need to be careful with the excessive elevation of T₃ levels in serum.

Acknowledgments

This work was supported by JSPS KAKENHI Grant Number JP19K09336. This research was supported in 2018 by a Grant-in-Aid for the Cooperative Research Project from the Joint Usage/Research Center (Joint Usage/Research Center for Science-Based Natural Medicine), Institute of Natural Medicine, University of Toyama. We thank Dr. Riyo Morimoto-Kamata for conducting histological analysis.

Conflict of Interest

The authors declare no conflict of interest.

REFERENCES

• 1) Liu YY, Brent GA. Thyroid hormone and the brain: mechanisms of action in development and role in protection and promotion of recovery after brain injury. Pharmacol. Ther., 186, 176–185 (2018).
• 2) Oppenheimer JH, Schwartz HL, Mariash CN, Kinlaw WB, Wong NC, Freake HC. Advances in our understanding of thyroid hormone action at the cellular level. Endocr. Rev., 8, 288–308 (1987).
• 3) Chanoine JP, Braverman LE, Farwell AP, Safran M, Alex S, Dubord S, Leonard JL. The thyroid gland is a major source of circulating T3 in the rat. J. Clin. Invest., 91, 2709–2713 (1993).
• 4) Ianiro G, Mangiola F, Di Rienzo TA, Bibbò S, Franceschi F, Greco AV, Gasbarrini A. Levothyroxine absorption in health and disease, and new therapeutic perspectives. Eur. Rev. Med. Pharmacol. Sci., 18, 451–456 (2014).
• 5) Volpe BT, Petito CK. Dementia with bilateral medial temporal lobe ischemia. Neurology, 35, 1793–1797 (1985).
• 6) Petito CK, Feldmann E, Pulsinelli WA, Plum F. Delayed hippocampal damage in humans following cardiorespiratory arrest. Neurology, 37, 1281–1286 (1987).
• 7) Kirino T. Delayed neuronal death in the gerbil hippocampus following ischemia. Brain Res., 239, 57–69 (1982).
• 8) Wu C, Zhan RZ, Qi S, Fujihara H, Taga K, Shimoji K. A forebrain ischemia preconditioning model established in C57Black/Crj6 mice. J. Neurosci. Methods, 107, 101–106 (2001).
• 9) Yang G, Kitagawa K, Matsushita K, Mabuchi T, Yagita Y, Yanagihara T, Matsumoto M. C57BL/6 strain is most susceptible to cerebral ischemia following bilateral common carotid occlusion among seven mouse strains: selective neuronal death in the murine transient forebrain ischemia. Brain Res., 752, 209–218 (1997).
• 10) Kawase M, Murakami K, Fujimura M, Morita-Fujimura Y, Gasche Y, Kondo T, Scott RW, Chan PH. Exacerbation of delayed cell injury after transient global ischemia in mutant mice with CuZn superoxide dismutase deficiency. Stroke, 30, 1962–1968 (1999).
• 11) Marcheselli VL, Hong S, Lukiw WJ, Tian HT, Gronert K, Musto A, Hardy M, Gimenez JM, Chiang N, Serhan CN, Bazan NG. Novel docosanoids inhibit brain ischemia-reperfusion-mediated leukocyte infiltration and inflammatory gene expression. J. Biol. Chem., 278, 43807–43817 (2003).
• 12) Tajiri S, Oyadomari S, Yano S, Morioka M, Gotoh T, Hamada JI, Ushio Y, Mori M. Ischemia-induced neuronal cell death is mediated by the endoplasmic reticulum stress pathway involving CHOP. Cell Death Differ., 11, 403–415 (2004).
• 13) Bunevicius A, Iervasi G, Bunevicius R. Neuroprotective actions of thyroid hormones and low-T3 syndrome as a biomarker in acute cerebrovascular disorders. Expert Rev. Neurother., 15, 315–326 (2015).
• 14) O’Keefe LM, Conway SE, Czap A, Malchoff CD, Benashski S, Fortunato G, Staff I, McCullough LD. Thyroid hormones and functional outcomes after ischemic stroke. Thyroid Res., 8, 9 (2015).
• 15) Doshi M, Kuwatori Y, Ishii Y, Sasahara M, Hirashima Y. Hypothermia during ischemia protects against neuronal death but not acute brain edema following transient forebrain ischemia in mice. Biol. Pharm. Bull., 32, 1957–1961 (2009).
• 16) Shimizu H, Ohgoh M, Ikeda M, Nishizawa Y, Ogura H. Caspase-3-like protease activity-independent apoptosis at the onset of neuronal cell death in the gerbil hippocampus after global ischemia. Biol. Pharm. Bull., 30, 1950–1953 (2007).
• 17) Lucas SM, Rothwell NJ, Gibson RM. The role of inflammation in CNS injury and disease. Br. J. Pharmacol., 147 (Suppl. 1), S232–S240 (2006).
• 18) Nakashima K, Ohtsuka A, Hayashi K. Comparison of the effects of thyroxine and triiodothyronine on protein turnover and apoptosis in primary chick muscle cell cultures. Biochem. Biophys. Res. Commun., 251, 442–448 (1998).
• 19) Green DR, Reed JC. Mitochondria and apoptosis. Science, 281, 1309–1312 (1998).
• 20) Yenari MA, Iwayama S, Cheng D, Sun GH, Fujimura M, Morita-Fujimura Y, Chan PH, Steinberg GK. Mild hypothermia attenuates cytochrome c release but does not alter Bcl-2 expression or caspase activation after experimental stroke. J. Cereb. Blood Flow Metab., 22, 29–38 (2002).
• 21) Walrand S, Short KR, Heemstra LA, Novak CM, Levine JA, Coenen-Schimke JM, Nair KS. Altered regulation of energy homeostasis in older rats in response to thyroid hormone administration. FASEB J., 28, 1499–1510 (2014).
• 22) Kim MJ, Cho JH, Cho JH, Park JH, Ahn JH, Tae HJ, Cho GS, Yan BC, Hwang IK, Lee CH, Bae EJ, Won MH, Lee JC. Impact of hyperthermia before and during ischemia-reperfusion on neuronal damage and gliosis in the gerbil hippocampus induced by transient cerebral ischemia. J. Neurol. Sci., 348, 101–110 (2015).
• 23) Minamisawa H, Smith ML, Siesjö BK. The effect of mild hyperthermia and hypothermia on brain damage following 5, 10, and 15 minutes of forebrain ischemia. Ann. Neurol., 28, 26–33 (1990).
• 24) Dhandapani KM, Brann DW. Transforming growth factor-β: a neuroprotective factor in cerebral ischemia. Cell Biochem. Biophys., 39, 13–22 (2003).
• 25) Pál G, Lovas G, Dobolyi A. Induction of transforming growth factor beta receptors following focal ischemia in the rat brain. PLOS ONE, 9, e106544 (2014).
• 26) Luo D, Zhang Y, Yuan X, Pan Y, Yang L, Zhao Y, Zhuo R, Chen C, Peng L, Li W, Jin X, Zhou Y. Oleoylethanolamide inhibits glial activation via moudulating PPARα and promotes motor function recovery after brain ischemia. Pharmacol. Res., 141, 530–540 (2019).
• 27) Qu Y, Zhao G, Li H. Forward and reverse signaling mediated by transmembrane tumor necrosis factor-alpha and TNF receptor 2: potential roles in an immunosuppressive tumor microenvironment. Front. Immunol., 8, 1675 (2017).
• 28) McCoy MK, Tansey MG. TNF signaling inhibition in the CNS: implications for normal brain function and neurodegenerative disease. J. Neuroinflammation, 5, 45 (2008).
• 29) Hua Q, Zhu XL, Li PT, Liu Y, Zhang N, Xu Y, Jia X. The inhibitory effects of cholalic acid and hyodeoxycholalic acid on the expression of TNF-α and IL-1β after cerebral ischemia in rats. Arch. Pharm. Res., 32, 65–73 (2009).
• 30) Barrientos RM, Higgins EA, Sprunger DB, Watkins LR, Rudy JW, Maier SF. Memory for context is impaired by a post context exposure injection of interleukin-1 beta into dorsal hippocampus. Behav. Brain Res., 134, 291–298 (2002).
• 31) Labrousse VF, Costes L, Aubert A, Darnaudéry M, Ferreira G, Amédée T, Layé S. Impaired interleukin-1beta and c-Fos expression in the hippocampus is associated with a spatial memory deficit in P2X(7) receptor-deficient mice. PLoS ONE, 4, e6006 (2009).
• 32) Chaalal A, Poirier R, Blum D, Laroche S, Enderlin V. Thyroid hormone supplementation restores spatial memory, hippocampal markers of neuroinflammation, plasticity-related signaling molecules, and β-amyloid peptide load in hypothyroid rats. Mol. Neurobiol., 56, 722–735 (2019).
• 33) Volpe BT, Pulsinelli WA, Tribuna J, Davis HP. Behavioral performance of rats following transient forebrain ischemia. Stroke, 15, 558–562 (1984).
• 34) Block F. Global ischemia and behavioural deficits. Prog. Neurobiol., 58, 279–295 (1999).
• 35) Wollenweber FA, Zietemann V, Gschwendtner A, Opherk C, Dichgans M. Subclinical hyperthyroidism in a risk factor for poor functional outcome after ischemic stroke. Stroke, 44, 1446–1448 (2013).
• 36) Sheu JJ, Kang JH, Lin HC, Lin HC. Hyperthyroidism and risk of ischemic stroke in young adults: a 5-year follow-up study. Stroke, 41, 961–966 (2010).