LncRNA Gm16638-201 Inhibits the 14-3-3Ɛ Pathway in the Murine Prefrontal Cortex to Induce Depressive Behaviors

Abstract

The dysregulation of certain long non-coding RNAs (lncRNAs) has been considered to be involved in neuropsychiatric disorders such as depression, implying the vital role of these transcripts. We have previously identified many differentially expressed lncRNAs in chronic unpredictable mild stress (CUMS) induced mice. Among them, lncRNA Gm16638-201 was highly expressed in the hippocampus (HIP) of CUMS, but the specific role and the underlying mechanisms remain unclear. Here, we reported that lncRNA Gm16638-201 was highly expressed in the prefrontal cortex (PFC) of CUMS induced depressive mice. Bioinformatic analysis shows that Gm16638-201 is mainly located in the cytoplasm. Nine neurological-related genes (Elmo2, Satb1, Hnrnpul1, Sipa1l3, Mapt, Tada3, Sgip1, IL-16, and StarD5) were predicted to be regulated in cis or trans by Gm16638-201 and involved into the 14-3-3Ɛ neurotrophic signaling pathway. We further confirmed the down-regulation of 14-3-3Ɛ and the nine predicted target genes in the PFC of CUMS mice except for Sgip1 and IL-16. In addition, they were also down-regulated in the primary cortical cell cultures with overexpression of Gm16638-201 constructed using an adenoviral-medicated gene expression system. In conclusion, we found that overexpression of Gm16638-201 negatively regulated several target genes and inhibited the 14-3-3Ɛ pathway in the PFC of CUMS induced depressive mice. This promising result suggests that Gm16638-201 may be a potential novel therapeutic target for depression.

INTRODUCTION

Depression is a common mental disorder characterized by persistent or recurrent apathy, world-weariness, anxiety, sleep disturbances, changes in appetite or weight, and impaired concentration,¹⁾ accompanied by restlessness, suicide, and other psychomotor functional disorders,²⁾ which seriously damages the QOL and body function of patients, and increases the economic burden of the family. According to the WHO report in 2017, about 340 million people of all ages in the world are suffering from depression.³⁾ More than 90 million people suffer from depression in China, which becomes the second-largest disease of burden.⁴⁾ Given the great social impact of depression, scientists have conducted a lot of research on the pathogenesis and mechanism and proposed several related theories including the monoaminergic theory,⁵⁾ the neurotrophic factors,⁶⁾ and the inflammatory factors related hypotheses,⁷⁾ epigenetic regulation,⁸⁾ gut-brain axis modulation⁹⁾and other hypotheses till now. However, the specific pathogenesis of depression is still not clear.

Long non-coding RNAs (LncRNAs) are non-coding transcripts with over 200 nucleotides, which are highly expressed in specific brain regions such as the cortex and prefrontal cortex (PFC) of embryos and adult mammals. Recent studies have shown that lncRNAs have not only involved in the regulation of stem cell pluripotency and cancer¹⁰⁾ but also involved in the development of the mammalian nervous system to maintain the homeostasis and function of the brain, including the maintenance of neuronal cell self-renewal, synaptic plasticity, synapse formation,¹¹⁾ and memory formation.^12,13)

The chronic unpredictable mild stress (CUMS) mice model mimics the variable and unpredictable physiological and psychological stressors encountered in human daily life and produces various behavioral changes.¹⁴⁾ These changes are thought to reflect some of the core symptoms of depression (such as weightlessness, anxiety, and hopelessness). It is considered to be an effective rodent model to introduce behavioral and neuronal disturbances evoked by stresses to study the molecular mechanism of depression. As we all know, the PFC and hippocampus (HIP) play important roles in learning, memory, and decision-making.¹⁵⁾ The neuronal projections from the HIP to PFC, referred to as the HIP-PFC circuit, participate in cognitive and emotional disturbances in several psychiatric disorders.¹⁶⁾ Studies on depression revealed that the PFC and HIP display structural and functional abnormalities in both individuals with depression and rodent depressive animals.^17,18) Therefore, much effort is needed to study the candidate causal genes and molecular mechanisms underlying depression in the PFC and HIP regions. As reported, the diagnosis of depression in older people is more difficult than the younger due to its various clinical symptoms and age-related,¹⁹⁾ thus reduction of the prevalence and misdiagnosis of geriatric depression partly relies on the dissection of its specific molecular mechanism. In the previous study, we explored the lncRNAs expression profiles at the whole transcriptome level by RNA-seq in the HIP of CUMS depressed mice at 13 months old representing the late life correlated to humans.²⁰⁾ Interestingly, we found that lncRNA Gm16638-201 encoding transcript RP24-252B21.2 is abnormally highly expressed in the HIP of depressed mice and it might regulate the expression of interleukin-16 (IL-16) and other proteins in cis or trans by bioinformatic prediction.²⁰⁾ As lncRNA Gm16638-201 (ENSMUST00000148687.1) is known to be located on chromosome 7 and consists of 4 exons with 1865 bps, but its function has not been reported currently. Therefore, in the present study, we aimed to find out the specific function of Gm16638-201 and the molecular mechanism underlying depression through over-expression of Gm16638-201 in primary cortical neuronal cultures.

MATERIALS AND METHODS

Animals

The BALB/c male mice (n = 20), 13 months old (weighing 24.8 g on average) representing the late-life of humans according to the mouse lifespan,²¹⁾ purchased from the Animal Experiment Center of Inner Mongolia Medical University (license number SYXK (Mongolia) 2015-0001) were fed with ad libitum food under the standard conditions at 22 ± 1 °C with 12 h light and dark cycles. After 2 weeks, the mice were randomly divided into two groups and used for further experiments. All the protocols used were approved by the Academic Ethics Committee of Inner Mongolia Medical University (the Experimental Ethics No. YKD2016024) by the Guide for Care and Use of Laboratory Animals.

Induction Protocol of CUMS Depressive Mice

Twenty BALB/c male mice were randomly divided into the CUMS (n = 15) and normal control (NOR, n = 5) groups and housed separately. Mice in the CUMS group were subjected to one chronic unpredictable mild stimulation daily, including circadian rhythm reversal, humid environment, deprivation of food and water, noise stimulation, physical restraint, cage tilt, unpredictable shocks, cold water swimming, shaking stress, bedding materials deprivation, tail clipping, and intermittent flash.²²⁾ The detailed stimulation protocol was listed in Table 1. After stimulation under all the stresses, the mice in CUMS group were then received one type of variable stimulation randomly daily and lasted for 8 weeks. Finally, the behavioral tests including tail suspension test (TST), sucrose preference test (SPT), forced swimming test (FST),^20,23,24) marble-burying test,²⁵⁾ were performed as reported and body weights were measured. After the behavior tests, all the animals were decapitated and their brains were quickly removed, frozen on dry ice, and kept in a freezer at −80 °C for further use.

Table 1. CUMS Regimen

Stimulus type	Operation method	Duration
Circadian rhythm reversal	Close the thick curtains during the day to keep the room dark; Keep the light on at night.	24 h
Humid environment	The padding is watered, but there is no ponding.	12 h
Deprivation of food and water	Remove the water bottle or food from the cage.	12 h
Noise stimulation	Intermittent playback	30 min
Physical restraint	The mice were put into the self-made restraint.	4 h
Cage tilt	Cage tilt 45°	12h
Unpredictable shocks	5 mA, one shock/5 s, 10 s duration	5 min
Cold water swimming	Water temperature is 5. The mice were blotted dry with absorbent paper after swimming.	5 min
Shaking stress	Placing the mouse cage onto the shocker shaker with160 rpm.	1 h
Bedding materials deprivation	The rat cage bedding was withdrawn.	12 h
Tail clipping	A long tail clip clamps the mouse tail.	1 min
Intermittent flash	Intermittent glare	2 s

RNA Extraction, Semi-quantitative RT-PCR, and Quantitative RT-PCR (qRT-PCR)

Total RNAs were extracted from the PFC of mice in both groups according to the manufacturer's instructions (TransGen, Beijing, China). First-strand cDNA was synthesized with 1 µg of total RNA using Prime-Script™ II cDNA Synthesis Kit and random primers (TaKaRa, Japan). RT was performed according to the manufacturer’s recommended protocols. Semi-quantitative PCR conditions were used as follows: Thirty cycles of denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s, and extension at 72 °C for 1 min. The primers were used for amplification are listed in Table 2. PCR products were run on 2% agarose gels and visualized by UV illumination.

Table 2. PCR Primers Were Used for Amplification of lncRNA Gm16638-201 and Target Genes

Primer name	Direction	Primer sequences (5′→3′)	PCR product size (bps)
lncRNA Gm16638-201	Forward	ATCCAGCAGACAGCACTATG	298
	Reverse	GTTGCCTCTGTGTTCAGAAG
Elmo2	Forward	GCTGGGCTTCACCAACCATA	258
	Reverse	ATGGGGTGGTAGTCATTGCG
Satb1	Forward	AACCGAACTCAGGGATTGCT	170
	Reverse	GCTGCGTTCAAGCTCCTTTC
Hnrnpul1	Forward	TGGATAAGATGCGGGTGATGG	261
	Reverse	TTCGCTTTACTGTGCGGTCT
Sipa1l3	Forward	ACCCCAGACTCCTCCACAAT	127
	Reverse	AGCCGTTGGTCATCACCTTT
Mapt	Forward	CCAACTGCTGAAGACGTGAC	104
	Reverse	TCGGCTGTAATTCCTTCTGGG
Tada3	Forward	ATTGTGCCGACATCACCAGT	240
	Reverse	GCAGGGCATCCACATCTTTTG
Sgip1	Forward	TTAACTCTGTCTCAGCAGCCC	112
	Reverse	CATTTGGTGCCCCATTGCTT
StarD5	Forward	GAAGAAGTGTCGGGAAGGCA	217
	Reverse	GCTCACACACAGCATATCCG
Gapdh	Forward	AGGTCGGTGTGAACGGATTTG	123
	Reverse	TGTAGACCATGTAGTTGAGGTCA

Quantitative RT-PCR was performed with TB Green^® Premix Ex Taq™ II (Tli RNaseH Plus, TaKaRa, Japan) in a 7500 fast real-time PCR cycler (AB instrument, U.S.A.) according to the manufacturer's instructions. The glyceraldehyde-3-phosphate dehydrogenase (Gapdh) gene was used as an internal standard.

Bioinformatic Analysis

The subcellular localization of Gm16638-201 was predicted by lncLocator (long non-coding RNA subcellular localization predictor, (http://www.csbio.sjtu.edu.cn/bioinf/lncLocator/). We obtained the nucleotide sequence of lncRNA Gm16638-201 (NR_166697.1) from the GenBank (https://www.ncbi.nlm.nih.gov/) and searched the RNALocate database by uploading it. The percentage score for subcellular localization of Gm16638-201 was then calculated and quantified. The target genes regulated by Gm16638-201 in cis or trans were predicted by searching the 10k or 100k upstream and downstream regions of lncRNAs and followed by their function analysis.²⁶⁾ Besides, the expressed Pearson's correlation coefficient between lncRNAs and coding genes with R function “cor.test” was calculated. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses of predicted target genes were performed using the Database for Annotation, Visualization and Integrated Discovery (DAVID) online tool (https://david.ncifcrf.gov/home.jsp). The possible interaction among the predicted target genes was predicted with confidence > 0.4 using the STRING database (https://cn.string-db.org/) and subsequently, the protein–protein interaction (PPI) network was analyzed and visualized using Cytoscape software (https://cytoscape.org/).

Primary Culture of Mouse Cortical Neurons

The newborn mice (p = 0) were sacrificed and the neuronal cortex was removed carefully. After being scissored in a pre-cold Dulbecco’s modified Eagle’s medium (DMEM) medium, the neuronal cortex was digested in 2 mg/mL of papain (Solarbio, Beijing, China) containing deoxyribonuclease (DNase) at a concentration of 0.05 mg/mL (Solarbio, Beijing, China) and incubated at room temperature for 20–30 min. Then 1 mL of horse serum (Sangon, Shanghai, China) was added to terminate the digestion. The dissociated cells were plated to a 6-well plate precoated with 10% poly-D-lysine (Sangon, Shanghai, China) and then incubated at 37 °C with 5% CO₂ for 4 h. After culturing for 4–8 h, the medium was replaced with a freshly made Neurobasal™-A (with 2% synthetic B-27 serum-free additive, 0.5 mmol/L L-glutamine, Thermo Fisher Scientific, U.S.A.) at 37 °C with 5% CO₂.

Immunocytochemical Staining

The primary cultured neuronal cortical cells were fixed in 4% paraformaldehyde solution for 20 min and permeabilized with 0.5% TritonX100 for 20 min. Then the cells were incubated with the primary antibody (NF-L, 1 : 50, Proteintech, Wuhan, China) for 1 h at 37 °C. After rinsing with phosphate buffered saline (PBS), the secondary antibody (CY3 goat anti-rabbit, immunoglobulin G (IgG) 1 : 50, TransGen, Beijing, China) was applied for 30 min. Finally, the stained cells were mounted with Fluoroshield™ with 4′-6-diamidino-2-phenylindole (DAPI) mounting medium (Sigma, U.S.A.) and observed under an inverted fluorescence microscope (OLYMPUS IX73, Japan).

Adenoviral Expression Vector Construction and Infection

The adenoviral recombinant vector of mouse Gm16638-201 transcript was constructed and adenoviral particles were produced by Genechem, Shanghai, China. Briefly, the full-length of mouse Gm16638-201 transcript (NR_166697) was constructed into the AgeI and NheI cloning site of adenoviral vector GV315 which contains enhanced green fluorescent protein (EGFP) tag (Genechem, Shanghai, China) and subsequently sequenced. Then the sequence-verified recombinant vector and packaging vector pBHG lox ΔE1, 3 Cre (Microbix. Canada) were co-transfected into HEK293 cells. After 10–15 d of co-transfection, the adenoviral particles were amplified and purified by Adeno-X™ Virus Purification Kit (BD Biosciences, Clontech) for further infection. At day in vitro (DIV) 2, the adenoviral particles (multiplicity of infection, MOI = 100) were added to infect the primary mouse neuronal cortical cells (Primary-N) at 37 °C, 5% CO₂ for 12 h and removed after 4 d. The infection efficiency was observed under an inverted fluorescent microscope (Olympus IX73, Japan). The Primary-N cells infected with the adenoviral particles with Gm16638-201 overexpression were referred to as Gm16638-201-Exp. The Primary-N cells infected with the adenoviral particles with the GV315 vector-only were used as negative control (NC).

Enzyme-Linked Immunosorbent Assay (ELISA)

IL-16 levels of the PFC of mice were measured using a standard quantitative sandwich ELISA (MEIMIAN, China). All analyses and calibrations were performed in duplicate. Optical densities (OD) were determined using an absorbance microplate reader (Elx808™ Bio-Tek Instruments, Winooski, VT, U.S.A.) at 450 nm. Gen5 Data Analysis software (Bio-Tek Instruments) was used to analyze all data and depict the standard curve.

Western Blot

The PFC of the mice and primary neuronal cells were harvested and total proteins were isolated. Briefly, the tissues and cells were lysed for 30 min with radio immunoprecipitation assay (RIPA) lysis buffer and centrifuged at 12000 rpm at 4 °C for 5 min. The samples were resolved by 10% sodium dodecylsulfate-polyacrylamide gel electrophoresis (SDS-PAGE), transferred to nitrocellulose membranes, and blotted using primary antibodies (14-3-3Ɛ, 1 : 1000, MAPT, 1 : 1000, BAD, 1 : 1000, Proteintech, Wuhan, China). Anti-GAPDH (1 : 10000) and β-Tubulin (1 : 1000) was used as an internal control. The membranes were washed with Tris Buffered Saline with 0.1% Tween^® 20 (TBST) three times and then incubated with the IRDye 800CW goat anti-rabbit secondary antibody (1 : 10000, LICOR, U.S.A.). After stripping, the same membrane was used for the detection of other proteins. The densities of bands were measured using the image analysis software (Image studio ver3.1) of Odyssey CLX, and changes in protein levels were presented as folds of those in the control group.

Statistical Analysis

Data were presented as means  ±  standard error of the mean (S.E.M.) and analyzed using GraphPad Prism 9 software (https://www.graphpad-prism.cn/). The unpaired Student’s t-test was used. The gene expression data were compared by the one-way ANOVA followed by a post-hoc test among three groups. The qRT-PCR results were analyzed by the 2^−△△CT quantitative method to determine differences in gene expression. Statistical differences were considered significant at p < 0.05.

RESULTS

The Mice in CUMS Group Exhibited the Depressive Behaviors

To verify the CUMS effectiveness, behavioral tests and body weight measurement were performed on both groups of mice (CUMS and NOR) after the eight weeks’ stimulation. As shown in Fig. 1A, compared with the NOR group, the mice in the CUMS model group showed significant body weight loss (p = 0.0121 < 0.05). The sucrose preference test found that the sucrose intake in the CUMS group was significantly lower than that in the normal group (p < 0.0001, Fig. 1B), indicating that the CUMS-induced mice developed depression-like symptoms. The anxiety behaviors were assessed by TST and FST. Compared with the NOR, the struggling time in the CUMS group was significantly reduced (Fig. 1C, p < 0.0001), and immobility time in the CUMS group was longer (Fig. 1D, p = 0.0027 < 0.01). These results indicated that the mice manifested anxiety and despair after exposure to CUMS. In the marble burying test, as shown in Fig. 1E, the mice in the CUMS group showed lower attention to unfamiliar glass marbles, and the number of marbles buried with bedding was significantly less than that of the mice in the NOR group (p = 0.0488 < 0.05), indicating that the mice showed anxiety-like behavior.

Fig. 1. The Behavior Tests of Mice Exposed to CUMS and Expression of Gm16638-201 in the PFC of Mice

A. Compared with normal mice, the body weight of mice after CUMS stimulation was significantly reduced. B. The preference for glucose in mice induced by CUMS stimulation was significantly lower than that in the normal group; C, D. The period of immobility was significantly increased in TST (C) and FST (D). E. The number of bead-embedded mice after CUMS stimulation was significantly less than that of mice in the normal group. F. Expression of Gm16638-201 in the PFC of mice was significantly increased compared with normal mice (n = 3, p = 0.0071 < 0.01). NOR: the normal mice group, and CUMS: CUMS induced depressive mice group. * means p < 0.05, ** means p < 0.01, **** means p < 0.0001.

Increased Expression of Gm16638-201 in the PFC of CUMS Depressive Mice

Our previous study found that Gm16638-201 was highly expressed in the HIP of CUMS mice,²⁰⁾ and the PFC has emerged as one of the regions most consistently impaired in major depressive disorder (MDD).²⁷⁾ Here we examined the expression of Gm16638-201 in the PFC of CUMS model mice by qPCR. As we expected, the results showed that the expression level of Gm16638-201 was also significantly increased in CUMS mice compared to NOR mice (Fig. 1F, p = 0.0071 < 0.01, Supplementary Fig. A), consistent with that in the HIP of CUMS.

Bioinformatic Analysis of the Subcellular Localization of Gm16638-201 and Functional Annotation of the Predicted Genes Regulated by Gm16638-201 in cis or trans

Although lncRNA does not encode a protein, most of these are the same as mRNA being transcribed, capped, and polyadenylated by RNA polymerase II,²⁸⁾ which indicates that lncRNA is similar to mRNA and will play different functions due to different subcellular localization. On the one hand, lncRNA in the nucleus can regulate the transcriptional program through interaction and remodeling with chromatin,^29,30) on the other hand, it is also involved in the maintenance of nuclear chamber spatial structure.³¹⁾ While lncRNA in cytoplasm not only can compete with endogenous RNA (ceRNA) and miRNA to regulate the translation and stability of mRNA^32,33) but also be involved in mediating signal transduction pathway³⁴⁾ and protein post-translational modification.³⁵⁾ Therefore, bioinformatics predicted the subcellular localization of Gm16638-201 manifested that it is mainly located in the cytoplasm, with a small amount located in the nucleus, ribosome, cytoplasm, and exosomes (Fig. 2A). The result suggests that Gm16638-201 which is abnormally highly expressed in PFC, may play an important biological role in the cytoplasm of neuronal cells.

Fig. 2. Bioinformatic Analysis of Subcellular Localization of Gm16638-201 and Functional Annotation of the Predicted Regulatory Genes

A. The subcellular localization of Gm16638-201 was predicted and analyzed by lncLocator. B. GO enrichment analysis of Gm16638-201 and predicted regulatory genes. The X-axis is the enrichment index, the Y-axis represents the GO classification, dot size represents the number of genes involved. C. PPI network of possible interactions for target genes. Nine genes including Elmo2, Satb1, Hnrnpul1, Sipa1l3, Mapt, Tada3, Sgip1, StarD5 and IL-16 were used for searching the possible interactions in the String database. PPI with confidence >0.4 was selected for further analysis and visualized by Cytoscape. Nodes represent the interacting proteins. Node size represents the PPI degree, and line thickness represents the strength of the data support.

In our previous study, 19 proteins were predicted to be co-localized or co-expressed (in cis or trans acting) with Gm16638-201²⁰⁾ (Table 3). Based on the review of the literature published and bioinformatics analysis, 9 genes (Elmo2, Satb1, Hnrnpul1, Sipa1l3, Mapt, Tada3, Sgip1, StarD5 and IL-16) among them were pointed out to be related to neurobiological processes or pathways and related diseases and selected to further study. GO analyses predicted that these genes are located in the nuclear periphery and intracellular part (Cellular Component, CC) and might participate in the process of response to external stimulus and DNA transcription and regulation (Biological Process, BP), and function in the SH3 domain binding and protein domain specific binding (Molecular Function, MF) (Fig. 2B). KEGG analysis revealed these target genes were in association with 14-3-3Ɛ-mediated neurotrophic signaling pathways (data not shown). Next, we searched the possible interactions among these nine genes in the STRING database and constructed a PPI network, and visualized it by Cytoscape (confidence > 0.4, Fig. 2C). Some of the interactions showed strong PPI evidence, such as Mapt and 14-3-3Ɛ, Mapt and Sgip1. Moreover, PPI network prediction revealed that 14-3-3Ɛ (encodes the tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon polypeptide/ the 14-3-3 epsilon protein, 14-3-3Ɛ) can interact with the nine target genes regulated by Gm16638-201 and play a central role in the interaction network. Several studies showed that 14-3-3Ɛ can interact with Microtubule-associated protein tau (MAPT) and BAD, and play an important role in neurobiological processes and pathways.^36,37) Overall, these results indicated that Gm16638-201 might regulate target proteins, such as MAPT, and affect the 14-3-3Ɛ neurotrophic pathway in depression.

Table 3. A List of Predicted Genes Regulated by lncRNA Gm16638-201 in cis and trans

Ensembl transcript ID	Gene symbol	Gene description	In cis or trans-acting	Pearson-correlation	p-Value
ENSMUST00000075249	Plekhg3	Pleckstrin homology domain containing, family G (with RhoGef domain) member 3	In trans	0.97638511	5.56E-08
ENSMUST00000163147	Epb41l5	Erythrocyte membrane protein band 4.1 like 5	In trans	0.964954921	3.93E-07
ENSMUST00000225991	Fam149b	Family with sequence similarity 149, member B	In trans	0.977382285	4.49E-08
ENSMUST00000138016	Mgat4c	MGAT4 family, member C	In trans	0.977947447	3.96E-08
ENSMUST00000095585	Adgrv1	Adhesion G protein-coupled receptor V1	In trans	0.958358076	9.19E-07
ENSMUST00000064376	Arhgap4	Rho GTPase activating protein 4	In trans	0.986833555	3.05E-09
ENSMUST00000063869	Cd1d1	CD1d1 antigen	In trans	0.965107126	3.84E-07
ENSMUST00000138315	Acsbg1	Acyl-CoA synthetase bubblegum family member 1	In trans	0.970712439	1.62E-07
ENSMUST00000164012	Crhr2	Corticotropin releasing hormone receptor 2	In trans	0.955207694	1.32E-06
ENSMUST00000071699	Elmo2	Engulfment and cell motility 2	In trans	0.990420307	6.25E-10
ENSMUST00000144331	Satb1	Special AT-rich sequence binding protein 1	In trans	0.992934348	1.37E-10
ENSMUST00000043765	Hnrnpul1	Heterogeneous nuclear ribonucleoprotein U-like 1	In trans	0.960188721	7.37E-07
ENSMUST00000182780	Sipa1l3	Signal-induced proliferation-associated 1-like protein 3	In trans	0.979684218	2.63E-08
ENSMUST00000145227	Mapt	Microtubule-associated protein tau	In trans	0.970206954	1.76E-07
ENSMUST00000099118	Tada3	Transcriptional adapter 3	In trans	0.952695079	1.72E-06
ENSMUST00000072481	Sgip1	SH3-domain GRB2-like (endophilin) interacting protein 1	In trans	0.953008545	1.67E-06
ENSMUST00000075418	StarD5	StAR-related lipid transfer (START) domain containing 5	In cis	—	—
ENSMUST00000001792	IL-16	Interleukin 16	In cis	—	—
ENSMUST00000039317	Tmc3	Transmembrane channel-like gene family 3	In cis	—	—

Over-Expression of Gm16638-201 in the Primary Cultures of Murine Cortical Neurons

To further understand the role of the high expression of Gm16638-201 in the PFC of CUMS depressive mice, we cultured the murine primary neuronal cortical cells (Fig. 3A). Immunocytochemical staining showed the neuronal-specific gene neurofilament-L (NF-L)³⁸⁾ was expressed in over 90% of cultured cells and glial fibrillary acidic protein (GFAP)-positive cells were rarely observed due to limited cultured cells (Fig. 3B, Supplementary Fig. B). Therefore, this result indicated that primary neuronal cultures of the murine cortex were successfully obtained. The primary neuronal cells were then infected with the adenovirus carrying Gm16638-201 recombinant plasmid (Fig. 4C). Subsequently, the expression level of Gm16638-201 was examined by RT-PCR and it was significantly increased (Fig. 3C, F_{(2, 6)} = 1204, p < 0.0001).

Fig. 3. Primary Cortical Neuron Cells Overexpressing Gm16638-201

A. Primary culture of the murine cortical neuron cells, scale bar is 100 µM. B. Immunocytochemical staining of NF-L in the primary cortical neurons. Scale bar: 10 µM. C. Overexpression of Gm16638-201 by adenovirus infection of the primary prefrontal cortical neurons. Scale bar: 100 µM. BF, bright field; EGFP, enhanced GFP protein tag. D. Gm16638-201 was successfully overexpressed in the primary cells of prefrontal cortical neurons compared with the negative control group (F_{(2, 6)} = 1204, p < 0.0001). ### means p < 0.001, **** means p < 0.0001. Primary-N, the primary cultured prefrontal cortex neuron cells, NC, the negative control group without Gm16638-201 expression, and Gm16638-201-Exp, Gm16638-201 over-expressed Primary-N cells.

Fig. 4. The Expression of Gm16638-201 and Predicted Target Genes in Murine PFC and Primary Neuronal Cells

A. Gm16638-201 and predicted target genes were all expressed in mouse PFC. B. Elmo2, Satb1, Hnrnpul1, Sipa1l3, Mapt, Tada3, and StarD5 except Sgip1 were all expressed and downregulated after overexpression of Gm16638-201 in Prime-N cells (F_(2,6) = 78.89, F_(2,6) = 78.89, F_(2,6) = 56.15, F_(2,6) = 84.06, F_(2,6) = 65.35, F_(2,6) = 159.9, F_(2,6) = 72.27, p < 0.01). C and D. IL-16 expression was increased in CUMS group and Prime-N cells overexpressed by Gm16638-201, relative to NOR and Prime-N control cells, respectively (p < 0.01). # means p < 0.05, ## means p < 0.01, ### means p < 0.001, #### means p < 0.0001, ** p < 0.01, *** p < 0.001, **** p < 0.0001.

Differential Expression of Target Genes Regulated by Gm16638-201

Nine genes (Elmo2, Satb1, Hnrnpul1, Sipa1l3, Mapt, Tada3, Sgip1, StarD5, IL-16) were predicted to be regulated by Gm16638-201 in cis or trans and implicated in neuronal development. Firstly, we examined the expression of 9 target genes and found that these 9 genes were all expressed in mouse PFC (Fig. 4A). Due to the tissue amount limitation, we secondly determined the expressions of these genes in primary neuronal cells with overexpression of Gm16638-201(Gm16638-201-Exp) which mimics its high expression in the PFC of CUMS by semi-quantitative RT-PCR. The results showed that the expression levels of Elmo2, Satb1, Hnrnpul1, Sipa1l3, Mapt, Tada3, and StarD5 except for Sgip1 were all down-regulated in the Gm16638-201-Exp cells compared with Primary-N and NC groups (Fig. 4B, F_(2,6) = 78.89, F_(2,6) = 78.89, F_(2,6) = 56.15, F_(2,6) = 84.06, F_(2,6) = 65.35, F_(2,6) = 159.9, F_(2,6) = 72.27, p < 0.01). Cytokines including interleukins (IL), lymphokines, interferons (IFN), chemokines, or tumor necrosis factors (TNF) have modulatory effects on various psychiatric disorders including schizophrenia, depression, and Alzheimer’s disease.³⁹⁾ In our previous study, IL-16 was predicted to be regulated by Gm16638-201 in cis in CUMS mice. In addition, markedly elevated levels of IL-16 expression were observed in mental illnesses such as MDD, bipolar disorder (BP), and schizophrenia.^40,41) Therefore, we investigated the IL-16 expression levels in the PFC of CUMS depressed mice and the Gm16638-201 over-expressed primary neuronal cells by ELISA. As a result, IL-16 expression was elevated in both tissue and cells (Figs. 4C, D, p = 0.0095 < 0.01; F_(2,6) = 68.09, p < 0.01).

The Gm16638-201 Induces Mouse Depression by Inhibiting 14-3-3Ɛ-Mediated Signaling in the PFC

To further clarify the mechanism of Gm16638-201 in depression, we examined the expression of 14-3-3Ɛ and MAPT in the Gm16638-201 over-expressed primary neuronal cells by the immunocytochemical staining. We found that 14-3-3Ɛ was expressed in both the nucleus and cytoplasm of primary neuronal cells (Supplementary Fig. C). Interestingly, when Gm16638-201 was overexpressed, the expression of 14-3-3Ɛ in the cytoplasm was dramatically decreased (Supplementary Fig. C), while not in the nucleus. This result indicated that Gm16638-201 could inhibit 14-3-3Ɛ expression in the cytoplasm of the neuronal cells, and demonstrated that Gm16638-201 mainly functions in the cytoplasm of neurons. We also detected the expression of 14-3-3Ɛ and MAPT in the PFC of CUMS mice. As shown in Fig. 5A, the expression of Mapt (also known as Tau) was down-regulated in the PFC of CUMS mice compared to NOR mice (p = 0.0023 < 0.05), and the expression of 14-3-3Ɛ was not statistically changed (p = 0.9881 < 0.05) at the transcript level. Furthermore, we examined the 14-3-3Ɛ and MAPT expressions at the translation level and found that they were all down-regulated in the PFC of CUMS mice (Fig. 5B, p = 0.0112 < 0.05; p = 0.0345 < 0.05). Consistently, their expression was also decreased in the primary cortical neurons with overexpression of Gm16638-201 (Fig. 5C, F_(2,6) = 57.08, F_(2,6) = 14.96, p < 0.01). In addition, we also checked the expression of BAD, a proapoptotic factor in the PFC of CUMS mice by Western blot since BAD could bind to 14-3-3Ɛ in the ventrolateral orbital cortex (VLO).³⁶⁾ As a result, we found that BAD was also down-regulated in both the PFC of CUMS mice (Fig. 5B, p = 0.0218 < 0.05) and the primary cortical neurons with overexpression of Gm16638-201 (Fig. 5C, F_(2,6) = 63.25, p < 0.0001). These results indicated that the elevated expression of Gm16638-201 inhibited the activity of the 14-3-3Ɛ signaling pathway in the PFC and affected depression.

Fig. 5. The Expressions of 14-3-3Ɛ, MAPT, and BAD Were Decreased in the PFC of CUMS Mice and Prime-N Cells Overexpressed by Gm16638-201

A. The expression of Mapt was down-regulated in the PFC of CUMS mice compared to the NOR group (p = 0.0023 < 0.05). The expression of 14-3-3Ɛ was not statistically changed in the PFC of CUMS mice compared to the NOR group (p = 0.9881 > 0.05). B. Western blot showed that the expressions of 14-3-3Ɛ, MAPT, and BAD were decreased in the PFC of CUMS depressed mice (n = 3, p = 0.0112 < 0.05; p = 0.0345 < 0.05; p = 0.0218 < 0.05). C. The expression of 14-3-3Ɛ, MAPT, and BAD is reduced in primary cortical neuronal cells after overexpression of Gm16638-201 by Western blot analysis (F_(2,6) = 57.08, F_(2,6) = 14.96, F_(2,6) = 63.25, p < 0.01). ## means p < 0.01, ### means p < 0.001, #### means p < 0.0001, * p < 0.05, ** p < 0.01, *** p < 0.001.

DISCUSSION

In this study, we used CUSM depressed mice and primary neuronal cells to investigate the molecular mechanism by which Gm16638-201 regulates PFC target genes and affects the occurrence of depression. Due to the dysfunction of the PFC in depression, qRT-PCR results showed that the Gm16638-201 was expressed highly in the PFC compared with normal mice. We also cultured the primary prefrontal cortical neuronal cells in vitro and over-expressed Gm16638-201 using an adenovirus-mediated expression system to study its function. At present, there is no relevant functional annotation for this lncRNA, and this study will provide experimental evidence for the functional annotation of Gm16638-201 in depression.

Bioinformatic analysis identified 19 possible genes regulated by Gm16638-201, and among them, nine genes were reported to be related to neurological processes or diseases. Therefore, we investigated these genes’ expression in the primary cultured neurons in that Gm16638-201 was over-expressed. Interestingly, the expression levels of these genes (Elmo2, Satb1, Hnrnpul1, Sipa1l3, Mapt, Tada3, and StarD5), except Sgip1, were found down-regulated while Gm16638-201 was highly expressed.

The down-regulated genes involve phagocytosis and cell motility protein 2 (Engulfment and cell motility protein 2, Elmo2) which can regulate the stability of microtubule dynamics by interacting with the RHO-related GTP-binding protein RhoG and the integrin-linked protein kinase ILK.⁴²⁾ This result suggests that Gm16638-201 may affect the stability of microtubules by reducing the expression of Elmo2, and then leading to the occurrence of depression. Another down-regulated gene is Stab1. Stabilin-1 (Stab1) can be regulated by lncRNA nuclear-enriched transcript 1 (NEAT1) and its high expression can promote Schwann cells proliferation and migration in the peripheral nervous system, enabling axonal growth and functional recovery after peripheral nerve injury.⁴³⁾ The expression of heterogeneous nuclear ribonucleoprotein U-like protein 1 (Hnrnpul1) was found reduced in Alzheimer’s disease,⁴⁴⁾ but its specific function has not been reported yet. Signal-induced proliferation-associated 1-like protein 3 (Sipa1l3) is one of the most abundant Rap GTPase-activating proteins (Gap GAPs) in the brain, which tightly regulates Rap signaling in postsynaptic neurons, and its C-terminus is required for postsynaptic localization.⁴⁵⁾ This study found that the expression of Sipa1l3 was inhibited when the Gm16638-201 was overexpressed in the PFC, suggesting that the Gm16638-201 may affect the signaling of postsynaptic neurons by inhibiting the expression of Sipa1l3. Transcriptional adapter 3 (Tada3) is a component of the Spt-ada-Gcn5 acetyltransferase (SAGA) complex that links the nuclear transcription of histone acetylation, which regulates the transcription of nearly all genes in human cells.⁴⁶⁾ The report from Galvan et al. has shown that Tada3 interacts with doublecortin-like kinase 3 (DCLK3) in striatal neurons and plays an important role in transcriptional regulation and/or chromatin remodeling.⁴⁷⁾ In our study, the expression of Tada3 decreased when Gm16638-201 was overexpressed, suggesting that Gm16638-201 might play an important role in gene transcription and chromatin remodeling. Taken together, our findings suggested that increased expression of Gm16638-201 in the PFC may affect neuronal cell microtubule stability, neuronal cell growth, synaptic signaling, and gene transcription and chromatin remodeling. However, further research is needed to be done to clarify the specific mechanism of lncRNA modulation in depression.

GO and KEGG pathway analysis of the 7 differentially expressed genes revealed that they were related to the 14-3-3Ɛ-mediated neurotrophin signaling pathway. 14-3-3Ɛ is a highly conserved, multifunctional protein that is most abundantly expressed in the brain, regulating cell cycle, apoptosis and autophagy by binding to various signaling proteins such as kinases and transcription factors. For example, it can interact with BAD to rescue the BAD-mediated apoptosis to prevent depression caused by chronic stress.^36,48–50) In addition, 14-3-3Ɛ binds to MAPT specifically and non-specifically to regulate the aggregation of MAPT.³⁷⁾ MAPT not only promotes the assembly and stability of microtubules but also participates in the establishment and maintenance of neuronal polarity in the central nervous system.⁵¹⁾ In addition, chronic stress can make pro-inflammatory cytokines such as TNF-α and IL-1β, IL-6, IL-16, etc. release, leading to the occurrence of depression.^7,52) Our previous study predicted that the transcript RP24-252B21.2 of Gm16638-201 could cis-regulate IL-16 and trans-regulate Mapt expression. Therefore, we examined the expression changes of IL16, MAPT, 14-3-3Ɛ, and BAD proteins and found that compared with normal mice and Prime-N cells, the expression of IL16 was increased whereas MAPT 14-3-3Ɛ and BAD proteins expression was decreased in both CUMS depressed mice and the Prime-N cells overexpressed with Gm16638-201. Our findings suggested that the up-regulated Gm16638-201could lead to the release of IL-16 and promote an inflammatory response.

CONCLUSION

In summary, our study has found that Gm16638-201 was up-regulated in the PFC of CUMS mice and its overexpression could inhibit 14-3-3Ɛ signal pathway activity by regulating the expression of Elmo2, Satb1, Hnrnpul1, Sipa1l3, Mapt, Tada3, StarD5 and IL-16 genes in the PFC and induced depression. The specific function of Gm16638-201 and its molecular mechanism underlying depression need to be explored in future studies.

Acknowledgments

We thank all the technicians of the Key Laboratory of Molecular Pathology, Inner Mongolia Medical University, China for their detailed guidance on the experiment conduction process.

This work was supported by Scientific Research Projects of Universities in Inner Mongolia Autonomous Region (NJZY111) and Natural Scientific Research Projects of Inner Mongolia Autonomous Region (2020MS03060).

Conflict of Interest

The authors declare no conflict of interest.

Supplementary Materials

This article contains supplementary materials.

REFERENCES

• 1) Zhang L, Verwer RWH, Lucassen PJ, Huitinga I, Swaab DF. Prefrontal cortex alterations in glia gene expression in schizophrenia with and without suicide. J. Psychiatr. Res., 121, 31–38 (2020).
• 2) Whiteford HA, Degenhardt L, Rehm J, Baxter AJ, Ferrari AJ, Erskine HE, Charlson FJ, Norman RE, Flaxman AD, Johns N, Burstein R, Murray CJ, Vos T. Global burden of disease attributable to mental and substance use disorders: findings from the Global Burden of Disease Study 2010. Lancet, 382, 1575–1586 (2013).
• 3) Organization WH. “Depression.“: ‹https://apps.who.int/iris/handle/10665/333464.›.
• 4) Yang G, Wang Y, Zeng Y, Gao GF, Liang X, Zhou M, Wan X, Yu S, Jiang Y, Naghavi M, Vos T, Wang H, Lopez AD, Murray CJ. Rapid health transition in China, 1990-2010: findings from the Global Burden of Disease Study 2010. Lancet, 381, 1987–2015 (2013).
• 5) Berlucchi G, Buchtel HA. Neuronal plasticity: historical roots and evolution of meaning. Exp. Brain Res., 192, 307–319 (2009).
• 6) Groves JO. Is it time to reassess the BDNF hypothesis of depression? Mol. Psychiatry, 12, 1079–1088 (2007).
• 7) Hurley LL, Tizabi Y. Neuroinflammation, neurodegeneration, and depression. Neurotox. Res., 23, 131–144 (2013).
• 8) Liu N, Wang ZZ, Zhao M, Zhang Y, Chen NH. Role of non-coding RNA in the pathogenesis of depression. Gene, 735, 144276 (2020).
• 9) Macedo D, Filho A, Soares de Sousa CN, Quevedo J, Barichello T, Junior HVN, Freitas de Lucena D. Antidepressants, antimicrobials or both? Gut microbiota dysbiosis in depression and possible implications of the antimicrobial effects of antidepressant drugs for antidepressant effectiveness. J. Affect. Disord., 208, 22–32 (2017).
• 10) Mercer TR, Dinger ME, Mattick JS. Long non-coding RNAs: insights into functions. Nat. Rev. Genet., 10, 155–159 (2009).
• 11) Antoniou D, Stergiopoulos A, Politis PK. Recent advances in the involvement of long non-coding RNAs in neural stem cell biology and brain pathophysiology. Front. Physiol., 5, 155 (2014).
• 12) Hosseini E, Bagheri-Hosseinabadi Z, De Toma I, Jafarisani M, Sadeghi I. The importance of long non-coding RNAs in neuropsychiatric disorders. Mol. Aspects Med., 70, 127–140 (2019).
• 13) Ninou E, Michail A, Politis PK. Long non-coding RNA lacuna regulates neuronal differentiation of neural stem cells during brain development. Front. Cell Dev. Biol., 9, 726857 (2021).
• 14) Willner P. Validity, reliability and utility of the chronic mild stress model of depression: a 10-year review and evaluation. Psychopharmacology, 134, 319–329 (1997).
• 15) Miyanishi H, Nitta A. A role of BDNF in the depression pathogenesis and a potential target as antidepressant: the modulator of stress sensitivity “Shati/Nat8l-BDNF System” in the dorsal striatum. Pharmaceuticals (Basel), 14, 889 (2021).
• 16) Godsil BP, Kiss JP, Spedding M, Jay TM. The hippocampal-prefrontal pathway: the weak link in psychiatric disorders? Eur. Neuropsychopharmacol., 23, 1165–1181 (2013).
• 17) Fournier NM, Duman RS. Role of vascular endothelial growth factor in adult hippocampal neurogenesis: implications for the pathophysiology and treatment of depression. Behav. Brain Res., 227, 440–449 (2012).
• 18) Hiser J, Koenigs M. The multifaceted role of the ventromedial prefrontal cortex in emotion, decision making, social cognition, and psychopathology. Biol. Psychiatry, 83, 638–647 (2018).
• 19) Fiske A, Wetherell JL, Gatz M. Depression in older adults. Annu. Rev. Clin. Psychol., 5, 363–389 (2009).
• 20) Zhang CL, Li YJ, Lu S, Zhang T, Xiao R, Luo HR. Fluoxetine ameliorates depressive symptoms by regulating lncRNA expression in the mouse hippocampus. Zool. Res., 42, 28–42 (2021).
• 21) Flurkey KM, Currer J, Harrison DE. Chapter 20 - Mouse models in aging research. The mouse in biomedical research (second edition). (Fox JG, Davisson MT, Quimby FW, Barthold SW, Newcomer CE, Smith AL eds.) Academic Press, Burlington, pp. 637–672 (2007).
• 22) Willner P, Muscat R, Papp M. Chronic mild stress-induced anhedonia: a realistic animal model of depression. Neurosci. Biobehav. Rev., 16, 525–534 (1992).
• 23) Porsolt RD, Bertin A, Jalfre M. Behavioral despair in mice: a primary screening test for antidepressants. Arch. Int. Pharmacodyn. Ther., 229, 327–336 (1977).
• 24) Lucki I. The forced swimming test as a model for core and component behavioral effects of antidepressant drugs. Behav. Pharmacol., 8, 523–532 (1997).
• 25) Pietropaolo S. Mood and anxiety-related phenotypes in mice: characterization using behavioral tests. Genes Brain Behavior, Vol. 9, Humana Press, New York, p. 544 (2010).
• 26) Guil S, Esteller M. Cis-acting noncoding RNAs: friends and foes. Nat. Struct. Mol. Biol., 19, 1068–1075 (2012).
• 27) Pizzagalli DA, Roberts AC. Correction: prefrontal cortex and depression. Neuropsychopharmacology, 47, 609 (2022).
• 28) Derrien T, Johnson R, Bussotti G, et al. The GENCODE v7 catalog of human long noncoding RNAs: Analysis of their gene structure, evolution, and expression. Genome Res., 22, 1775–1789 (2012).
• 29) Melé M, Mattioli K, Mallard W, Shechner DM, Gerhardinger C, Rinn JL. Chromatin environment, transcriptional regulation, and splicing distinguish lincRNAs and mRNAs. Genome Res., 27, 27–37 (2017).
• 30) Kutter C, Watt S, Stefflova K, Wilson MD, Goncalves A, Ponting CP, Odom DT, Marques AC. Rapid turnover of long noncoding RNAs and the evolution of gene expression. PLOS Genet., 8, e1002841 (2012).
• 31) Clemson CM, McNeil JA, Willard HF, Lawrence JB. XIST RNA paints the inactive X chromosome at interphase: evidence for a novel RNA involved in nuclear/chromosome structure. J. Cell Biol., 132, 259–275 (1996).
• 32) Yuan JH, Liu XN, Wang TT, Pan W, Tao QF, Zhou WP, Wang F, Sun SH. The MBNL3 splicing factor promotes hepatocellular carcinoma by increasing PXN expression through the alternative splicing of lncRNA-PXN-AS1. Nat. Cell Biol., 19, 820–832 (2017).
• 33) Grelet S, Link LA, Howley B, Obellianne C, Palanisamy V, Gangaraju VK, Diehl JA, Howe PH. A regulated PNUTS mRNA to lncRNA splice switch mediates EMT and tumour progression. Nat. Cell Biol., 19, 1105–1115 (2017).
• 34) Aznaourova M, Janga H, Sefried S, Kaufmann A, Dorna J, Volkers SM, Georg P, Lechner M, Hoppe J, Dokel S, Schmerer N, Gruber AD, Linne U, Bauer S, Sander LE, Schmeck B, Schulte LN. Noncoding RNA MaIL1 is an integral component of the TLR4-TRIF pathway. Proc. Natl. Acad. Sci. U.S.A., 117, 9042–9053 (2020).
• 35) Lin A, Li C, Xing Z, et al. The LINK-A lncRNA activates normoxic HIF1alpha signalling in triple-negative breast cancer. Nat. Cell Biol., 18, 213–224 (2016).
• 36) Zhao Y, Coulson EJ, Su X, Zhang J, Sha B, Xu H, Deng Y, Chen Y, Cao J, Wang Y, Wang S. Identification of 14-3-3 epsilon as a regulator of the neural apoptotic pathway for chronic-stress-induced depression. iScience, 24, 102043 (2021).
• 37) Chen Y, Chen X, Yao Z, Shi Y, Xiong J, Zhou J, Su Z, Huang Y. 14-3-3/Tau interaction and tau amyloidogenesis. J. Mol. Neurosci., 68, 620–630 (2019).
• 38) Bhan A, Jacobsen C, Myhr KM, Dalen I, Lode K, Farbu E. Neurofilaments and 10-year follow-up in multiple sclerosis. Mult. Scler., 24, 1301–1307 (2018).
• 39) Lu Y, Ho CS, Liu X, Chua AN, Wang W, McIntyre RS, Ho RC. Chronic administration of fluoxetine and pro-inflammatory cytokine change in a rat model of depression. PLOS ONE, 12, e0186700 (2017).
• 40) Raedler TJ. Inflammatory mechanisms in major depressive disorder. Curr. Opin. Psychiatry, 24, 519–525 (2011).
• 41) Shinko Y, Otsuka I, Okazaki S, Horai T, Boku S, Takahashi M, Ueno Y, Sora I, Hishimoto A. Chemokine alterations in the postmortem brains of suicide completers. J. Psychiatr. Res., 120, 29–33 (2020).
• 42) Jackson BC, Ivanova IA, Dagnino L. An ELMO2-RhoG-ILK network modulates microtubule dynamics. Mol. Biol. Cell, 26, 2712–2725 (2015).
• 43) Liu X, Yu X, He Y, Wang L. Long noncoding RNA nuclear enriched abundant transcript 1 promotes the proliferation and migration of Schwann cells by regulating the miR-34a/Satb1 axis. J. Cell. Physiol., 234, 16357–16366 (2019).
• 44) Soleimani Zakeri NS, Pashazadeh S, MotieGhader H. Gene biomarker discovery at different stages of Alzheimer using gene co-expression network approach. Sci. Rep., 10, 12210 (2020).
• 45) Dolnik A, Kanwal N, Mackert S, Halbedl S, Proepper C, Bockmann J, Schoen M, Boeckers TM, Kuhl SJ, Schmeisser MJ. Sipa1l3/SPAR3 is targeted to postsynaptic specializations and interacts with the Fezzin ProSAPiP1/Lzts3. J. Neurochem., 136, 28–35 (2016).
• 46) Bonnet J, Wang CY, Baptista T, Vincent SD, Hsiao WC, Stierle M, Kao CF, Tora L, Devys D. The SAGA coactivator complex acts on the whole transcribed genome and is required for RNA polymerase II transcription. Genes Dev., 28, 1999–2012 (2014).
• 47) Galvan L, Francelle L, Gaillard MC, et al. The striatal kinase DCLK3 produces neuroprotection against mutant huntingtin. Brain, 141, 1434–1454 (2018).
• 48) Fountoulakis M, Cairns N, Lubec G. Increased levels of 14-3-3 gamma and epsilon proteins in brain of patients with Alzheimer’s disease and Down syndrome. J. Neural Transm. Suppl., 57, 323–335 (1999).
• 49) Won J, Kim DY, La M, Kim D, Meadows GG, Joe CO. Cleavage of 14-3-3 protein by caspase-3 facilitates bad interaction with Bcl-x(L) during apoptosis. J. Biol. Chem., 278, 19347–19351 (2003).
• 50) Gu Q, Cuevas E, Raymick J, Kanungo J, Sarkar S. Downregulation of 14-3-3 proteins in Alzheimer’s disease. Mol. Neurobiol., 57, 32–40 (2020).
• 51) Wang JZ, Liu F. Microtubule-associated protein tau in development, degeneration and protection of neurons. Prog. Neurobiol., 85, 148–175 (2008).
• 52) Li Y, Dong Y, Meng L, Yu P, Zhao P, Gong M, Gao Q, Shi H, Meng C, Gao Y. Effects of exogenous biliverdin treatment on neurobehaviors in mice. Biol. Pharm. Bull., 44, 325–331 (2021).